GGRNA Home | Help | Advanced search

2019-03-23 03:29:10, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_014981               7074 bp    mRNA    linear   PRI 11-MAY-2013
DEFINITION  Homo sapiens myosin, heavy chain 15 (MYH15), mRNA.
ACCESSION   NM_014981 XM_036988 XM_938225
VERSION     NM_014981.1  GI:150010557
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 7074)
  AUTHORS   Martins-de-Souza,D., Guest,P.C., Mann,D.M., Roeber,S., Rahmoune,H.,
            Bauder,C., Kretzschmar,H., Volk,B., Baborie,A. and Bahn,S.
  TITLE     Proteomic analysis identifies dysfunction in cellular transport,
            energy, and protein metabolism in different brain regions of
            atypical frontotemporal lobar degeneration
  JOURNAL   J. Proteome Res. 11 (4), 2533-2543 (2012)
   PUBMED   22360420
  REMARK    GeneRIF: A protein encoded by this locus was found to be
            differentially expressed in postmortem brains from patients with
            atypical frontotemporal lobar degeneration.
REFERENCE   2  (bases 1 to 7074)
  AUTHORS   Oudot-Mellakh,T., Cohen,W., Germain,M., Saut,N., Kallel,C.,
            Zelenika,D., Lathrop,M., Tregouet,D.A. and Morange,P.E.
  TITLE     Genome wide association study for plasma levels of natural
            anticoagulant inhibitors and protein C anticoagulant pathway: the
            MARTHA project
  JOURNAL   Br. J. Haematol. 157 (2), 230-239 (2012)
   PUBMED   22443383
REFERENCE   3  (bases 1 to 7074)
  AUTHORS   Rossi,A.C., Mammucari,C., Argentini,C., Reggiani,C. and
            Schiaffino,S.
  TITLE     Two novel/ancient myosins in mammalian skeletal muscles: MYH14/7b
            and MYH15 are expressed in extraocular muscles and muscle spindles
  JOURNAL   J. Physiol. (Lond.) 588 (PT 2), 353-364 (2010)
   PUBMED   19948655
  REMARK    GeneRIF: MYH15, the ortholog of the ventricular MYH of frogs and
            birds, is selectively expressed at the transcript level in the
            extraocular muscles.
REFERENCE   4  (bases 1 to 7074)
  AUTHORS   Luke,M.M., O'Meara,E.S., Rowland,C.M., Shiffman,D., Bare,L.A.,
            Arellano,A.R., Longstreth,W.T. Jr., Lumley,T., Rice,K., Tracy,R.P.,
            Devlin,J.J. and Psaty,B.M.
  TITLE     Gene variants associated with ischemic stroke: the cardiovascular
            health study
  JOURNAL   Stroke 40 (2), 363-368 (2009)
   PUBMED   19023099
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   5  (bases 1 to 7074)
  AUTHORS   Luke,M.M., Lalouschek,W., Rowland,C.M., Catanese,J.J.,
            Bolonick,J.I., Bui,N.D., Greisenegger,S., Endler,G., Devlin,J.J.
            and Mannhalter,C.
  TITLE     Polymorphisms associated with both noncardioembolic stroke and
            coronary heart disease: vienna stroke registry
  JOURNAL   Cerebrovasc. Dis. 28 (5), 499-504 (2009)
   PUBMED   19752551
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   6  (bases 1 to 7074)
  AUTHORS   Shiffman,D., O'Meara,E.S., Bare,L.A., Rowland,C.M., Louie,J.Z.,
            Arellano,A.R., Lumley,T., Rice,K., Iakoubova,O., Luke,M.M.,
            Young,B.A., Malloy,M.J., Kane,J.P., Ellis,S.G., Tracy,R.P.,
            Devlin,J.J. and Psaty,B.M.
