GGRNA Home | Help | Advanced search

2020-10-24 06:52:30, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_014749               5600 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens KIAA0586 (KIAA0586), transcript variant 5, mRNA.
ACCESSION   NM_014749
VERSION     NM_014749.3  GI:154813196
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 5600)
  AUTHORS   Yin,Y., Bangs,F., Paton,I.R., Prescott,A., James,J., Davey,M.G.,
            Whitley,P., Genikhovich,G., Technau,U., Burt,D.W. and Tickle,C.
  TITLE     The Talpid3 gene (KIAA0586) encodes a centrosomal protein that is
            essential for primary cilia formation
  JOURNAL   Development 136 (4), 655-664 (2009)
   PUBMED   19144723
REFERENCE   2  (bases 1 to 5600)
  AUTHORS   Davey,M.G., Paton,I.R., Yin,Y., Schmidt,M., Bangs,F.K.,
            Morrice,D.R., Smith,T.G., Buxton,P., Stamataki,D., Tanaka,M.,
            Munsterberg,A.E., Briscoe,J., Tickle,C. and Burt,D.W.
  TITLE     The chicken talpid3 gene encodes a novel protein essential for
            Hedgehog signaling
  JOURNAL   Genes Dev. 20 (10), 1365-1377 (2006)
   PUBMED   16702409
  REMARK    GeneRIF: The chicken ortholog functions in regulation of the Gli
            repressor and activator proteins in the Hedgehog signaling pathway.
REFERENCE   3  (bases 1 to 5600)
  AUTHORS   Wood,R., Chumbler,F. and Wiegand,R.
  TITLE     Incorporation of dietary cis and trans isomers of octadecenoate in
            lipid classes of liver and hepatoma
  JOURNAL   J. Biol. Chem. 252 (6), 1965-1970 (1977)
   PUBMED   191447
  REMARK    GeneRIF: The chicken ortholog encodes a centrosomal protein
            containing a highly conserved region necessary for ciliogenesis,
            neural tube patterning, and Hedgehog signaling.
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            DB271535.1, DC348119.1, AL042761.1, AL139021.6, CN308043.1,
            AY359881.1, BX097526.1 and CN281643.1.
            On Aug 7, 2007 this sequence version replaced gi:41281468.
            
            Transcript Variant: This variant (5) contains an alternate segment
            in the 5' coding region, uses a downstream start codon, and lacks
            several alternate in-frame exons, compared to variant 1. This
            results in a shorter protein (isoform 5), compared to isoform 1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC066647.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025084, ERS025088 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-542               DB271535.1         2-543
            543-937             DC348119.1         166-560
            938-1391            AL042761.1         20-473
            1392-1392           AL139021.6         114382-114382
            1393-1554           AL042761.1         475-636
            1555-2104           CN308043.1         67-616
            2105-2572           AY359881.1         2186-2653
            2573-2573           AL139021.6         134344-134344
            2574-4885           AY359881.1         2655-4966
            4886-5103           BX097526.1         514-731
            5104-5600           CN281643.1         1-497               c
FEATURES             Location/Qualifiers
     source          1..5600
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="14"
                     /map="14q23.1"
     gene            1..5600
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /note="KIAA0586"
                     /db_xref="GeneID:9786"
                     /db_xref="HGNC:19960"
                     /db_xref="MIM:610178"
     exon            1..472
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       125
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182066982"
     variation       205
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145502517"
     variation       206
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368811330"
     misc_feature    214..216
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /note="upstream in-frame stop codon"
     variation       267
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368726079"
     variation       269
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372615752"
     variation       270
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375579488"
     CDS             274..4692
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /note="isoform 5 is encoded by transcript variant 5;
                     ortholog of chicken talpid{3}; protein TALPID3"
                     /codon_start=1
                     /product="protein TALPID3 isoform 5"
                     /protein_id="NP_055564.3"
                     /db_xref="GI:154813197"
                     /db_xref="CCDS:CCDS45115.1"
                     /db_xref="GeneID:9786"
                     /db_xref="HGNC:19960"
                     /db_xref="MIM:610178"
                     /translation="
MKGSEVSLEKKKKIKMPVKRLREVVSQNHGDHLVLLKDELPCVPPALSANKRLPVGTGTSLNGTSRGSSDLTSARNCYQPLLENPMVSESDFSKDVAVQVLPLDKIEENNKQKANDIFISQYTMGQKDALRTVLKQKAQSMPVFKEVKVHLLEDAGIEKDAVTQETRISPSGIDSATTVAAATAAAIATAAPLIKVQSDLEAKVNSVTELLSKLQETDKHLQRVTEQQTSIQRKQEKLHCHDHEKQMNVFMEQHIRHLEKLQQQQIDIQTHFISAALKTSSFQPVSMPSSRAVEKYSVKPEHPNLGSCNPSLYNTFASKQAPLKEVEDTSFDKQKSPLETPAPRRFAPVPVSRDDELSKRENLLEEKENMEVSCHRGNVRLLEQILNNNDSLTRKSESSNTTSLTRSKIGWTPEKTNRFPSCEELETTKVTMQKSDDVLHDLGQKEKETNSMVQPKESLSMLKLPDLPQNSVKLQTTNTTRSVLKDAEKILRGVQNNKKVLEENLEAIIRAKDGAAMYSLINALSTNREMSEKIRIRKTVDEWIKTISAEIQGLLKATTVIQDEDYMLQVYGKPVYQGHRSTLKKGPYLRFNSPSPKSRPQRPKVIERVKGTKVKSIRTQTDFYATKPKKMDSKMKHSVPVLPHGDQQYLFSPSREMPTFSGTLEGHLIPMAILLGQTQSNSDTMPPAGVIVSKPHPVTVTTSIPPSSRKVETGVKKPNIAIVEMKSEKKDPPQLTVQVLPSVDIDSISNSSADVLSPLSSPKEASLPPVQTWIKTPEIMKVDEEEVKFPGTNFDEIIDVIQEEEKCDEIPDSEPILEFNRSVKADSTKYNGPPFPPVASTFQPTADILDKVIERKETLENSLIQWVEQEIMSRIISGLFPVQQQIAPSISVSVSETSEPLTSDIVEGTSSGALQLFVDAGVPVNSNVIKHFVNEALAETIAVMLGDREAKKQGPVATGVSGDASTNETYLPARVCTPLPTPQPTPPCSPSSPAKECVLVKTPDSSPCDSDHDMAFPVKEICAEKGDDMPAIMLVNTPTVTPTTTPPPAAAVFTPTLSDISIDKLKVSSPELPKPWGDGDLPLEEENPNSPQEELHPRAIVMSVAKDEEPESMDFPAQPPPPEPVPFMPFPAGTKAPSPSQMPGSDSSTLESTLSVTVTETETLDKPISEGEILFSCGQKLAPKILEDIGLYLTNLNDSLSSTLHDAVEMEDDPPSEGQVIRMSHKKFHADAILSFAKQNQESAVSQQAVYHSEDLENSVGELSEGQRPQLTAAAENILMGHSLYMQPPVTNTQSLDQQCDPKPLSRQFDTVSGSIYEDSCASHGPMSLGELELEPNSKLVLPTTLLTAQENDVNLPVAAEDFSQYQLKQNQDVKQVEHKPSQSYLRVRNKSDIAPSQQQVSPGDMDRTQIELNPYLTCVFSGGKAVPLSASQMPPAKMSVMLPSVNLEDCSQSLSLSTMQEDMESSGADTF
