GGRNA Home | Help | Advanced search

2019-03-25 14:29:08, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_014706               4377 bp    mRNA    linear   PRI 05-MAY-2013
DEFINITION  Homo sapiens squamous cell carcinoma antigen recognized by T cells
            3 (SART3), mRNA.
ACCESSION   NM_014706
VERSION     NM_014706.3  GI:119393885
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 4377)
  AUTHORS   Liu,Y., Lee,M.R., Timani,K., He,J.J. and Broxmeyer,H.E.
  TITLE     Tip110 maintains expression of pluripotent factors in and
            pluripotency of human embryonic stem cells
  JOURNAL   Stem Cells Dev. 21 (6), 829-833 (2012)
   PUBMED   22132941
  REMARK    GeneRIF: TIP110 is also expressed in human embryonic stem cells
            (hESCs) and expression was decreased with differentiation of these
            ESCs.
REFERENCE   2  (bases 1 to 4377)
  AUTHORS   Song,E.J., Werner,S.L., Neubauer,J., Stegmeier,F., Aspden,J.,
            Rio,D., Harper,J.W., Elledge,S.J., Kirschner,M.W. and Rape,M.
  TITLE     The Prp19 complex and the Usp4Sart3 deubiquitinating enzyme control
            reversible ubiquitination at the spliceosome
  JOURNAL   Genes Dev. 24 (13), 1434-1447 (2010)
   PUBMED   20595234
REFERENCE   3  (bases 1 to 4377)
  AUTHORS   Mohamed,E.R., Naito,M., Terasaki,Y., Niu,Y., Gohara,S., Komatsu,N.,
            Shichijo,S., Itoh,K. and Noguchi,M.
  TITLE     Capability of SART3(109-118) peptide to induce cytotoxic T
            lymphocytes from prostate cancer patients with HLA class I-A11,
            -A31 and -A33 alleles
  JOURNAL   Int. J. Oncol. 34 (2), 529-536 (2009)
   PUBMED   19148489
  REMARK    GeneRIF: Levels of anti-SART3 peptide antibody in prostate cancer
            patients are significantly higher than those of non-cancer
            subjects.
REFERENCE   4  (bases 1 to 4377)
  AUTHORS   Licht,K., Medenbach,J., Luhrmann,R., Kambach,C. and Bindereif,A.
  TITLE     3'-cyclic phosphorylation of U6 snRNA leads to recruitment of
            recycling factor p110 through LSm proteins
  JOURNAL   RNA 14 (8), 1532-1538 (2008)
   PUBMED   18567812
  REMARK    GeneRIF: Both purified and recombinant LSm2-8 proteins are able to
            recruit p110 protein to U6 snRNA via interaction with the highly
            conserved C-terminal region of p110.
REFERENCE   5  (bases 1 to 4377)
  AUTHORS   Hock,J., Weinmann,L., Ender,C., Rudel,S., Kremmer,E., Raabe,M.,
            Urlaub,H. and Meister,G.
  TITLE     Proteomic and functional analysis of Argonaute-containing
            mRNA-protein complexes in human cells
  JOURNAL   EMBO Rep. 8 (11), 1052-1060 (2007)
   PUBMED   17932509
REFERENCE   6  (bases 1 to 4377)
  AUTHORS   Harada,K., Yamada,A., Yang,D., Itoh,K. and Shichijo,S.
  TITLE     Binding of a SART3 tumor-rejection antigen to a pre-mRNA splicing
            factor RNPS1: a possible regulation of splicing by a complex
            formation
  JOURNAL   Int. J. Cancer 93 (5), 623-628 (2001)
   PUBMED   11477570
REFERENCE   7  (bases 1 to 4377)
  AUTHORS   Tanaka,S., Tsuda,N., Kawano,K., Sakamoto,M., Nishida,T.,
            Hashimoto,T., Shichijo,S., Kamura,T. and Itoh,K.
  TITLE     Expression of tumor-rejection antigens in gynecologic cancers
  JOURNAL   Jpn. J. Cancer Res. 91 (11), 1177-1184 (2000)
   PUBMED   11092984
REFERENCE   8  (bases 1 to 4377)
  AUTHORS   Xia,J.H., Yang,Y.F., Deng,H., Tang,B.S., Tang,D.S., He,Y.G.,
            Xia,K., Chen,S.X., Li,Y.X., Pan,Q., Long,Z.G., Dai,H.P., Liao,X.D.,
            Xiao,J.F., Liu,Z.R., Lu,C.Y., Yu,K.P. and Deng,H.X.