  TITLE     Association of gene variants with incident myocardial infarction in
            the Cardiovascular Health Study
  JOURNAL   Arterioscler. Thromb. Vasc. Biol. 28 (1), 173-179 (2008)
   PUBMED   17975119
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   7  (bases 1 to 7074)
  AUTHORS   Bare,L.A., Morrison,A.C., Rowland,C.M., Shiffman,D., Luke,M.M.,
            Iakoubova,O.A., Kane,J.P., Malloy,M.J., Ellis,S.G., Pankow,J.S.,
            Willerson,J.T., Devlin,J.J. and Boerwinkle,E.
  TITLE     Five common gene variants identify elevated genetic risk for
            coronary heart disease
  JOURNAL   Genet. Med. 9 (10), 682-689 (2007)
   PUBMED   18073581
  REMARK    GeneRIF: Observational study of gene-disease association and
            gene-gene interaction. (HuGE Navigator)
REFERENCE   8  (bases 1 to 7074)
  AUTHORS   McGuigan,K., Phillips,P.C. and Postlethwait,J.H.
  TITLE     Evolution of sarcomeric myosin heavy chain genes: evidence from
            fish
  JOURNAL   Mol. Biol. Evol. 21 (6), 1042-1056 (2004)
   PUBMED   15014174
REFERENCE   9  (bases 1 to 7074)
  AUTHORS   Stedman,H.H., Kozyak,B.W., Nelson,A., Thesier,D.M., Su,L.T.,
            Low,D.W., Bridges,C.R., Shrager,J.B., Minugh-Purvis,N. and
            Mitchell,M.A.
  TITLE     Myosin gene mutation correlates with anatomical changes in the
            human lineage
  JOURNAL   Nature 428 (6981), 415-418 (2004)
   PUBMED   15042088
REFERENCE   10 (bases 1 to 7074)
  AUTHORS   Desjardins,P.R., Burkman,J.M., Shrager,J.B., Allmond,L.A. and
            Stedman,H.H.
  TITLE     Evolutionary implications of three novel members of the human
            sarcomeric myosin heavy chain gene family
  JOURNAL   Mol. Biol. Evol. 19 (4), 375-393 (2002)
   PUBMED   11919279
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AB023217.3, AC069499.17 and AK126801.1.
            On or before Jun 30, 2007 this sequence version replaced
            gi:113414591, gi:113415158.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB023217.3 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1566              AB023217.3         1-1566
            1567-1569           AC069499.17        116580-116582
            1570-2744           AB023217.3         1570-2744
            2745-2851           AK126801.1         680-786
            2852-3603           AB023217.3         2852-3603
            3604-4853           AK126801.1         1539-2788
            4854-7074           AB023217.3         4854-7074
FEATURES             Location/Qualifiers
     source          1..7074
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="3"
                     /map="3q13.13"
     gene            1..7074
                     /gene="MYH15"
                     /note="myosin, heavy chain 15"
                     /db_xref="GeneID:22989"
                     /db_xref="HGNC:31073"
                     /db_xref="MIM:609929"
     exon            1..60
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    25..27
                     /gene="MYH15"
                     /note="upstream in-frame stop codon"
     CDS             58..5898
                     /gene="MYH15"
                     /note="myosin, heavy polypeptide 15; myosin-15"
                     /codon_start=1
                     /product="myosin-15 precursor"
