GGRNA Home | Help | Advanced search

2018-11-22 03:57:50, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_015045               6302 bp    mRNA    linear   PRI 15-JUN-2013
DEFINITION  Homo sapiens wings apart-like homolog (Drosophila) (WAPAL), mRNA.
ACCESSION   NM_015045 XM_290471
VERSION     NM_015045.2  GI:93102362
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 6302)
  AUTHORS   Wu,N., Kong,X., Ji,Z., Zeng,W., Potts,P.R., Yokomori,K. and Yu,H.
  TITLE     Scc1 sumoylation by Mms21 promotes sister chromatid recombination
            through counteracting Wapl
  JOURNAL   Genes Dev. 26 (13), 1473-1485 (2012)
   PUBMED   22751501
  REMARK    GeneRIF: Depletion of Wapl, a negative cohesin regulator, rescues
            sister chromatid homologous recombination defects of
            Mms21-deficient or Scc1 mutant-expressing cells
REFERENCE   2  (bases 1 to 6302)
  AUTHORS   Divaris,K., Monda,K.L., North,K.E., Olshan,A.F., Lange,E.M.,
            Moss,K., Barros,S.P., Beck,J.D. and Offenbacher,S.
  TITLE     Genome-wide association study of periodontal pathogen colonization
  JOURNAL   J. Dent. Res. 91 (7 SUPPL), 21S-28S (2012)
   PUBMED   22699663
REFERENCE   3  (bases 1 to 6302)
  AUTHORS   Terret,M.E., Sherwood,R., Rahman,S., Qin,J. and Jallepalli,P.V.
  TITLE     Cohesin acetylation speeds the replication fork
  JOURNAL   Nature 462 (7270), 231-234 (2009)
   PUBMED   19907496
REFERENCE   4  (bases 1 to 6302)
  AUTHORS   Shintomi,K. and Hirano,T.
  TITLE     Releasing cohesin from chromosome arms in early mitosis: opposing
            actions of Wapl-Pds5 and Sgo1
  JOURNAL   Genes Dev. 23 (18), 2224-2236 (2009)
   PUBMED   19696148
REFERENCE   5  (bases 1 to 6302)
  AUTHORS   Oikawa,K., Akiyoshi,A., Tanaka,M., Takanashi,M., Nishi,H.,
            Isaka,K., Kiseki,H., Idei,T., Tsukahara,Y., Hashimura,N., Mukai,K.
            and Kuroda,M.
  TITLE     Expression of various types of alternatively spliced WAPL
            transcripts in human cervical epithelia
  JOURNAL   Gene 423 (1), 57-62 (2008)
   PUBMED   18662753
  REMARK    GeneRIF: isolated a large number of additional alternatively
            spliced WAPL variants from various cervical epithelia. Each variant
            consists of a variable 5'-terminal region and the conserved
            remainder.
REFERENCE   6  (bases 1 to 6302)
  AUTHORS   Ballif,B.A., Villen,J., Beausoleil,S.A., Schwartz,D. and Gygi,S.P.
  TITLE     Phosphoproteomic analysis of the developing mouse brain
  JOURNAL   Mol. Cell Proteomics 3 (11), 1093-1101 (2004)
   PUBMED   15345747
REFERENCE   7  (bases 1 to 6302)
  AUTHORS   Kwiatkowski,B.A., Ragoczy,T., Ehly,J. and Schubach,W.H.
  TITLE     Identification and cloning of a novel chromatin-associated protein
            partner of Epstein-Barr nuclear protein 2
  JOURNAL   Exp. Cell Res. 300 (1), 223-233 (2004)
   PUBMED   15383329
  REMARK    GeneRIF: FOE encodes a protein of 1227 amino acids with a
            functional bipartite nuclear localization signal, an arginine-rich
            motif, a putative nuclear export signal as well as with three
            highly acidic regions and a predicted coiled-coil domain.
REFERENCE   8  (bases 1 to 6302)
  AUTHORS   Lehner,B. and Sanderson,C.M.
