Home |
Help |
Advanced search
2024-04-26 08:24:18, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_014762 4286 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens 24-dehydrocholesterol reductase (DHCR24), mRNA.
ACCESSION NM_014762
VERSION NM_014762.3 GI:114155130
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 4286)
AUTHORS Wu,B.J., Chen,K., Shrestha,S., Ong,K.L., Barter,P.J. and Rye,K.A.
TITLE High-density lipoproteins inhibit vascular endothelial inflammation
by increasing 3beta-hydroxysteroid-Delta24 reductase expression and
inducing heme oxygenase-1
JOURNAL Circ. Res. 112 (2), 278-288 (2013)
PUBMED 23123430
REMARK GeneRIF: Inflammation is inhibited in coronary artery endothlial
cells by increasing 3beta-hydroxysteroid-Delta24 reductase
expression.
REFERENCE 2 (bases 1 to 4286)
AUTHORS Feher,A., Juhasz,A., Pakaski,M., Kalman,J. and Janka,Z.
TITLE Gender dependent effect of DHCR24 polymorphism on the risk for
Alzheimer's disease
JOURNAL Neurosci. Lett. 526 (1), 20-23 (2012)
PUBMED 22910610
REMARK GeneRIF: a gender dependent effect of DHCR24 rs600491 polymorphism
on the susceptibility to Alzheimer disease.
REFERENCE 3 (bases 1 to 4286)
AUTHORS Zerenturk,E.J., Kristiana,I., Gill,S. and Brown,A.J.
TITLE The endogenous regulator 24(S),25-epoxycholesterol inhibits
cholesterol synthesis at DHCR24 (Seladin-1)
JOURNAL Biochim. Biophys. Acta 1821 (9), 1269-1277 (2012)
PUBMED 22178193
REMARK GeneRIF: a novel role for 24,25EC in cholesterol homeostasis,
through its rapid inhibition of cholesterol synthesis at DHCR24.
REFERENCE 4 (bases 1 to 4286)
AUTHORS Saito,M., Kohara,M. and Tsukiyama-Kohara,K.
TITLE Hepatitis C virus promotes expression of the 3beta-hydroxysterol
delta24-reductase through Sp1
JOURNAL J. Med. Virol. 84 (5), 733-746 (2012)
PUBMED 22431021
REMARK GeneRIF: Activation of Sp1 by oxidative stress is involved in the
promotion of expression of DHCR24 by Hepatitis C virus.
REFERENCE 5 (bases 1 to 4286)
AUTHORS Lu,X., Li,Y., Liu,J., Cao,X., Wang,X., Wang,D., Seo,H. and Gao,B.
TITLE The membrane topological analysis of 3beta-hydroxysteroid-Delta24
reductase (DHCR24) on endoplasmic reticulum
JOURNAL J. Mol. Endocrinol. 48 (1), 1-9 (2012)
PUBMED 22010141
REMARK GeneRIF: DHCR24-overexpressed cells were protected from apoptosis
in response to oxidative stress, which was accompanied by a
decrease in DHCR24 content on the ER and activation of caspase-3.
Publication Status: Online-Only
REFERENCE 6 (bases 1 to 4286)
AUTHORS Luciani,P., Ferruzzi,P., Arnaldi,G., Crescioli,C., Benvenuti,S.,
Nesi,G., Valeri,A., Greeve,I., Serio,M., Mannelli,M. and Peri,A.
TITLE Expression of the novel adrenocorticotropin-responsive gene
selective Alzheimer's disease indicator-1 in the normal adrenal
cortex and in adrenocortical adenomas and carcinomas
JOURNAL J. Clin. Endocrinol. Metab. 89 (3), 1332-1339 (2004)
PUBMED 15001630
REMARK GeneRIF: seladin-1/DHCR24 is modulated by the ACTH/cAMP-driven
pathway and its expression is reduced in adrenal cancer
REFERENCE 7 (bases 1 to 4286)
AUTHORS Andersson,H.C., Kratz,L. and Kelley,R.
TITLE Desmosterolosis presenting with multiple congenital anomalies and
profound developmental delay
JOURNAL Am. J. Med. Genet. 113 (4), 315-319 (2002)
PUBMED 12457401
REFERENCE 8 (bases 1 to 4286)
AUTHORS Waterham,H.R., Koster,J., Romeijn,G.J., Hennekam,R.C., Vreken,P.,
Andersson,H.C., FitzPatrick,D.R., Kelley,R.I. and Wanders,R.J.