                     /protein_id="NP_055796.1"
                     /db_xref="GI:150010558"
                     /db_xref="CCDS:CCDS43127.1"
                     /db_xref="GeneID:22989"
                     /db_xref="HGNC:31073"
                     /db_xref="MIM:609929"
                     /translation="
MVESCLLTFRAFFWWIALIKMDLSDLGEAAAFLRRSEAELLLLQATALDGKKKCWIPDGENAYIEAEVKGSEDDGTVIVETADGESLSIKEDKIQQMNPPEFEMIEDMAMLTHLNEASVLHTLKRRYGQWMIYTYSGLFCVTINPYKWLPVYQKEVMAAYKGKRRSEAPPHIFAVANNAFQDMLHNRENQSILFTGESGAGKTVNSKHIIQYFATIAAMIESRKKQGALEDQIMQANTILEAFGNAKTLRNDNSSRFGKFIRMHFGARGMLSSVDIDIYLLEKSRVIFQQAGERNYHIFYQILSGQKELHDLLLVSANPSDFHFCSCGAVTVESLDDAEELLATEQAMDILGFLPDEKYGCYKLTGAIMHFGNMKFKQKPREEQLEADGTENADKAAFLMGINSSELVKCLIHPRIKVGNEYVTRGQTIEQVTCAVGALSKSMYERMFKWLVARINRALDAKLSRQFFIGILDITGFEILEYNSLEQLCINFTNEKLQQFFNWHMFVLEQEEYKKESIEWVSIGFGLDLQACIDLIEKPMGILSILEEECMFPKATDLTFKTKLFDNHFGKSVHLQKPKPDKKKFEAHFELVHYAGVVPYNISGWLEKNKDLLNETVVAVFQKSSNRLLASLFENYMSTDSAIPFGEKKRKKGASFQTVASLHKENLNKLMTNLKSTAPHFVRCINPNVNKIPGILDPYLVLQQLRCNGVLEGTRICREGFPNRLQYADFKQRYCILNPRTFPKSKFVSSRKAAEELLGSLEIDHTQYRFGITKVFFKAGFLGQLEAIRDERLSKVFTLFQARAQGKLMRIKFQKILEERDALILIQWNIRAFMAVKNWPWMRLFFKIKPLVKSSEVGEEVAGLKEECAQLQKALEKSEFQREELKAKQVSLTQEKNDLILQLQAEQETLANVEEQCEWLIKSKIQLEARVKELSERVEEEEEINSELTARGRKLEDECFELKKEIDDLETMLVKSEKEKRTTEHKVKNLTEEVEFLNEDISKLNRAAKVVQEAHQQTLDDLHMEEEKLSSLSKANLKLEQQVDELEGALEQERKARMNCERELHKLEGNLKLNRESMENLESSQRHLAEELRKKELELSQMNSKVENEKGLVAQLQKTVKELQTQIKDLKEKLEAERTTRAKMERERADLTQDLADLNERLEEVGGSSLAQLEITKKQETKFQKLHRDMEEATLHFETTSASLKKRHADSLAELEGQVENLQQVKQKLEKDKSDLQLEVDDLLTRVEQMTRAKANAEKLCTLYEERLHEATAKLDKVTQLANDLAAQKTKLWSESGEFLRRLEEKEALINQLSREKSNFTRQIEDLRGQLEKETKSQSALAHALQKAQRDCDLLREQYEEEQEVKAELHRTLSKVNAEMVQWRMKYENNVIQRTEDLEDAKKELAIRLQEAAEAMGVANARNASLERARHQLQLELGDALSDLGKVRSAAARLDQKQLQSGKALADWKQKHEESQALLDASQKEVQALSTELLKLKNTYEESIVGQETLRRENKNLQEEISNLTNQVREGTKNLTEMEKVKKLIEEEKTEVQVTLEETEGALERNESKILHFQLELLEAKAELERKLSEKDEEIENFRRKQQCTIDSLQSSLDSEAKSRIEVTRLKKKMEEDLNEMELQLSCANRQVSEATKSLGQLQIQIKDLQMQLDDSTQLNSDLKEQVAVAERRNSLLQSELEDLRSLQEQTERGRRLSEEELLEATERINLFYTQNTSLLSQKKKLEADVARMQKEAEEVVQECQNAEEKAKKAAIEAANLSEELKKKQDTIAHLERTRENMEQTITDLQKRLAEAEQMALMGSRKQIQKLESRVRELEGELEGEIRRSAEAQRGARRLERCIKELTYQAEEDKKNLSRMQTQMDKLQLKVQNYKQQVEVAETQANQYLSKYKKQQHELNEVKERAEVAESQVNKLKIKAREFGKKVQEE
"
     sig_peptide     58..144
                     /gene="MYH15"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     misc_feature    208..333
                     /gene="MYH15"
                     /note="Myosin N-terminal SH3-like domain; Region:
                     Myosin_N; pfam02736"
                     /db_xref="CDD:111612"
     misc_feature    349..2427
                     /gene="MYH15"
                     /note="Myosin. Large ATPases; Region: MYSc; smart00242"
                     /db_xref="CDD:197599"
     misc_feature    352..2424
                     /gene="MYH15"
                     /note="Myosin motor domain, type II myosins. Myosin II
                     mediates cortical contraction in cell motility, and is the
                     motor in smooth and skeletal muscle. This catalytic (head)
                     domain has ATPase activity and belongs to the larger group
                     of P-loop NTPases. Myosins...; Region: MYSc_type_II;
                     cd01377"
                     /db_xref="CDD:30099"