  TITLE     A protein interaction framework for human mRNA degradation
  JOURNAL   Genome Res. 14 (7), 1315-1323 (2004)
   PUBMED   15231747
REFERENCE   9  (bases 1 to 6302)
  AUTHORS   Oikawa,K., Ohbayashi,T., Kiyono,T., Nishi,H., Isaka,K., Umezawa,A.,
            Kuroda,M. and Mukai,K.
  TITLE     Expression of a novel human gene, human wings apart-like (hWAPL),
            is associated with cervical carcinogenesis and tumor progression
  JOURNAL   Cancer Res. 64 (10), 3545-3549 (2004)
   PUBMED   15150110
REFERENCE   10 (bases 1 to 6302)
  AUTHORS   Fallone,C.A.
  TITLE     Epidemiology of the antibiotic resistance of Helicobacter pylori in
            Canada
  JOURNAL   Can. J. Gastroenterol. 14 (10), 879-882 (2000)
   PUBMED   11111111
  REMARK    Review article
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AL731569.18, AB065003.1 and AL844892.5.
            On Apr 21, 2006 this sequence version replaced gi:42734324.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB065003.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-417               AL731569.18        50443-50859         c
            418-3814            AB065003.1         421-3817
            3815-3819           AL844892.5         138164-138168       c
            3820-5138           AB065003.1         3823-5141
            5139-6302           AL844892.5         130111-131274       c
FEATURES             Location/Qualifiers
     source          1..6302
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="10"
                     /map="10q23.2"
     gene            1..6302
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /note="wings apart-like homolog (Drosophila)"
                     /db_xref="GeneID:23063"
                     /db_xref="HGNC:23293"
                     /db_xref="HPRD:11072"
                     /db_xref="MIM:610754"
     exon            1..420
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    86..88
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /note="upstream in-frame stop codon"
     variation       198
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2289738"
     exon            421..941
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /inference="alignment:Splign:1.39.8"
     CDS             443..4015
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /note="friend of EBNA2 (Epstein-Barr virus nuclear protein
                     2); friend of EBNA2 protein"
                     /codon_start=1
                     /product="wings apart-like protein homolog"
                     /protein_id="NP_055860.1"
                     /db_xref="GI:42734325"
                     /db_xref="CCDS:CCDS7375.1"
                     /db_xref="GeneID:23063"
                     /db_xref="HGNC:23293"
                     /db_xref="HPRD:11072"
                     /db_xref="MIM:610754"
                     /translation="
MTSRFGKTYSRKGGNGSSKFDEVFSNKRTTLSTKWGETTFMAKLGQKRPNFKPDIQEIPKKPKVEEESTGDPFGFDSDDESLPVSSKNLAQVKCSSYSESSEAAQLEEVTSVLEANSKISHVVVEDTVVSDKCFPLEDTLLGKEKSTNRIVEDDASISSCNKLITSDKVENFHEEHEKNSHHIHKNADDSTKKPNAETTVASEIKETNDTWNSQFGKRPESPSEISPIKGSVRTGLFEWDNDFEDIRSEDCILSLDSDPLLEMKDDDFKNRLENLNEAIEEDIVQSVLRPTNCRTYCRANKTKSSQGASNFDKLMDGTSQALAKANSESSKDGLNQAKKGGVSCGTSFRGTVGRTRDYTVLHPSCLSVCNVTIQDTMERSMDEFTASTPADLGEAGRLRKKADIATSKTTTRFRPSNTKSKKDVKLEFFGFEDHETGGDEGGSGSSNYKIKYFGFDDLSESEDDEDDDCQVERKTSKKRTKTAPSPSLQPPPESNDNSQDSQSGTNNAENLDFTEDLPGVPESVKKPINKQGDKSKENTRKIFSGPKRSPTKAVYNARHWNHPDSEELPGPPVVKPQSVTVRLSSKEPNQKDDGVFKAPAPPSKVIKTVTIPTQPYQDIVTALKCRREDKELYTVVQHVKHFNDVVEFGENQEFTDDIEYLLSGLKSTQPLNTRCLSVISLATKCAMPSFRMHLRAHGMVAMVFKTLDDSQHHQNLSLCTAALMYILSRDRLNMDLDRASLDLMIRLLELEQDASSAKLLNEKDMNKIKEKIRRLCETVHNKHLDLENITTGHLAMETLLSLTSKRAGDWFKEELRLLGGLDHIVDKVKECVDHLSRDEDEEKLVASLWGAERCLRVLESVTVHNPENQSYLIAYKDSQLIVSSAKALQHCEELIQQYNRAEDSICLADSKPLPHQNVTNHVGKAVEDCMRAIIGVLLNLTNDNEWGSTKTGEQDGLIGTALNCVLQVPKYLPQEQRFDIRVLGLGLLINLVEYSARNRHCLVNMETSCSFDSSICSGEGDDSLRIGGQVHAVQALVQLFLERERAAQLAESKTDELIKDAPTTQHDKSGEWQETSGEIQWVSTEKTDGTEEKHKKEEEDEELDLNKALQHAGKHMEDCIVASYTALLLGCLCQESPINVTTVREYLPEGDFSIMTEMLKKFLSFMNLTCAVGTTGQKSISRVIEYLEHC