"
     variation       288
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199554737"
     variation       309
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372215354"
     variation       337
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202124602"
     variation       373
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186659284"
     variation       390
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190089844"
     variation       440
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201315284"
     variation       444
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372659413"
     variation       455
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183168709"
     exon            473..543
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       475
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:147119902"
     variation       488
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201393625"
     variation       510
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370677508"
     variation       530
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74055693"
     exon            544..613
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       559
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189943424"
     variation       584
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376005040"
     variation       602
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373836349"
     exon            614..683
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       620
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376113173"
     variation       636
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368352741"
     variation       640
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:183240083"
     variation       668
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200627657"
     exon            684..858
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       695
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61735931"
     variation       755
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11622776"
     variation       805
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374972438"
     variation       849
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369143869"
     exon            859..1080
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       865
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375374719"
     variation       873
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61738360"
     variation       893
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199837404"
     variation       916
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201097695"
     variation       971
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:193056942"
     variation       996
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373333959"
     variation       1003
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376338487"
     variation       1056
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370332963"
     variation       1058
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376289224"
     exon            1081..1234
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       1085
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368574051"
     variation       1123
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371179268"
     variation       1142
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:186378072"
     variation       1211
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191232589"
     exon            1235..1402
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       1247
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:144456198"
     variation       1329
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148006211"
     variation       1341
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376048205"
     variation       1350
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199623501"
     variation       1353
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200094677"
     variation       1357
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371365932"
     variation       1370
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:59248588"
     variation       1382
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369845308"
     variation       1392
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1748971"
     exon            1403..1526
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       1416
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370408761"
     variation       1503
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10135645"
     variation       1510
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377325998"
     variation       1513
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147844088"
     exon            1527..1635
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       1532
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187783779"