     misc_feature    order(487..498,502..507,649..672)
                     /gene="MYH15"
                     /note="ATP-binding site [chemical binding]; other site"
                     /db_xref="CDD:30099"
     misc_feature    814..831
                     /gene="MYH15"
                     /note="switch I region; other site"
                     /db_xref="CDD:30099"
     misc_feature    1477..1500
                     /gene="MYH15"
                     /note="switch II region; other site"
                     /db_xref="CDD:30099"
     misc_feature    order(1561..1596,1603..1632)
                     /gene="MYH15"
                     /note="relay loop; other site"
                     /db_xref="CDD:30099"
     misc_feature    2056..2124
                     /gene="MYH15"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Y2K3.5);
                     Region: Actin-binding (By similarity)"
     misc_feature    2176..2220
                     /gene="MYH15"
                     /note="SH1 helix; other site"
                     /db_xref="CDD:30099"
     misc_feature    order(2215..2220,2227..2229,2245..2247,2254..2259,
                     2266..2268,2359..2361,2368..2370,2374..2379,2383..2391,
                     2401..2403,2410..2418)
                     /gene="MYH15"
                     /note="converter subdomain; other site"
                     /db_xref="CDD:30099"
     misc_feature    2362..2406
                     /gene="MYH15"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Y2K3.5);
                     Region: Actin-binding (By similarity)"
     misc_feature    3355..5868
                     /gene="MYH15"
                     /note="Myosin tail; Region: Myosin_tail_1; pfam01576"
                     /db_xref="CDD:144972"
     misc_feature    3430..3432
                     /gene="MYH15"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    5245..5247
                     /gene="MYH15"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    5254..5256
                     /gene="MYH15"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    5257..5259
                     /gene="MYH15"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     exon            61..205
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            206..312
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            313..456
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            457..613
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            614..641
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            642..735
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            736..828
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            829..892
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            893..988
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            989..1092
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            1093..1231
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            1232..1350
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            1351..1500
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            1501..1671
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            1672..1848
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            1849..1981