TITLE Mutations in the 3beta-hydroxysterol Delta24-reductase gene cause
desmosterolosis, an autosomal recessive disorder of cholesterol
biosynthesis
JOURNAL Am. J. Hum. Genet. 69 (4), 685-694 (2001)
PUBMED 11519011
REFERENCE 9 (bases 1 to 4286)
AUTHORS Greeve,I., Hermans-Borgmeyer,I., Brellinger,C., Kasper,D.,
Gomez-Isla,T., Behl,C., Levkau,B. and Nitsch,R.M.
TITLE The human DIMINUTO/DWARF1 homolog seladin-1 confers resistance to
Alzheimer's disease-associated neurodegeneration and oxidative
stress
JOURNAL J. Neurosci. 20 (19), 7345-7352 (2000)
PUBMED 11007892
REFERENCE 10 (bases 1 to 4286)
AUTHORS Croce,C.M., Kieba,I., Koprowski,H., Molino,M. and Rothblat,G.H.
TITLE Restoration of the conversion of desmosterol to cholesterol in
L-cells after hybridization with human fibroblasts
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 71 (1), 110-113 (1974)
PUBMED 4359325
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from BP200916.1, BC004375.1 and
AC096536.2.
This sequence is a reference standard in the RefSeqGene project.
On Sep 7, 2006 this sequence version replaced gi:56790943.
Summary: This gene encodes a flavin adenine dinucleotide
(FAD)-dependent oxidoreductase which catalyzes the reduction of the
delta-24 double bond of sterol intermediates during cholesterol
biosynthesis. The protein contains a leader sequence that directs
it to the endoplasmic reticulum membrane. Missense mutations in
this gene have been associated with desmosterolosis. Also, reduced
expression of the gene occurs in the temporal cortex of Alzheimer
disease patients and overexpression has been observed in adrenal
gland cancer cells. [provided by RefSeq, Jul 2008].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: D13643.3, AF261758.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-582 BP200916.1 1-582
583-1900 BC004375.1 489-1806
1901-4286 AC096536.2 66340-68725 c
FEATURES Location/Qualifiers
source 1..4286
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="1"
/map="1p32.3"
gene 1..4286
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/note="24-dehydrocholesterol reductase"
/db_xref="GeneID:1718"
/db_xref="HGNC:2859"
/db_xref="HPRD:05916"
/db_xref="MIM:606418"
exon 1..360
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/inference="alignment:Splign:1.39.8"
variation 79
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/replace="g"
/replace="t"
/db_xref="dbSNP:17552526"
CDS 130..1680
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/EC_number="1.3.1.72"
/note="desmosterol-to-cholesterol enzyme; 3
beta-hydroxysterol delta 24-reductase; selective AD
indicator 1; diminuto/dwarf1 homolog; seladin 1;
delta(24)-sterol reductase; 3-beta-hydroxysterol
delta-24-reductase"
/codon_start=1
/product="delta(24)-sterol reductase precursor"
/protein_id="NP_055577.1"
/db_xref="GI:13375618"
/db_xref="CCDS:CCDS600.1"
/db_xref="GeneID:1718"
/db_xref="HGNC:2859"
/db_xref="HPRD:05916"
/db_xref="MIM:606418"
/translation="
MEPAVSLAVCALLFLLWVRLKGLEFVLIHQRWVFVCLFLLPLSLIFDIYYYVRAWVVFKLSSAPRLHEQRVRDIQKQVREWKEQGSKTFMCTGRPGWLTVSLRVGKYKKTHKNIMINLMDILEVDTKKQIVRVEPLVTMGQVTALLTSIGWTLPVLPELDDLTVGGLIMGTGIESSSHKYGLFQHICTAYELVLADGSFVRCTPSENSDLFYAVPWSCGTLGFLVAAEIRIIPAKKYVKLRFEPVRGLEAICAKFTHESQRQENHFVEGLLYSLDEAVIMTGVMTDEAEPSKLNSIGNYYKPWFFKHVENYLKTNREGLEYIPLRHYYHRHTRSIFWELQDIIPFGNNPIFRYLFGWMVPPKISLLKLTQGETLRKLYEQHHVVQDMLVPMKCLQQALHTFQNDIHVYPIWLCPFILPSQPGLVHPKGNEAELYIDIGAYGEPRVKHFEARSCMRQLEKFVRSVHGFQMLYADCYMNREEFWEMFDGSLYHKLREKLGCQDAFPEVYDKICKAARH
"
sig_peptide 130..195
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
mat_peptide 196..1677
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/product="delta(24)-sterol reductase"
misc_feature 223..285
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q15392.2);
transmembrane region"
misc_feature <469..738
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/note="FAD binding domain; Region: FAD_binding_4;
pfam01565"
/db_xref="CDD:201863"
misc_feature 481..>918
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/note="FAD/FMN-containing dehydrogenases [Energy
production and conversion]; Region: GlcD; COG0277"
/db_xref="CDD:30625"
misc_feature 493..498
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/inference="non-experimental evidence, no additional
details recorded"
/note="Cleavage, by caspase (Potential); propagated from
UniProtKB/Swiss-Prot (Q15392.2); cleavage site"
misc_feature 1276..1281
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/inference="non-experimental evidence, no additional
details recorded"
/note="Cleavage, by caspase (Potential); propagated from
UniProtKB/Swiss-Prot (Q15392.2); cleavage site"
exon 361..516
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/inference="alignment:Splign:1.39.8"
exon 517..622
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/inference="alignment:Splign:1.39.8"
STS 525..691
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/standard_name="DHCR24"
/db_xref="UniSTS:503206"
exon 623..741
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/inference="alignment:Splign:1.39.8"
exon 742..1005
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/inference="alignment:Splign:1.39.8"
exon 1006..1149
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/inference="alignment:Splign:1.39.8"
exon 1150..1347
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/inference="alignment:Splign:1.39.8"
exon 1348..1526
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/inference="alignment:Splign:1.39.8"
exon 1527..4286
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/inference="alignment:Splign:1.39.8"
variation 1651
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/replace="a"
/replace="g"
/db_xref="dbSNP:11555496"
variation 1794
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/replace="c"
/replace="t"
/db_xref="dbSNP:11555498"
variation 1795
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/replace="c"
/replace="t"
/db_xref="dbSNP:201545563"
variation 1824
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1060883"
variation 1901
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1138030"
variation 3168
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/replace="c"
/replace="t"
/db_xref="dbSNP:8990"
variation 3225
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/replace="g"
/replace="t"
/db_xref="dbSNP:11555497"
variation 3264
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/replace="c"
/replace="t"
/db_xref="dbSNP:7374"
variation 3504
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/replace="g"
/replace="t"
/db_xref="dbSNP:654561"
variation 3645
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/replace="a"
/replace="c"
/db_xref="dbSNP:11555500"
variation 3760
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/replace="c"
/replace="t"
/db_xref="dbSNP:377656375"
STS 3784..4013
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/standard_name="RH68204"
/db_xref="UniSTS:72823"
variation 3843
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/replace="c"
/replace="t"
/db_xref="dbSNP:10299"
variation 4001
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/replace="c"
/replace="t"
/db_xref="dbSNP:3210014"
variation 4036
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/replace="c"
/replace="t"
/db_xref="dbSNP:11555494"
STS 4050..4206
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/standard_name="SHGC-74871"
/db_xref="UniSTS:80242"
variation 4136
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1061250"
variation 4174
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1061256"
variation 4200
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1804406"
variation 4224
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1063449"
variation 4235
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/replace="a"
/replace="g"
/db_xref="dbSNP:657688"
variation 4249
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