  TITLE     Identification of a locus for disseminated superficial actinic
            porokeratosis at chromosome 12q23.2-24.1
  JOURNAL   J. Invest. Dermatol. 114 (6), 1071-1074 (2000)
   PUBMED   10844547
REFERENCE   9  (bases 1 to 4377)
  AUTHORS   Harada,K., Yamada,A., Mine,T., Kawagoe,N., Takasu,H. and Itoh,K.
  TITLE     Mouse homologue of the human SART3 gene encoding tumor-rejection
            antigen
  JOURNAL   Jpn. J. Cancer Res. 91 (2), 239-247 (2000)
   PUBMED   10761712
REFERENCE   10 (bases 1 to 4377)
  AUTHORS   Yang,D., Nakao,M., Shichijo,S., Sasatomi,T., Takasu,H.,
            Matsumoto,H., Mori,K., Hayashi,A., Yamana,H., Shirouzu,K. and
            Itoh,K.
  TITLE     Identification of a gene coding for a protein possessing shared
            tumor epitopes capable of inducing HLA-A24-restricted cytotoxic T
            lymphocytes in cancer patients
  JOURNAL   Cancer Res. 59 (16), 4056-4063 (1999)
   PUBMED   10463607
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DA391623.1, BC032601.1,
            CN349201.1, BQ231651.1, D63879.1 and AI656011.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Dec 14, 2006 this sequence version replaced gi:21327689.
            
            Summary: The protein encoded by this gene is an RNA-binding nuclear
            protein that is a tumor-rejection antigen. This antigen possesses
            tumor epitopes capable of inducing HLA-A24-restricted and
            tumor-specific cytotoxic T lymphocytes in cancer patients and may
            be useful for specific immunotherapy. This gene product is found to
            be an important cellular factor for HIV-1 gene expression and viral
            replication. It also associates transiently with U6 and U4/U6
            snRNPs during the recycling phase of the spliceosome cycle. This
            encoded protein is thought to be involved in the regulation of mRNA
            splicing. [provided by RefSeq, Jul 2008].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB020880.1, D63879.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-367               DA391623.1         5-371
            368-2073            BC032601.1         151-1856
            2074-2505           CN349201.1         77-508
            2506-2949           BQ231651.1         301-744
            2950-3895           D63879.1           2715-3660
            3896-4377           AI656011.1         1-482               c
FEATURES             Location/Qualifiers
     source          1..4377
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="12"
                     /map="12q24.1"
     gene            1..4377
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /note="squamous cell carcinoma antigen recognized by T
                     cells 3"
                     /db_xref="GeneID:9733"
                     /db_xref="HGNC:16860"
                     /db_xref="HPRD:11532"
                     /db_xref="MIM:611684"
     exon            1..547
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /inference="alignment:Splign:1.39.8"
     variation       59..60
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:17040770"
     misc_feature    224..226
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /note="upstream in-frame stop codon"
     CDS             236..3127
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /note="tat-interacting protein of 110 kDa; SART-3;
                     hSART-3"
                     /codon_start=1
                     /product="squamous cell carcinoma antigen recognized by
                     T-cells 3"
                     /protein_id="NP_055521.1"
                     /db_xref="GI:7661952"
                     /db_xref="CCDS:CCDS9117.1"
                     /db_xref="GeneID:9733"
                     /db_xref="HGNC:16860"
                     /db_xref="HPRD:11532"
                     /db_xref="MIM:611684"
                     /translation="
MATAAETSASEPEAESKAGPKADGEEDEVKAARTRRKVLSRAVAAATYKTMGPAWDQQEEGVSESDGDEYAMASSAESSPGEYEWEYDEEEEKNQLEIERLEEQLSINVYDYNCHVDLIRLLRLEGELTKVRMARQKMSEIFPLTEELWLEWLHDEISMAQDGLDREHVYDLFEKAVKDYICPNIWLEYGQYSVGGIGQKGGLEKVRSVFERALSSVGLHMTKGLALWEAYREFESAIVEAARLEKVHSLFRRQLAIPLYDMEATFAEYEEWSEDPIPESVIQNYNKALQQLEKYKPYEEALLQAEAPRLAEYQAYIDFEMKIGDPARIQLIFERALVENCLVPDLWIRYSQYLDRQLKVKDLVLSVHNRAIRNCPWTVALWSRYLLAMERHGVDHQVISVTFEKALNAGFIQATDYVEIWQAYLDYLRRRVDFKQDSSKELEELRAAFTRALEYLKQEVEERFNESGDPSCVIMQNWARIEARLCNNMQKARELWDSIMTRGNAKYANMWLEYYNLERAHGDTQHCRKALHRAVQCTSDYPEHVCEVLLTMERTEGSLEDWDIAVQKTETRLARVNEQRMKAAEKEAALVQQEEEKAEQRKRARAEKKALKKKKKIRGPEKRGADEDDEKEWGDDEEEQPSKRRRVENSIPAAGETQNVEVAAGPAGKCAAVDVEPPSKQKEKAASLKRDMPKVLHDSSKDSITVFVSNLPYSMQEPDTKLRPLFEACGEVVQIRPIFSNRGDFRGYCYVEFKEEKSALQALEMDRKSVEGRPMFVSPCVDKSKNPDFKVFRYSTSLEKHKLFISGLPFSCTKEELEEICKAHGTVKDLRLVTNRAGKPKGLAYVEYENESQASQAVMKMDGMTIKENIIKVAISNPPQRKVPEKPETRKAPGGPMLLPQTYGARGKGRTQLSLLPRALQRPSAAAPQAENGPAAAPAVAAPAATEAPKMSNADFAKLFLRK