"
     misc_feature    443..2419
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q7Z5K2.1);
                     Region: Mediates interaction with the cohesin complex"
     misc_feature    467..469
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    659..667
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q7Z5K2.1);
                     Region: FGF motif 1"
     misc_feature    671..673
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q7Z5K2.1); phosphorylation site"
     misc_feature    671..673
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /citation=[6]
     misc_feature    671..673
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    944..946
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-acetyllysine; propagated from
                     UniProtKB/Swiss-Prot (Q7Z5K2.1); acetylation site"
     misc_feature    1103..1105
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q7Z5K2.1); phosphorylation site"
     misc_feature    1103..1105
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    1109..1111
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q7Z5K2.1); phosphorylation site"
     misc_feature    1109..1111
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    1118..1120
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q7Z5K2.1); phosphorylation site"
     misc_feature    1118..1120
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    1580..1582
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q7Z5K2.1); phosphorylation site"
     misc_feature    1727..1735
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q7Z5K2.1);
                     Region: FGF motif 2"
     misc_feature    1796..1798
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    1799..1807
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q7Z5K2.1);
                     Region: FGF motif 3"
     misc_feature    1817..1819
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q7Z5K2.1); phosphorylation site"
     misc_feature    1817..1819
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    1823..1825
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q7Z5K2.1); phosphorylation site"
     misc_feature    1823..1825
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    2348..3439
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /note="Wings apart-like protein regulation of
                     heterochromatin; Region: WAPL; pfam07814"
                     /db_xref="CDD:191860"
     misc_feature    3152..3154
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q7Z5K2.1); phosphorylation site"
     variation       790
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34053295"
     exon            942..1967
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /inference="alignment:Splign:1.39.8"
     variation       1607
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35436708"
     exon            1968..2086
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /inference="alignment:Splign:1.39.8"
     exon            2087..2182
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /inference="alignment:Splign:1.39.8"
     exon            2183..2335
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /inference="alignment:Splign:1.39.8"
     exon            2336..2472
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /inference="alignment:Splign:1.39.8"