/replace="c"
/replace="g"
/db_xref="dbSNP:3210021"
polyA_signal 4263..4268
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
polyA_site 4286
/gene="DHCR24"
/gene_synonym="DCE; Nbla03646; seladin-1; SELADIN1"
ORIGIN
aatcgcgaggcggcgggcgatcccgggctccccgggctgtgggctacaggcgcagagcgggccaggcgcggagctggcggcagtgacaggaggcgcgaacccgcagcgcttaccgcgcggcgccgcaccatggagcccgccgtgtcgctggccgtgtgcgcgctgctcttcctgctgtgggtgcgcctgaaggggctggagttcgtgctcatccaccagcgctgggtgttcgtgtgcctcttcctcctgccgctctcgcttatcttcgatatctactactacgtgcgcgcctgggtggtgttcaagctcagcagcgctccgcgcctgcacgagcagcgcgtgcgggacatccagaagcaggtgcgggaatggaaggagcagggtagcaagaccttcatgtgcacggggcgccctggctggctcactgtctcactacgtgtcgggaagtacaagaagacacacaaaaacatcatgatcaacctgatggacattctggaagtggacaccaagaaacagattgtccgtgtggagcccttggtgaccatgggccaggtgactgccctgctgacctccattggctggactctccccgtgttgcctgagcttgatgacctcacagtggggggcttgatcatgggcacaggcatcgagtcatcatcccacaagtacggcctgttccaacacatctgcactgcttacgagctggtcctggctgatggcagctttgtgcgatgcactccgtccgaaaactcagacctgttctatgccgtaccctggtcctgtgggacgctgggtttcctggtggccgctgagatccgcatcatccctgccaagaagtacgtcaagctgcgtttcgagccagtgcggggcctggaggctatctgtgccaagttcacccacgagtcccagcggcaggagaaccacttcgtggaagggctgctctactccctggatgaggctgtcattatgacaggggtcatgacagatgaggcagagcccagcaagctgaatagcattggcaattactacaagccgtggttctttaagcatgtggagaactatctgaagacaaaccgagagggcctggagtacattcccttgagacactactaccaccgccacacgcgcagcatcttctgggagctccaggacattatcccctttggcaacaaccccatcttccgctacctctttggctggatggtgcctcccaagatctccctcctgaagctgacccagggtgagaccctgcgcaagctgtacgagcagcaccacgtggtgcaggacatgctggtgcccatgaagtgcctgcagcaggccctgcacaccttccaaaacgacatccacgtctaccccatctggctgtgtccgttcatcctgcccagccagccaggcctagtgcaccccaaaggaaatgaggcagagctctacatcgacattggagcatatggggagccgcgtgtgaaacactttgaagccaggtcctgcatgaggcagctggagaagtttgtccgcagcgtgcatggcttccagatgctgtatgccgactgctacatgaaccgggaggagttctgggagatgtttgatggctccttgtaccacaagctgcgagagaagctgggttgccaggacgccttccccgaggtgtacgacaagatctgcaaggccgccaggcactgagctggagcccgcctggagagacagacacgtgtgagtggtcaggcatcttcccttcactcaagcttggctgctttcctagatccacactttcaaagagaaacccctccagaactcccaccctgacagcccaacaccaccttcctcctggcttccagggggcagcccagtggaatggaaagaatgtgggatttggagtcagacaagcctgagtccagttccccgtttagaactcattagctgtgtgactctgggtgagtcccttaacccctctgagcccgggtctcttcattagttgaaagggatagtaatacctacttgcaggttgttgtcatctgagttgagcactggtcacattgaaggtgctgggtaagtggtagctcttgttgcttcccgttcagcgtcacatctgcagtggagcctgaaaaggctccacattaggtcacctgtgcacagccatggctggaatgatgaaggggatacgctggagttgccctgccatcgcctccatcagccagacgaggtcctcacaggagaaggacagctcttccccaccctgggatctcaggagggcagccacggagtggggaggccccagatgcgctgtgccaaagccaggtccgaggccaaagttctccctgccatccttggtgccgtcctgccccttcctccttcatgcctgggcctgcaggcccaccccagccaccactgagtccactcggagtgccctgtgttcctggagaaggcattccagggttgaatcttgtcccagcctcagcctgggacacctaggtggagagagtggtctccgctctgaattggatccaggggacctgggctcattcttcttggctcaccaaccctgcaggcctcatctttcccaaaacccactttgtcttggtgggagtgggtccgcgctgctctgcagcaggggctggggagtggacagcatcaggtgggaaagtggagtccaccctcatgtttctgtaggattctcaccgtggggctggaagaaaagagcatcgacttgatttctccaaccactcatccctctttttctttcttccaccactccccaccccagctgtagttaatttcagtgccttacaaatcctaagctcagagaaagttccatttccgttccagagggaagggaacctccctaggtccttccctggcttgttataacgcaaagcttggttgtttatgcaactctatcttaagaactgcccagcctcagctgaaaacccgaatctgagaaggaattgcgtcatgtaagggaagctggaattaagggagctgagccagtcatggttgtggcgtgtgagtcaggagacctaggtttcagcccctctctactgtcagcgagctgtgcaacgtgggcaagtcattgtcctctgagctgcagtttcctcatctgtcacatcgctacagacaagacctccctggaacccttctgattgtcttagacactgtggttgcaaaacccacggaaagcctcatttgtgtggaaagtcagaggaaaaatgatccagtggacacttggggattatctgtcattcaagatccttccttcaaccccaaggtcagctcccatctcatttccagaaaggctcatacctggcttgcagggaagcatctgtcttgtcattccaggtgccagaatcctctcagagtcattgaagggtgttcacccatcccacccaaggcttggcacactgccagtgtcttagcagggtcttgtgagggctgggggcatccaggcactcagaaggcaaaggaaccaccctacccatttggcctctggagggggcagaagaaagaaataaacctcatcctatattttacaaagcatgtgaattctggcattagctctcataggagacccatgtgcttccttgctcagtgcaaaactgatgattctacttgctgtagatgaatggttaacacgagctagttaaacagtgccattgttttgccagtgaagcctccaaccctaagccactgggacggtggccagagatgccagcagcctctgtcgcccttagtcatataaccaaaatccagaccttatccacaacccggggcttggaaaggaaggtattttggaatcacaccctccggttatgttgctccagtaaaatcttgcctggaaagaggcagtcttcttagcatggtgagctgagttcatggcttttttttgtagccagtcctgtccctggccatccatgtgatggttttggatggagttaaacttgatgccagtgggcagtgcatgtggaaagtatcagagtaaggctctcccctccagagccctgagtttcttggctgcatgaaggttttctttagaatcagaattgtagccagtttctttggccagaaggatgaatacttggatattactgaaagggaggggtggagatgggtgtggcagtgtatggtgtgtgatttttattttcttctttggtcatgggggccaaggagaaaggcatgaatcttccctgtcaggctcttacagccacaggcactgtgtctactgtctggaagacatgtccccatggctgtggggccgctgcttctgtttaaataaaagtggcctggaagctggc