"
     misc_feature    239..241
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N-acetylalanine; propagated from
                     UniProtKB/Swiss-Prot (Q15020.1); acetylation site"
     misc_feature    263..265
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q15020.1); phosphorylation site"
     misc_feature    263..265
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    281..283
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q15020.1); phosphorylation site"
     misc_feature    281..283
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    533..>1615
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /note="Pre-mRNA 3'-end processing (cleavage and
                     polyadenylation) factor [RNA processing and modification];
                     Region: RNA14; COG5107"
                     /db_xref="CDD:34710"
     misc_feature    611..709
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q15020.1);
                     Region: HAT 1"
     misc_feature    725..820
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q15020.1);
                     Region: HAT 2"
     misc_feature    836..946
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q15020.1);
                     Region: HAT 3"
     misc_feature    959..1060
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q15020.1);
                     Region: HAT 4"
     misc_feature    1205..1303
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /note="HAT (Half-A-TPR) repeats; Region: HAT; smart00386"
                     /db_xref="CDD:197693"
     misc_feature    1205..1303
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q15020.1);
                     Region: HAT 5"
     misc_feature    1310..1408
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q15020.1);
                     Region: HAT 6"
     misc_feature    1415..1525
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q15020.1);
                     Region: HAT 7"
     misc_feature    1694..1795
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q15020.1);
                     Region: HAT 8"
     misc_feature    2033..2245
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q15020.1);
                     Region: Required for nuclear localization"
     misc_feature    2036..2086
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q15020.1);
                     Region: Nuclear localization signal (Potential)"
     misc_feature    2348..2572
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /note="RRM (RNA recognition motif), also known as RBD (RNA
                     binding domain) or RNP (ribonucleoprotein domain), is a
                     highly abundant domain in eukaryotes found in proteins
                     involved in post-transcriptional gene expression processes
                     including mRNA and rRNA...; Region: RRM; cd00590"
                     /db_xref="CDD:100104"
     misc_feature    order(2354..2356,2477..2479,2483..2485)
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /note="RNA/DNA binding site [nucleotide binding]; other
                     site"
                     /db_xref="CDD:100104"
     misc_feature    2564..2572
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /note="RRM dimerization site [polypeptide binding]; other
                     site"
                     /db_xref="CDD:100104"
     misc_feature    2639..2854
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /note="RRM (RNA recognition motif), also known as RBD (RNA
                     binding domain) or RNP (ribonucleoprotein domain), is a
                     highly abundant domain in eukaryotes found in proteins
                     involved in post-transcriptional gene expression processes
                     including mRNA and rRNA...; Region: RRM; cd00590"
                     /db_xref="CDD:100104"
     misc_feature    order(2645..2647,2762..2764,2768..2770)
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /note="RNA/DNA binding site [nucleotide binding]; other
                     site"
                     /db_xref="CDD:100104"
     misc_feature    2789..2791
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q15020.1); phosphorylation site"
     misc_feature    2789..2791