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            1982..2049
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            2050..2137
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            2138..2255
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            2256..2379
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            2380..2516
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            2517..2772
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     variation       2564
                     /gene="MYH15"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:74614944"
     exon            2773..3015
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            3016..3192
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            3193..3338
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            3339..3429
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            3430..3819
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            3820..3946
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            3947..4065
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            4066..4262
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            4263..4612
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     variation       4456
                     /gene="MYH15"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1078456"
     exon            4613..4737
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            4738..4853
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            4854..5046
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            5047..5250
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            5251..5376
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            5377..5547
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            5548..5652
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            5653..5748
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            5749..5883
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
     exon            5884..7074
                     /gene="MYH15"
                     /inference="alignment:Splign:1.39.8"
ORIGIN      
catttctacttcatatgatcattttaattgtatttacctcatcttaccaaaaagatcatggttgaatcttgcctactcacgtttagggcctttttttggtggattgctttaataaagatggatctgtcagaccttggagaagccgcagccttcctcagaagaagtgaagctgagctgcttctactacaggccacagccttggatgggaagaagaaatgctggattcctgatggtgagaatgcttatatcgaggctgaggtaaaagggagtgaagatgatggaacagtaattgttgagacagcagatggagagagtctgagcataaaggaggacaaaatccagcagatgaatcctccagagtttgaaatgattgaagacatggcaatgctgactcacctcaatgaggcatccgtgctgcataccctgaagcggcgctatggccagtggatgatctatacatattcaggtctcttctgtgtgaccataaacccttacaaatggcttcccgtgtatcagaaagaagtcatggccgcctacaaagggaagaggcgatcagaggctccccctcacatctttgctgttgccaataacgcctttcaggacatgcttcacaatcgagaaaatcagtctatactcttcacaggagaatctggtgctggaaagactgtgaacagcaaacatattatccagtattttgccaccatagcagccatgattgaatccaggaaaaagcagggggcgttagaagatcaaatcatgcaagcgaatactatcttggaagcatttggaaatgctaaaaccctgagaaatgacaactcctctcgttttggcaaattcatcaggatgcactttggtgccagaggcatgctgtcatctgtggacattgatatctatttgcttgaaaagtccagggtgattttccagcaggctggagagaggaactaccacatattctatcaaattctatctggacaaaaagagcttcatgacctgctcctggtatctgcaaatccctcagacttccacttttgctcctgtggagcagttactgtggagagcttggatgatgctgaagaattgctggccacagaacaagccatggacatcttgggctttcttcctgatgagaagtatggatgctataaactcactggagccatcatgcactttggaaatatgaaatttaaacagaaacctagagaagagcaactggaagcagatggcacagaaaatgctgacaaagctgctttcctcatgggcattaactcctctgagttggtaaagtgcttgatccatcctagaatcaaagttggtaacgaatatgttaccagaggtcaaactatagaacaggtaacctgtgctgtcggtgccctgtccaagtcaatgtatgaaaggatgtttaagtggctagtggcacggatcaacagggccctggatgccaagctgtcaaggcagttcttcattggcattcttgacatcactggttttgaaatccttgagtataatagccttgagcaactttgcattaattttaccaatgaaaaattacaacaattcttcaattggcacatgtttgttctggagcaagaggaatataagaaagaaagcattgaatgggtgtctattggctttggtctggatttgcaagcttgcatagatctcattgagaagccaatgggcatcctttccatccttgaagaagagtgtatgtttcctaaggctacagacctgactttcaagaccaaactctttgacaaccattttggaaagtcggttcatctccagaagcccaagcctgataagaagaaatttgaagctcattttgaacttgtccattatgcaggagtggtaccttataatatcagtggttggctggaaaagaacaaagacctccttaatgaaacagtggtagctgtatttcagaagtcttccaacagactcctggcgagcctttttgaaaattacatgagtactgacagtgctataccatttggggagaagaaacgaaagaaaggagcttcattccaaacggttgcatctctgcataaagaaaacctgaataaattgatgactaatctgaaatcaacagcacctcattttgtgagatgcataaatcccaatgtgaacaaaataccaggtatactggacccttacttggttctacagcagttgcgctgtaatggtgtcttggaagggactaggatatgccgtgaaggttttccaaaccgactgcagtatgctgattttaaacaaaggtactgcattctgaatccaaggacctttccaaagagcaagtttgtgagcagcagaaaagcagctgaagaattacttggctccttggagatagaccatacccagtaccgatttggaatcactaaggtgttttttaaagctgggtttctgggccaactggaagcaataagagatgagagactatctaaagtcttcacattgttccaagccagagcacagggcaaactgatgcgaatcaaattccagaagattctggaagaaagggatgcacttattttgatccaatggaacataagagctttcatggctgtgaagaactggccctggatgaggctcttcttcaagatcaagcctcttgttaaatcttcagaagtaggagaagaagtagctggactgaaggaagagtgtgcacaattacagaaagccttggagaaatcagagtttcagagggaggaactgaaagcaaagcaagtatccctcactcaggaaaaaaatgacctgattcttcagcttcaggctgagcaagagacactggcaaatgttgaagagcagtgcgagtggctgattaaatccaagatccagctggaggccagagtaaaggagctgtcggagagggtggaggaagaagaggagataaattctgagctgactgccagggggcggaaactcgaagatgaatgttttgagttgaagaaagaaatcgatgacctggaaacaatgttggtgaagtcagagaaggagaagcgtactacagagcacaaggtcaagaacttgactgaggaagtagagtttctaaatgaggatatcagcaaacttaacagagcagccaaggttgtgcaggaggcccatcagcagaccctggatgacctgcacatggaggaggagaagctcagcagcctgagcaaagcaaatctgaagctggaacagcaagttgatgagcttgagggtgcccttgagcaggagagaaaagcgagaatgaactgtgaaagggaactgcacaaactggagggcaatttaaagctgaatcgggaaagtatggagaacctggaaagcagccagcgacacctggcagaagagctgaggaaaaaagaattagaattgagtcagatgaattcaaaagtggagaatgagaaaggcctggtagctcagcttcagaagacggttaaagagcttcagactcaaataaaggatttgaaagagaaactagaagctgaaaggaccactcgagccaagatggaaagggagagagctgacctcacccaagacctggctgacttgaatgagaggctggaggaggtaggaggatccagtttggctcagctggaaataactaagaaacaggaaaccaaattccagaagctgcaccgagacatggaagaggccactctgcactttgagacaacttctgcatctttgaagaagagacatgcagacagcctggctgagctcgagggccaggtagaaaatctacagcaggtcaagcagaaactggaaaaagacaagagtgacttgcagctagaagtagatgacctcctgacccgtgttgagcagatgacaagagctaaggcaaatgctgagaaactctgtactctatatgaagagcgcttgcatgaagcaactgcaaagctagataaggtgactcagttggcaaatgacctggcagcacaaaagacaaagctgtggagtgagagtggcgagttcctacggaggcttgaagagaaggaggctctgataaaccaactttccagggaaaagagcaacttcactcggcagattgaagacctgagagggcagctggaaaaggagaccaaatcccagagtgccctggcccatgccctgcagaaggctcagcgtgactgtgaccttctacgagagcagtatgaggaagaacaagaggtcaaggctgagctgcaccggaccttatccaaagtcaatgctgaaatggtgcaatggagaatgaagtatgaaaacaatgtcatccagagaacagaagacttggaggatgccaagaaggaactggcaattagattgcaggaggcagccgaagccatgggggtggccaatgccagaaatgcctccttggagagagccaggcaccagctgcagctggagctcggggacgccctgtctgacctcgggaaggtccgctctgcagcagccaggctggaccagaagcagctgcagtctggcaaggcccttgccgactggaagcagaagcacgaggagtcccaggcgttgctggatgcctctcagaaggaagttcaggctctcagtacagagctcctcaagctcaagaacacctatgaggagagcatcgtgggccaggagacactcaggagggagaacaagaacctccaagaagagatttctaatctgacaaaccaggttagagaagggaccaagaacttaactgaaatggaaaaggtcaagaaactaattgaagaagagaagacagaagtccaggtgacactggaagaaacagagggagccctggaacgtaatgaaagcaagattcttcatttccagcttgaactcttggaagctaaagcagaacttgaaagaaagctttcagagaaagatgaagaaatagaaaattttaggaggaagcagcagtgtaccattgactccctgcagtctagtctggattctgaagctaagagcagaattgaggttacccggctgaagaagaagatggaagaggacctcaatgagatggaactccagcttagctgtgccaaccggcaggtgtcagaagcaaccaaatccctgggccagcttcagattcaaatcaaggaccttcaaatgcagctggatgacagcacacaactgaacagtgatctgaaggagcaggtggctgtggctgagcggcgcaactctcttcttcagtctgaactagaggatctaaggtccctgcaagagcagacagagcgtggccgcaggctgtcagaagaagagctcctggaagcaacagaaagaatcaatcttttctatacccagaacacaagcctcctcagccagaagaagaaactggaggctgatgttgcccggatgcagaaagaagctgaagaggtggtgcaggagtgtcaaaatgcagaagagaaggccaagaaggcagccattgaggcagcaaacttgtcagaagaactgaagaagaagcaagacaccattgcccacttggaaaggacaagagaaaatatggagcagacaattacagacttacagaaaaggctggctgaagctgaacagatggccctgatggggagtagaaagcaaatccagaaactagaatccagggttcgtgaactggaaggtgaactggagggtgaaatccgtcgcagtgcagaggcccagaggggagcccgcagacttgagcgatgcatcaaagagctgacctatcaggcagaggaagacaagaagaatctgagcaggatgcaaactcagatggataaacttcagctaaaagtgcaaaattacaagcagcaagtcgaggtggcggaaacacaagccaatcaatacctttccaagtataagaaacagcaacatgagttgaatgaagtgaaggaaagggcagaggtggcagaatctcaagtcaataaactcaaaattaaagcaagagagtttgggaaaaaggttcaagaagaatagcatcccctgctttgaaaggacaacagctggagaagtacaaggaaggtgctgtttcatggccaaaaacttaggttgcatggaaacatttttaaaaacatgtttaaattgcttttcacaccatataaacaaggcaattagaaaaataattaaagggaatatcattgcttccacagttaatggggattttttgatcctcaaatgcaagtaaactaccttctaatgcttcacatgacagattaaataaatggaagaaccttttcaattctgatgtttaaaaaatgaataaatacttgatcctttgtccatatttcctcttaatgggtaggactcatagaagatgtccttagaccagtcacgcttcatggggactagggcatgttggtgaatggtttttactaaagttaggcaactttggcttgattcacccctaaatctatgaatgtatattgtgagccagcagtggtagaatggaagtcataagatctcctcagcattgtgatataaatatagctatagttaggcaatttgaacatgtaggcaaaactctcctaatcaacacacatgtaggctatatgctggtacatgctttaaacatggaggtaaccccacacgagacattcagtgacaggtaatatgctggatttgtgcagtaccgatttggctcagctggaggaacatgtcccggaattcctctctctcatggttctggattggagtaggtcataaagaaatttgcattaatttgatcagcagctattttatactcataaggtcagtgtacagacccaagcatggtgacagcttgaaaatatgactccaggccaaaaaggggagctagaagagaccagagacagctccctggacccagagctcttccagctcctgccagcctcctccttcagctttgcaaagtactggccaggtgtgtgtgcagctccatggcaaccagcatcagcttttcctgagatcacacacagcattgcagtggaggccgtgagacagacatgggttctgtttgttcttatggacttcccttcatccttgctgcattcacagtcgacctacagtgacttcaggcccagaaccagatgcagagggaacagcctggcctagacttctccaccagcacccacaattgtgtaaggctgaagctctataataaatctttattctgtc
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:22989 -> Molecular function: GO:0003774 [motor activity] evidence: IEA
            GeneID:22989 -> Molecular function: GO:0003779 [actin binding] evidence: IEA
            GeneID:22989 -> Molecular function: GO:0005516 [calmodulin binding] evidence: IEA
            GeneID:22989 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
            GeneID:22989 -> Cellular component: GO:0030016 [myofibril] evidence: IEA
            GeneID:22989 -> Cellular component: GO:0032982 [myosin filament] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.