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:1718 -> Molecular function: GO:0008762 [UDP-N-acetylmuramate dehydrogenase activity] evidence: IEA
GeneID:1718 -> Molecular function: GO:0016628 [oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor] evidence: IDA
GeneID:1718 -> Molecular function: GO:0019899 [enzyme binding] evidence: IPI
GeneID:1718 -> Molecular function: GO:0042605 [peptide antigen binding] evidence: IPI
GeneID:1718 -> Molecular function: GO:0050614 [delta24-sterol reductase activity] evidence: IEA
GeneID:1718 -> Molecular function: GO:0050660 [flavin adenine dinucleotide binding] evidence: IEA
GeneID:1718 -> Biological process: GO:0006695 [cholesterol biosynthetic process] evidence: IEA
GeneID:1718 -> Biological process: GO:0006695 [cholesterol biosynthetic process] evidence: IMP
GeneID:1718 -> Biological process: GO:0006695 [cholesterol biosynthetic process] evidence: ISS
GeneID:1718 -> Biological process: GO:0006695 [cholesterol biosynthetic process] evidence: NAS
GeneID:1718 -> Biological process: GO:0006695 [cholesterol biosynthetic process] evidence: TAS
GeneID:1718 -> Biological process: GO:0006915 [apoptotic process] evidence: NAS
GeneID:1718 -> Biological process: GO:0006979 [response to oxidative stress] evidence: IEP
GeneID:1718 -> Biological process: GO:0007050 [cell cycle arrest] evidence: NAS
GeneID:1718 -> Biological process: GO:0007265 [Ras protein signal transduction] evidence: IEA
GeneID:1718 -> Biological process: GO:0008104 [protein localization] evidence: IEA
GeneID:1718 -> Biological process: GO:0008285 [negative regulation of cell proliferation] evidence: IEA
GeneID:1718 -> Biological process: GO:0009725 [response to hormone stimulus] evidence: IEA
GeneID:1718 -> Biological process: GO:0009888 [tissue development] evidence: IMP
GeneID:1718 -> Biological process: GO:0016044 [cellular membrane organization] evidence: IEA
GeneID:1718 -> Biological process: GO:0030539 [male genitalia development] evidence: IEA
GeneID:1718 -> Biological process: GO:0031639 [plasminogen activation] evidence: IEA
GeneID:1718 -> Biological process: GO:0042987 [amyloid precursor protein catabolic process] evidence: IEA
GeneID:1718 -> Biological process: GO:0043066 [negative regulation of apoptotic process] evidence: IDA
GeneID:1718 -> Biological process: GO:0043154 [negative regulation of cysteine-type endopeptidase activity involved in apoptotic process] evidence: IDA
GeneID:1718 -> Biological process: GO:0043588 [skin development] evidence: ISS
GeneID:1718 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS
GeneID:1718 -> Biological process: GO:1901214 [regulation of neuron death] evidence: NAS
GeneID:1718 -> Cellular component: GO:0000139 [Golgi membrane] evidence: IEA
GeneID:1718 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:1718 -> Cellular component: GO:0005783 [endoplasmic reticulum] evidence: IDA
GeneID:1718 -> Cellular component: GO:0005789 [endoplasmic reticulum membrane] evidence: NAS
GeneID:1718 -> Cellular component: GO:0005789 [endoplasmic reticulum membrane] evidence: TAS
GeneID:1718 -> Cellular component: GO:0005829 [cytosol] evidence: IEA
GeneID:1718 -> Cellular component: GO:0005856 [cytoskeleton] evidence: IEA
GeneID:1718 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_055577 -> EC 1.3.1.72
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.