     variation       1542
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190675549"
     variation       1609
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371477725"
     exon            1636..1856
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       1666
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376681702"
     variation       1680
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200446131"
     variation       1696
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:78468862"
     variation       1712
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61745119"
     variation       1717
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375472516"
     variation       1718
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369211190"
     variation       1795
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61745095"
     variation       1843
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:61742715"
     exon            1857..1929
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       1926
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374601841"
     exon            1930..2104
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       1948
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375173927"
     variation       1962
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376649351"
     variation       2007
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199777168"
     variation       2032
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370560098"
     variation       2035
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202025419"
     variation       2055
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185266107"
     variation       2077
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:190081177"
     exon            2105..2299
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       2122
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200735064"
     variation       2137
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371583234"
     variation       2168
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373601253"
     variation       2190
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:78009437"
     variation       2208
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368904420"
     variation       2246
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372160214"
     variation       2272
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192490416"
     exon            2300..2487
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       2303
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369552863"
     variation       2340
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200937470"
     variation       2399
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372212501"
     variation       2414
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376797336"
     variation       2417
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:78460691"
     variation       2431
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369070060"
     variation       2441
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369850927"
     variation       2470
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201629494"
     variation       2482
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373130060"
     exon            2488..2598
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       2494
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370111393"
     variation       2531
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200219991"
     variation       2548
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:113040775"
     variation       2556
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:377409718"
     variation       2573
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1748986"
     variation       2576
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200490147"
     variation       2578
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377023593"
     exon            2599..2679
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       2602
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367573993"
     variation       2603
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:45478500"
     variation       2629
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372915104"
     variation       2634
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374585380"
     variation       2640
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368361783"
     variation       2675
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377015806"
     variation       2676
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367998141"
     exon            2680..2870
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       2780
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139493302"
     variation       2781
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368984896"
     variation       2783
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:202051871"
     variation       2851
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61974537"
     exon            2871..2989
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       2876
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:181400417"
     variation       2877
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373201020"
     variation       2889
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374762003"
     variation       2929
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:376119494"
     variation       2953