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     STS             329..444
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /standard_name="RH25375"
                     /db_xref="UniSTS:89125"
     variation       343
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1063936"
     exon            548..674
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /inference="alignment:Splign:1.39.8"
     exon            675..779
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /inference="alignment:Splign:1.39.8"
     variation       742
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11113986"
     exon            780..964
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /inference="alignment:Splign:1.39.8"
     exon            965..1016
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /inference="alignment:Splign:1.39.8"
     exon            1017..1141
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /inference="alignment:Splign:1.39.8"
     exon            1142..1297
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /inference="alignment:Splign:1.39.8"
     exon            1298..1436
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /inference="alignment:Splign:1.39.8"
     exon            1437..1544
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /inference="alignment:Splign:1.39.8"
     exon            1545..1622
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /inference="alignment:Splign:1.39.8"
     exon            1623..1681
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /inference="alignment:Splign:1.39.8"
     exon            1682..1791
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /inference="alignment:Splign:1.39.8"
     exon            1792..1904
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /inference="alignment:Splign:1.39.8"
     exon            1905..1981
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /inference="alignment:Splign:1.39.8"
     exon            1982..2150
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /inference="alignment:Splign:1.39.8"
     exon            2151..2605
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /inference="alignment:Splign:1.39.8"
     STS             2574..2736
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /standard_name="SART3"
                     /db_xref="UniSTS:258303"
     exon            2606..2758
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /inference="alignment:Splign:1.39.8"
     exon            2759..2949
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /inference="alignment:Splign:1.39.8"
     variation       2896
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2303633"
     exon            2950..4370
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /inference="alignment:Splign:1.39.8"
     STS             3149..4061
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /standard_name="SART3_3515"
                     /db_xref="UniSTS:462508"
     STS             3156..3376
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /standard_name="SGC31638"
                     /db_xref="UniSTS:61874"
     polyA_signal    3876..3881
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
     polyA_site      3899
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
     STS             4083..4195
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /standard_name="A007J29"
                     /db_xref="UniSTS:78853"
     STS             4216..4343
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
                     /standard_name="WI-17609"
                     /db_xref="UniSTS:75822"
     polyA_signal    4324..4329
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
     polyA_signal    4348..4353
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
     polyA_site      4349
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
     polyA_site      4353
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
     polyA_site      4370
                     /gene="SART3"
                     /gene_synonym="DSAP1; P100; p110; p110(nrb); RP11-13G14;
                     TIP110"
ORIGIN      