     exon            2473..2584
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /inference="alignment:Splign:1.39.8"
     exon            2585..2812
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /inference="alignment:Splign:1.39.8"
     exon            2813..2924
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /inference="alignment:Splign:1.39.8"
     exon            2925..3022
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /inference="alignment:Splign:1.39.8"
     exon            3023..3099
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /inference="alignment:Splign:1.39.8"
     exon            3100..3275
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /inference="alignment:Splign:1.39.8"
     exon            3276..3391
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /inference="alignment:Splign:1.39.8"
     STS             3332..3456
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /standard_name="MARC_12283-12284:1005150312:1"
                     /db_xref="UniSTS:267395"
     exon            3392..3556
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /inference="alignment:Splign:1.39.8"
     exon            3557..3764
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /inference="alignment:Splign:1.39.8"
     exon            3765..3853
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /inference="alignment:Splign:1.39.8"
     exon            3854..3949
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /inference="alignment:Splign:1.39.8"
     exon            3950..6302
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /inference="alignment:Splign:1.39.8"
     STS             4030..4261
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /standard_name="RH79889"
                     /db_xref="UniSTS:88017"
     variation       5134
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202046975"
     variation       5665
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1896513"
     STS             5968..6052
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /standard_name="RH68106"
                     /db_xref="UniSTS:56945"
     STS             5989..6201
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /standard_name="RH130055"
                     /db_xref="UniSTS:213343"
     variation       6214
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:15299"
     polyA_signal    6279..6284
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
     polyA_site      6302
                     /gene="WAPAL"
                     /gene_synonym="FOE; KIAA0261; WAPL"
ORIGIN      
gcgagcggctgttggaggaaggaggtgggggccgggagcgcaaatggcgttgagatggttcagggccctgttcaaactccagcactgaccattcaccggcggaagcggcggcgcaggaggcggcggcggcccagcgggggcacacagcaggctctgttaccagctccagcagtggcggccagcgagagctaggcctgggcccggccggcggcgctcgaggcggggagggaagttgcggggccgccgctcctgcccccccaaccgggcttcctatttaccgaaagcagagtccctcgcctctctcggctctcacctgccggccctgctctcccgcgcgagggttccgcgcccgcccgcgggccgtagggagcgggagaggcggaggcggcccgtggccaaagcacccgccaggctccgaggagaatatgaaactggtgtcaaaatgacatccagatttgggaaaacatacagtaggaaaggtggaaatggcagttcaaaattcgatgaagtcttttccaacaaacggactacccttagcacaaaatggggagagaccacatttatggctaaattagggcagaagaggcccaatttcaaaccagatatccaagaaattccgaagaaacctaaagtggaagaagaaagtactggagatccttttggatttgatagtgatgatgagtctctaccagtttcttcaaagaatttagcccaggttaagtgttcctcttattcagaatctagtgaagctgctcagttggaagaggtcacttcagtacttgaagctaatagcaaaattagtcatgtggtcgttgaagacactgtcgtttctgataaatgcttccctttggaggacactttacttgggaaagaaaagagcacaaaccgaattgtagaagatgatgcaagcataagtagctgtaataaattaataacttcagataaagtggagaattttcatgaagaacatgaaaagaatagtcaccatattcacaaaaatgctgatgacagtactaagaaacccaatgcagaaactacagtggcttctgaaatcaaggaaacaaatgatacttggaactcccagtttgggaaaaggccagaatcaccatcagaaatatctccaatcaagggatctgttagaactggtttgtttgaatgggataatgattttgaagatatcagatcagaagactgtattttaagtttggatagtgatccccttttggagatgaaggatgacgattttaaaaatcgattggaaaatctgaatgaagccattgaggaagatattgtacaaagtgttcttaggccaaccaactgtaggacgtactgtagggccaataaaacgaaatcctcccaaggagcatcaaattttgataagctgatggacggcaccagtcaggccttagccaaagcaaacagtgaatcgagtaaagatggcctgaatcaggcaaagaaagggggtgtaagttgtgggaccagttttagagggacagttggacggactagagattacactgttttacatccatcttgcttgtcagtttgtaatgttaccatacaggatactatggaacgcagcatggatgagttcactgcatccactcctgcagatttgggagaagctggtcgtctcagaaaaaaggcagatattgcaacttctaagactactactagatttcgacctagtaatactaaatccaaaaaggatgttaaacttgaattttttggttttgaagatcatgagacaggaggtgatgaaggaggttctggaagttctaattacaaaattaagtattttggctttgatgatctcagtgaaagcgaagatgatgaagatgatgactgtcaagtagaaagaaagacaagcaaaaaaagaactaaaacagctccatcaccctccttgcagcctcccccagaaagcaatgataattcccaggacagtcagtctggtactaacaatgcagaaaacttggattttacagaggacttgcctggtgtgcctgaaagtgtgaagaagcccataaataaacaaggagataaatcaaaggaaaataccagaaagatttttagtggccccaaacggtcacccacaaaagctgtatataatgccagacattggaatcatccagattcagaagaactgcctgggccaccagtagtaaaacctcagagtgtcacagtgaggctgtcttcaaaggaaccaaatcaaaaagatgatggagtttttaaggctcctgcaccaccatccaaagtgataaaaactgtgacaatacctactcagccctaccaagatatagttactgcactgaaatgcagacgagaagacaaagaattatatactgttgttcagcacgtgaagcacttcaacgatgttgtagaatttggtgaaaatcaagagttcactgatgacattgagtacttgttaagtggcttaaagagcactcagcctctaaacacacgttgccttagtgttattagcttggctactaaatgtgccatgcccagttttcgaatgcacctgagagcacatgggatggtagcaatggtctttaaaaccttggatgattcccagcaccatcagaatctgtccctctgtacagctgccctcatgtatatactgagtagagatcgtttgaacatggatcttgatagagctagcttagatctaatgattcgacttttggaactggaacaagatgcttcatcagccaagctactgaatgaaaaagacatgaacaaaattaaagaaaaaatccgaaggctctgtgaaactgtacacaacaagcatcttgatctagaaaatataacgactgggcatttagctatggagacattattatcccttacttctaaacgagcaggagactggtttaaagaagaactccggcttttgggtggtctggatcatattgtagataaagtaaaagaatgtgtggatcatttaagtagagatgaggatgaagagaaactggtagcctcactatggggagcagagagatgtttacgagttttagaaagtgtaactgtgcataatcccgaaaatcaaagctacttgatagcatataaagattcccaacttattgtttcatcagctaaagcattacagcattgtgaagaactgattcagcagtacaaccgtgctgaggacagcatatgcttagctgacagtaagcctctgcctcaccagaatgtaactaaccatgtaggcaaagcagtggaggactgcatgagggccatcatcggggtgttgcttaatttaactaatgataatgagtggggcagcaccaaaacaggagagcaggacggtctcataggcacagcgctgaactgtgtgcttcaggttccaaagtacctacctcaggagcagagatttgatattcgagtgctgggcttaggtctgctgataaatctagtggagtatagtgctcggaatcggcactgtcttgtcaacatggaaacatcgtgctcttttgattcttccatctgtagtggagaaggggatgatagtttaaggataggtggacaagttcatgctgtccaggctttagtgcagctattccttgagcgagagcgggcagcccagctagcagaaagtaaaacagatgagttgatcaaagatgctcccaccactcagcatgataagagtggagagtggcaagaaacaagtggagaaatacagtgggtgtcaactgaaaagactgatggtacagaagagaaacataagaaggaggaggaggatgaagaacttgacctcaataaagcccttcagcatgccggcaaacacatggaggattgcattgtggcctcctacacagcactacttcttgggtgtctctgccaggaaagtccaatcaatgtaaccactgtgcgggaatatctgccagaaggagacttttcaataatgacagagatgctcaaaaaatttttgagttttatgaatctcacttgtgctgttggaacaactggccagaaatctatctctagagtgattgaatatttggaacattgctagctgctttacctttgcttcaggtgctcggtaatgctggagctatccttagacaaagaaaagtcaagtcatgaaagaagtccttgaagatataccaagaacattcatcagtatcattcgtgtttggatttttaaggccacctgatttcttcgtcatgcattcggcatttgctaaatgacagttactacatcaatctgcaactatcaaaaatgaggggaaaaggttcaggctgttaacaattccatgcagtatttaaatacatttactttggcagagtttataccctccccttgttttcttgctttattctgggcaagtttgaaggggaaaatttgtgctgctgttagtgcaactgctgtgtatgttgagccactgttgtcatgccagccaggtgcaaaggcagcttagctactgaggtagcgaatgttctgaggacattctagacaacagcttagttcctttttcaggctcatttgcttttgcttttttgttgaatgattccaatcgtaaataaagcttttaataattttgtgaattttttggttgttgttccctgaactactgtctatatttaaaattagatggaatccaaagatacacgggattaatagtatatttttttattcttgattaggtttgggttattgaactattttttacttttgagaccacaaccatattcaatatcataccataatgtgtcatagctataggcacaagaaaaacaacagtttgagagaatattatataagatgatgtgccctgttaaaaggaggaggcaaaatagtcaaacccagggtagtttacacttaatgctagggaggctcttaaaacattattagattttgaggaaagactctctagatatattttctaatgttcagtacaataaatataaggaagctaaaacaccaatgtggaattcctgtttccagataacatgtatattcttctatagagtgacaggatcaattgcataagcgcaaagccttaaattgctggtttagagaagacccttttttcattcagattctttgttcgtagagcagttatttgaaaaacagttatggaacacaaaacattttatagatttaatatcataacattgcaaatttttcttgtattattcacaccactggttatacttttttttttccttttttattgattgggcctgaatacaggctttctagagatctttttcattaatacttttaaatacctttcaggtagttacatcatgtttcttcattggatttgtaaaacttgaagccataaaaatattagtttggtgtgtattggggaaaatagctaaaagtctaatttttacccatttagactttgttatttccttgtataaagtgacaaatcggggctcttgtatcagtgccagctgtaatgtttttaaatgcagtggctgccttctattgtcttcctatttttgataatgcagattgttgggaaatctgtaaggaagtaactgattccaggcaaattgttttcttccttctacccaccccaacccctacccatcaccttttaagaacatagtacgccagtgtaacgtgggaaccattgagattgtatttgccctgagtattaaagctagcttagcaaaatacttttaaaaacatattggtaaatgatacccgtaaaattaaattagttatattttattttaaaatgcaaaatacattgatatttattaatcattggatttagggaaagggacagatttttggtgaacctgacttgtggcagatggtaaggaatattataaaacatttggatgagaacaatcagggcgaactgcatttttctgttacactggtaatcatttgaaaattgatttacctcagtgtttaacagttttttgttttgttttgttttttaaataataactaattgtcgagcactgatagagatgcagattttggtggggggaggtggtgggggagataatcacttcaccaactgcagtgcatttgtgtgtttttaaccctcagagaactctgcattttagggtacttgaggctgacttaactaaaagttttaaagtaaccttttttccattgtaaatatttctgtaaatactaccaattggaaattagaacagtagagtacttttctgaatccaatcctatttttattttatacagtatttctcagctgtgatctttggagcaaaagccaacggcaggaaaaaatagtttgtaccagtttcatgaagtatgtctttgggtttttgtaaataattttaactcaaataaaattgctactttcaataca
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:23063 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:23063 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: TAS
            GeneID:23063 -> Biological process: GO:0000910 [cytokinesis] evidence: TAS
            GeneID:23063 -> Biological process: GO:0007067 [mitosis] evidence: IEA
            GeneID:23063 -> Biological process: GO:0008156 [negative regulation of DNA replication] evidence: IMP
            GeneID:23063 -> Biological process: GO:0009636 [response to toxic substance] evidence: IEA
            GeneID:23063 -> Biological process: GO:0019048 [modulation by virus of host morphology or physiology] evidence: IEA
            GeneID:23063 -> Biological process: GO:0035562 [negative regulation of chromatin binding] evidence: IMP
            GeneID:23063 -> Biological process: GO:0045875 [negative regulation of sister chromatid cohesion] evidence: IMP
            GeneID:23063 -> Biological process: GO:0071168 [protein localization to chromatin] evidence: IMP
            GeneID:23063 -> Biological process: GO:0071922 [regulation of cohesin localization to chromatin] evidence: IMP
            GeneID:23063 -> Cellular component: GO:0000775 [chromosome, centromeric region] evidence: TAS
            GeneID:23063 -> Cellular component: GO:0000785 [chromatin] evidence: IDA
            GeneID:23063 -> Cellular component: GO:0000795 [synaptonemal complex] evidence: IEA
            GeneID:23063 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:23063 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
            GeneID:23063 -> Cellular component: GO:0005694 [chromosome] evidence: TAS
            GeneID:23063 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
            GeneID:23063 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:23063 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
            GeneID:23063 -> Cellular component: GO:0008278 [cohesin complex] evidence: IDA
            GeneID:23063 -> Cellular component: GO:0015630 [microtubule cytoskeleton] evidence: IDA
            GeneID:23063 -> Cellular component: GO:0043231 [intracellular membrane-bounded organelle] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.