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368808852"
     variation       2957
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3783696"
     variation       2988
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370778483"
     exon            2990..3189
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       3029
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368583200"
     variation       3048
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199537542"
     variation       3083
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375690080"
     variation       3087
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368251704"
     variation       3091
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141771152"
     variation       3092
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372259984"
     variation       3098
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:182274649"
     variation       3105
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201263653"
     variation       3149
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77860620"
     variation       3155
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:367811307"
     variation       3174
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371456681"
     variation       3180
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374691292"
     variation       3188
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369859399"
     exon            3190..3349
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       3211
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1617510"
     variation       3228
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369590767"
     variation       3292
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373431045"
     variation       3311
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187091758"
     variation       3322
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:77810875"
     variation       3328
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:140565291"
     variation       3337
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374459469"
     exon            3350..3572
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       3413
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377332917"
     variation       3419
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201898983"
     variation       3452
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200148591"
     variation       3492..3493
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:368765650"
     variation       3495
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199517530"
     variation       3509
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3929708"
     variation       3512
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200085678"
     exon            3573..3826
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       3598
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200722491"
     variation       3601
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368136238"
     variation       3609
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371957302"
     variation       3625
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373763986"
     variation       3646
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376675866"
     variation       3649
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199743989"
     variation       3669
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:367676896"
     variation       3689
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201709033"
     variation       3690
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375360391"
     variation       3708
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201202020"
     variation       3733
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143158234"
     variation       3743
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201702546"
     variation       3758
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369318614"
     variation       3760
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201889432"
     variation       3764
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190271845"
     variation       3774
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377467641"
     variation       3819
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199982600"
     exon            3827..3903
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       3831
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374590484"
     variation       3850
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:377000129"
     variation       3886
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371424977"
     variation       3894
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113191202"
     variation       3895
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374292446"
     variation       3901
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377275619"
     exon            3904..4035
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       3906
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188676684"
     variation       3907
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181413894"
     variation       3936..3937
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:35666852"
     variation       3965
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3783697"
     variation       3970
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376234883"
     variation       4025
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201929144"
     variation       4033