agttgtgacggaacgcatgccattataatgagtttttatatctggtgggagcttttacagggtataaaataatgtgaatttagtgtatgtggagattttcctgttatctaagttcccagtttctctttcaatggcaagaaaacgggtttttgataaggcgcgcgccgcgggcagcttctgcctcagcgggtcttcggcggccgcgggaagacccgagagtcattagaagcgcaagatggcgactgcggccgaaacctcggcttcagaacccgaggctgagtccaaggctgggcccaaggctgacggagaggaggatgaggttaaggcggctaggacaaggaggaaggtgttatcgcgggctgtggccgctgcgacatacaagaccatggggccagcgtgggatcagcaggaggaaggcgtgagcgagagcgatggggatgagtacgccatggcttcctccgcggagagctcccccggggagtacgagtgggaatatgacgaagaggaggagaaaaaccagctggagattgagagactggaggagcagttgtctatcaacgtctatgactacaactgccatgtggacttgatcagactgctcaggctggaaggggagcttaccaaggtgaggatggcccgccagaagatgagtgaaatctttcccttgactgaagagctctggctggagtggctgcatgacgagatcagcatggcccaggatggcctggacagagagcacgtgtatgacctctttgagaaagccgtgaaggattacatttgtcctaacatttggctagagtatggccagtactcagttggtgggattggtcagaaaggtggccttgagaaagttcgctccgtgtttgaaagggctctctcgtctgttggtttacatatgaccaaaggactcgccctctgggaggcttaccgagagtttgaaagtgcgattgtggaagctgctcggcttgagaaagtccacagtcttttccggcgacagttggcgatcccactctatgatatggaggccacatttgcagagtatgaagaatggtcagaagacccaataccagagtcagtaattcagaactataacaaagcactacagcagctggagaaatataaaccctatgaagaagcactgttgcaggcagaggcaccaaggctggcagaatatcaagcatatatcgattttgagatgaaaattggcgatcctgctcgcattcagttgatctttgagcgcgccctggtcgagaactgccttgtcccagacttatggatccgttacagtcagtacctagatcgacaactgaaagtaaaggatttggttttatctgtacataaccgcgctattagaaactgcccctggacagttgccttatggagtcggtacctcttggccatggagagacatggagttgatcatcaagtaatttctgtaaccttcgagaaagctttgaatgccggcttcatccaggccactgattatgtggagatttggcaggcataccttgattacctgaggagaagggttgatttcaaacaagactccagtaaagagctggaggagttgagggccgcctttactcgtgccttggagtatctgaagcaggaggtggaagagcgtttcaatgagagtggtgatccaagctgcgtgattatgcagaactgggctaggattgaggctcgactgtgcaataacatgcagaaagctcgggaactctgggatagcatcatgaccagaggaaatgccaagtacgccaacatgtggctagagtattacaacctggaaagagctcatggtgacacccagcactgccggaaggctctgcaccgggccgtccagtgcaccagtgactacccagagcacgtctgcgaagtgttactcaccatggagaggacagaaggttctttagaagattgggatatagctgttcagaaaactgaaacccgattagctcgtgtcaatgagcagagaatgaaggctgcagagaaggaagcagcccttgtgcagcaagaagaagaaaaggctgaacaacggaaaagagctcgggctgagaagaaagcgttaaaaaagaagaaaaagatcagaggcccagagaagcgcggagcagatgaggatgatgagaaagagtggggcgatgatgaagaagagcagccttccaaacgcagaagggtcgagaacagcatccctgcagctggagaaacacaaaatgtagaagtagcagcagggcccgctgggaaatgtgctgccgtagatgtggagcccccttcgaagcagaaggagaaggcagcctccctgaagagggacatgcccaaggtgctgcacgacagcagcaaggacagcatcaccgtctttgtcagcaacctgccctacagcatgcaggagccggacacgaagctcaggccactcttcgaggcctgtggggaggtggtccagatccgacccatcttcagcaaccgtggggatttccgaggttactgctacgtggagtttaaagaagagaaatcagcccttcaggcactggagatggaccggaaaagtgtagaagggaggccaatgtttgtttccccctgtgtggataagagcaaaaaccccgattttaaggtgttcaggtacagcacttccctagagaaacacaagctgttcatctcaggcctgcctttctcctgtactaaagaggaactagaagaaatctgtaaggctcatggcaccgtgaaggacctcaggctggtcaccaaccgggctggcaaaccaaagggcctggcctacgtggagtatgaaaatgaatcccaggcgtcgcaggctgtgatgaagatggacggcatgactatcaaagagaacatcatcaaagtggcaatcagcaaccctcctcagaggaaagttccagagaagccggagaccaggaaggcaccaggtggccccatgcttttgccgcagacatacggagcgagggggaagggaaggacgcagctgtctctactgcctcgtgccctgcagcgcccaagtgctgcagctcctcaggctgagaacggccctgccgcggctcctgcagttgccgccccagcagccaccgaggcacccaagatgtccaatgccgattttgccaagctgtttctgagaaagtgaacgggacgctgggagacaggaaatgccttacttcactctggcccggcggacctcccaccacccagcagtgcactggggatggacaggcctggtgtgctgcgtgctcgcaaccacagatggctcctcggctttagacagaaaggggaaggggttctaagtcaagagcctttcagtgctccctcatattgagggcagtggcagaaaagtgaccactctgcaggctgggcccaggatgtggtgtcctgagatagttttgtatcttaaagactgaggcacagaagcgaaacgagaacacactgtttttgagacacagttgtccaaatgtttctggccagctccggcccctttttgtatgacacttctcttccaccctgcacagcacatgtgcccgtcattcttttaattttaaaagatgaaatggcagatgctagtaattcacagaatggcctcttgtgggggtgggtctgagggaagtcagctataaaacatttgctggagttttgttcaatggggctgtgcatttttatattatgtgtttgtaaatgacatgtcagccattgtttcatgtttcctaaaagcagaatatttgcaacatttgttttgtataggaattatttgtgccacctgctgtggactgttttctttgcctagtgactagtgacctgtgttgtctaaacatgagtttcagccctttggttttgtttaataccatgtcaaatgcaaacttcaattctccccatttagctttattaaactgacgttctcttcaaaacttcttgctgaatggtactcagatgtgcattcacatacagatgtgttttgaagtgggtgtaccttgctttacctaatagatgtgtaaatagaacttttgtaagtcaaatcccattgtcactttgatttaaattattccagctgtgatgtgtcttcattttatagcagtttgacactggagcttttgagcttttttacctcacatcttttatcaaataatatttactgctttgaaaacagcaacagcattggccagttcagtaggggaagcttgctttattaagacactctggagaaagacgtcagggaatccttgtatatgtcgtgggaatcaactcctcatttatctgttgcgtaagtttaagtttttgtgcatcagtcgggttttctatatttttttaacttaacattttttaatataaccgattaaaaagtagacagaacagtaaaataaactcctgtgtgcctaccaaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:9733 -> Molecular function: GO:0000166 [nucleotide binding] evidence: IEA
            GeneID:9733 -> Molecular function: GO:0003723 [RNA binding] evidence: IEA
            GeneID:9733 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:9733 -> Biological process: GO:0006396 [RNA processing] evidence: IEA
            GeneID:9733 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:9733 -> Cellular component: GO:0016607 [nuclear speck] evidence: IEA
            GeneID:9733 -> Cellular component: GO:0043231 [intracellular membrane-bounded organelle] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.