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373649439"
     exon            4036..4213
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       4092
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61729923"
     variation       4158
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200906427"
     variation       4170
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148016417"
     variation       4179
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369759253"
     variation       4182
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372138430"
     variation       4205
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376795880"
     variation       4207
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369067010"
     variation       4211
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373357386"
     exon            4214..4368
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       4243
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140874828"
     variation       4251
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369935221"
     variation       4256
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192561585"
     variation       4350
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144692893"
     variation       4351
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202235093"
     variation       4360
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200405048"
     exon            4369..4474
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       4370
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200127338"
     variation       4371
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139175231"
     exon            4475..4540
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     variation       4481
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374096160"
     variation       4506
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11611"
     variation       4517
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370303493"
     exon            4541..5591
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /inference="alignment:Splign:1.39.8"
     STS             4555..4844
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /standard_name="WI-20905"
                     /db_xref="UniSTS:31105"
     variation       4564
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140026883"
     variation       4598
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377020452"
     variation       4605
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:45568037"
     variation       4617
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371910625"
     variation       4618
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375085808"
     STS             4628..4760
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /standard_name="RH15628"
                     /db_xref="UniSTS:59832"
     STS             4644..4768
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /standard_name="D14S696E"
                     /db_xref="UniSTS:151575"
     variation       4668
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188723128"
     variation       4672..4676
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace=""
                     /replace="tcggg"
                     /db_xref="dbSNP:199504537"
     variation       4674
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61745066"
     variation       4689
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373503925"
     variation       4694
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376691503"
     variation       4769
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375948139"
     variation       4797
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74607305"
     polyA_signal    4860..4865
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
     polyA_site      4879
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
     variation       4919
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370422091"
     variation       4971
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369997201"
     variation       5035
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139596781"
     variation       5041
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374397560"
     variation       5042
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149751065"
     STS             5095..5233
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /standard_name="G30978"
                     /db_xref="UniSTS:64038"
     variation       5120
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145442381"
     variation       5134
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11545286"
     variation       5137
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139072701"
     variation       5183
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:181452208"
     variation       5212
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185323978"
     variation       5352
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:74058013"
     variation       5388
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144014186"
     polyA_signal    5563..5568
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
     polyA_site      5591
                     /gene="KIAA0586"
                     /gene_synonym="Talpid3"
ORIGIN      
ttattgttgctcctgtggccattctcttgtcatccccactttcacattttggcgtggtgtattaatagactgagtgggattaatgggtaaatatgactttatagtcagctctaatcctggattcaatatcagaatttagattttcagctttgtggatgttcgacattttaaaaacagttattgcaaagaggtgaaaattttgttctgaagtcttaaggaaacagagaaagtttttccgtccttaagtgtgggacttgttttgtgaccaacaatatgaaaggctctgaggtcagcttggagaagaaaaaaaagattaagatgccagtgaagagacttcgtgaggtagtttctcaaaatcatggagatcatttggttttgctgaaagatgagttgccctgtgttcctccggcattgtctgcaaataaacgtcttcctgttggaacggggactagtttgaatggaacatcacgtggttcatcagacttaacttctgctagaaattgttaccagcctctattagaaaatcccatggtgtcagaaagtgatttttctaaagacgttgcagtgcaagtgttgcctttggataaaatagaagagaacaacaagcaaaaagcaaatgacatcttcatttctcagtatacaatgggacagaaagatgctctaagaacagttttaaagcaaaaagctcaaagcatgcctgtttttaaggaagtaaaggtacatctgttagaagatgcaggcatagagaaggatgctgttactcaggagactagaatttcacccagtggaattgattcagctacaaccgtggctgcagcaactgctgctgccattgcaaccgcagctccgttgataaaggtgcagagtgatttggaagcaaaagtcaattctgttacagaattacttagtaaattacaggagactgataaacacctgcaacgtgttacagagcagcaaacaagcattcagaggaaacaagagaaattacattgtcatgatcacgaaaagcaaatgaatgtgtttatggagcagcacataaggcatcttgaaaagttacaacaacaacaaatagatattcagactcattttattagtgctgcactcaagactagtagttttcagcctgttagtatgccctcctccagagcagtggaaaagtattccgtaaaaccagaacaccctaatcttggtagctgtaatccatctttatataacacatttgcttccaaacaagcacctttaaaagaagttgaagatacgagttttgataaacagaaatctcctttggagacaccagcacctcgcagatttgctcctgtacctgtttcaagggatgatgaactatcaaagagggaaaatcttttggaagaaaaagaaaatatggaagtgtcgtgtcacagaggaaatgtaagactattggaacaaattttgaataataatgattctttgacaagaaaaagtgaatcatcaaacaccacctcactaactaggtcaaaaataggatggactcctgagaaaacaaacagatttccttcctgtgaagagctagaaacaactaaagtgactatgcagaagtctgatgatgttcttcatgaccttggccaaaaagagaaagaaacaaatagcatggtccagccaaaagaatctctgagtatgttgaagcttccagatcttccacagaattctgttaagcttcaaacaaccaatacaacaagatctgtattgaaagatgctgagaagattttgagaggagtacaaaacaataaaaaagtacttgaagaaaacctggaagctattattcgtgcaaaagatggagctgccatgtattcgcttatcaatgctttatctaccaacagagagatgtcagagaaaattaggatcagaaagacagtggatgaatggattaaaactatttctgcagaaattcaggggcttttgaaagcaaccacagtaatacaagatgaagattatatgttacaagtctatggaaagccagtttatcagggccatcgaagcactcttaaaaaaggaccatatctcagatttaattctccatctcctaagtccagaccacagagaccaaaagtaatagaacgagttaaaggcactaaggtaaagtcaataagaacacagactgacttctatgcaacaaaacctaagaagatggattctaaaatgaaacattctgttcctgtgttacctcatggcgatcagcaatatttgttcagcccaagtagagaaatgcctactttttcaggtacattggaaggtcatctgattcctatggcaattcttttaggacaaacccaaagtaatagtgataccatgccacctgctggagtgattgtcagcaagccacaccctgtaactgtgactacttctattcctccatcatctcgaaaagtagaaactggagtaaagaaacctaacatagccattgtagaaatgaagtcagaaaaaaaggatcctcctcagcttactgtgcaggtattacccagtgtagatattgacagcatttcaaatagtagtgctgatgtcctttcacctctgtctagccccaaagaagcatctcttcctcctgtgcaaacttggataaagactccagaaattatgaaggtagatgaagaagaggtgaagtttccaggaactaactttgatgaaataatcgatgtcatacaggaagaagaaaaatgtgatgaaattccagactctgaaccaattctggagtttaacagaagtgttaaagctgattctacaaaatataatggtcctccatttccgccagttgcttctacttttcagcccactgctgatattctggataaagtaattgagagaaaagaaacactggaaaatagcttaattcaatgggtagagcaagaaataatgtcaagaattatctctgggctctttccagtccagcaacagattgcacctagtatcagtgtttcagtcagtgagacaagtgaaccactgacttctgacattgtggaaggaacaagcagtggcgccctccagctttttgttgatgctggtgttcctgtgaactcaaatgtgattaaacattttgttaacgaagctcttgctgagaccattgctgtcatgctgggtgacagagaagcaaagaagcaaggtcctgttgctacaggtgtttctggggatgcttcaacaaatgaaacatatttgccggcaagagtgtgcaccccactgcctaccccacagcctacgcctccttgctcaccttcatcacctgctaaggagtgtgttttggtaaagactccagattcttctccctgtgattcggatcatgatatggcttttcctgtgaaagaaatatgtgctgaaaaaggagatgatatgcctgccatcatgcttgttaatactccaacagttacccctactactacacctcctccagcggcggcagtttttaccccaactttgtcagatatttccattgataaattgaaggtatcaagcccagagcttcccaagccatggggtgatggagacctgccactggaagaagagaaccctaactcacctcaagaagaacttcatccaagagctattgtaatgtctgtggctaaggatgaagaaccagagagtatggatttccctgctcagcctccacctccagagccagttccctttatgccatttcctgccggcaccaaggccccttccccctcacagatgccaggttctgattcatcaacactggagagcacattgagtgttactgtcactgaaactgaaactttagataaacccatctctgaaggagagattttatttagctgtggtcaaaaattggcccccaagattttagaagatataggactgtacctgacaaaccttaatgatagcttatccagcactctgcatgatgccgttgaaatggaggatgatcctcctagtgaagggcaagtgattaggatgtcccataaaaaatttcatgcagatgcaattctttcttttgctaaacaaaaccaggagtcagcagtttcccagcaagcagtctatcattcagaggacttggaaaacagtgtgggtgaacttagtgaaggacaaagaccccagctaacagcggcagcagagaacatcttaatgggacattctctctatatgcagccacctgtcactaatacacagtctttggatcaacaatgtgatcctaaaccattatctcggcaatttgacacagtttcaggtagtatttatgaagattcatgtgctagtcatggtccaatgagtttgggagaattggagttggagccaaattctaagctggttcttcccacaacacttctgacagcacaagaaaatgatgttaatttaccagtagccgctgaagatttttcccagtaccaactaaagcaaaatcaggatgttaagcaagttgaacacaaaccatcacaaagttacctacgtgttagaaataaatctgatattgcaccttcacagcaacaagtttcaccaggtgatatggatcggacacaaattgagcttaatccgtacctcacatgtgtattttcaggtgggaaagcagtgccactctccgcttcacagatgccccctgccaagatgtcagtgatgctgccgtcagtgaacctcgaggactgctctcagtctctgagtctcagcacaatgcaggaggacatggagtcttcgggggcagataccttctgaacgggaagagacagccagcacagtgtttatgccactggttttaaagtcattttaccttggcttaaaaccctctctcagactgtttggtttttgagcatattctgaaaaaaaaattccaatattttaaaataaaacaaaaagcataatttgggtatttaaagtttttaaataaaataagtataagtcattataagtctgattgtgagttgtttcttagaatcctgagatagcatagagtagtgaaagggcatggcttttgacatctaggcatttaatctataggtgtaattatctgtatgtatttataaaattatgtagctcaaggttattcattctaacatttttataacagcaaatagaaaaaatcaaatgtctatcaataatagactggttttaaagtgatggtacatcagtacaatggaatactatgtattacaaaaaaaaatttaaaaagtttattgatatggaataatctttgagatgcactgttaaagtgaaaaaagccatgtgcaaaatagtgtgtgaactatgcagttgttgaaattatttaaaatggggtggggaggaattcaaatgtatggtatgtcacatattcttacatgtatttgcttgtaaatatattatataaacaagaaactgctaagtttgtctccagggagtagaattgttggctgggtgataggagaggctaagtgataggaatcaaggataatcgtggttactatgtatttgaacttcagttgtgatagaaaaaaatcatcagtgagattaatttttatatgccttatgtataccatataaacctttataaacctgtgaaacatgtaactctattaccttttgcaacataaatacataaaattaaaggaaaataaaaagcattgcttcgtaatcagataaaaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:9786 -> Biological process: GO:0007224 [smoothened signaling pathway] evidence: ISS
            GeneID:9786 -> Biological process: GO:0060271 [cilium morphogenesis] evidence: ISS
            GeneID:9786 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
            GeneID:9786 -> Cellular component: GO:0005813 [centrosome] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.