GGRNA Home | Help | Advanced search

2019-03-22 05:09:59, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_014695               5828 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens coiled-coil domain containing 144A (CCDC144A), mRNA.
ACCESSION   NM_014695
VERSION     NM_014695.1  GI:149363641
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 5828)
  AUTHORS   Park,S.S., Stankiewicz,P., Bi,W., Shaw,C., Lehoczky,J., Dewar,K.,
            Birren,B. and Lupski,J.R.
  TITLE     Structure and evolution of the Smith-Magenis syndrome repeat gene
            clusters, SMS-REPs
  JOURNAL   Genome Res. 12 (5), 729-738 (2002)
   PUBMED   11997339
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from BC133019.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC133019.1, BC144225.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025084, ERS025088 [ECO:0000350]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..5828
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="17"
                     /map="17p11.2"
     gene            1..5828
                     /gene="CCDC144A"
                     /note="coiled-coil domain containing 144A"
                     /db_xref="GeneID:9720"
                     /db_xref="HGNC:29072"
     exon            1..420
                     /gene="CCDC144A"
                     /inference="alignment:Splign:1.39.8"
     variation       37
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201938569"
     variation       57
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200340971"
     CDS             77..4360
                     /gene="CCDC144A"
                     /codon_start=1
                     /product="coiled-coil domain-containing protein 144A"
                     /protein_id="NP_055510.1"
                     /db_xref="GI:149363642"
                     /db_xref="CCDS:CCDS45621.1"
                     /db_xref="GeneID:9720"
                     /db_xref="HGNC:29072"
                     /translation="
MASWGGEKRGGAEGSPKPAVYATRKTPSVGSQGDQWYLGYPGDQWSSGFPYSWWKNSVGSESKHGEGALDQPQHDVRLEDLGELHRAARSGDVPGVEHILAPGDTGVDKRDRKKSIQQLVPEYKEKQTPESLPQNNNPDWHPTNLTLSDETCQRSKNLKVDDKCPSVSPSMPENQSATKELGQMNLTEREKMDTGVVLLSGNDTLHDLCQSQLPENKESKEAEQDSELTSEEEQERLKGCENKQPQKTSQEPEMAKDCDREDIPIYPVLPHVQKSEEMWIEQGKLEWKNQLKLVINELKQRFGEIYEKYKIPACPEEEPLLDNSTRGTDVKDIPFNLTNNIPGCEEEDASEISVSVVFETFPEQKEPSLKNIIHPYYHPYSGSQEHVCQSSSKFHLHENKLDCDNDNKPGIGHIFSTDKNFHNDASTKKARNPEVVMVEMKEDQEFDLQMTKNMNQNSDSGSTNNYKSLKPKLENLSSLPPDSDRTSEVYLHEELQQDMQKFKNEVNTLEEEFLALKKEDVQLHKDVEEEMEKHRSNSTELSGTLTDGTTVGNDDDGLNQQIPRKENGEHDRPADKTSNEKNEVKNQIYPEADFADSMEPSEIASEDCELSHSVYENFMLLIEQLRMEYKDSASLPRIQDTFCLCEHLLKLKNNHCDQLTVKLKQMENMVSVLQNELSETKKTKLQLELQKIEWEKELYDLRLALKQENEEKRNADMLYNKDSEQLRIKEEECGKVVETKQQLKWNLRRLVKELRTVRNNLDLVVQERNDAQKQLSEEQDARILQDQILTSKQKELEMARKKMNSEISHRHQKEKDLFHEDCMLQEEIALLRLEIDTIKNQNKQKEKKYFEDIEAVKEKNDNLQKIIKLNEETLTETILQYSGQLNNLTAENKILNSELENGKQNQERLEIEMESYRCRLAAAVRDCDQSQTARDLKLDFQRTRQEWVRLHDKMKVDMSGLQAKNEILSEKLSNAESKINSLQIQLHNTRDALGRESLILERVQRDLSQTQCQKKETEQMYQIEQSKLKKYIAKQESVEERLSQLQSENMLLRQQLDDAHKKANSQEKTSSTIQDQFHSAAKNLQAESEKQILSLQEKNKELMDEYNHLKERMDQCEKEKAGRKIDLTEAQETVPSRCLHLDAENEVLQLQQTLFSMKAIQKQCETLQKNKKQLKQEVVNLKSYMERNMLERGKAEWHKLLIEERARKEIEEKLNEAILTLQKQAAVSHEQLVQLREDNTTSIKTQMELTIKDLESEISRIKTSQADFNKTELERYKELYLEEVKVRESLSNELSRTNEMIAEVSTQLTVEKEQTRSRSLFTAYATRPVLESPCVGNLNDSEGLNRKHIPRKKRSALKDMESYLLKMQQKLQNDLTAEVAGSSQTGLHRIPQCSSFSSSSLHLLLCSICQPFFLILQLLLNMNLDPI
"
     misc_feature    3803..4144
                     /gene="CCDC144A"
                     /note="Domain of unknown function (DUF3496); Region:
                     DUF3496; pfam12001"
                     /db_xref="CDD:192910"
     variation       81
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2928658"
     variation       87
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370924631"
     variation       94
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367735394"
     variation       129
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371265519"
     variation       160
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2349265"
     variation       164
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2928657"
     variation       186
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199720294"
     variation       189
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200445302"
     variation       195
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201250638"
     variation       214
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368437733"
     variation       223
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201730519"
     variation       225
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:117829593"
     variation       244
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375134449"
     variation       277
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200747549"
     variation       301
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2621675"
     variation       328
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369164566"
     variation       341
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185265343"
     variation       346
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375659406"
     variation       377
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202033635"
     variation       378
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2621674"
     variation       394
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201245161"
     exon            421..491
                     /gene="CCDC144A"
                     /inference="alignment:Splign:1.39.8"
     exon            492..740
                     /gene="CCDC144A"
                     /inference="alignment:Splign:1.39.8"
     variation       544
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200485989"
     exon            741..814
                     /gene="CCDC144A"
                     /inference="alignment:Splign:1.39.8"
     variation       795
                     /gene="CCDC144A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376419771"
     exon            815..1654
                     /gene="CCDC144A"
                     /inference="alignment:Splign:1.39.8"
     variation       819
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201792224"
     variation       824
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376080025"
     variation       838
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368503677"
     variation       851
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371860754"
     variation       867
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376203443"
     variation       887
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200353361"
     variation       888
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201297434"
     variation       943
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:9904955"
     variation       956
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376339930"
     variation       1036
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369859661"
     variation       1055
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373055547"
     variation       1110
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201473559"
     variation       1117
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377307125"
     variation       1157
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200444506"
     variation       1202
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375253790"
     variation       1251
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:59471143"
     variation       1375
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377459013"
     variation       1475
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192192037"
     variation       1510
                     /gene="CCDC144A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368571934"
     variation       1540
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371251531"
     variation       1569
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374355538"
     variation       1599
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368458434"
     variation       1600
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371753347"
     variation       1618
                     /gene="CCDC144A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374867098"
     exon            1655..1791
                     /gene="CCDC144A"
                     /inference="alignment:Splign:1.39.8"
     variation       1755
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371240426"
     exon            1792..1825
                     /gene="CCDC144A"
                     /inference="alignment:Splign:1.39.8"
     variation       1814
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:192011569"
     variation       1822
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200681750"
     exon            1826..1967
                     /gene="CCDC144A"
                     /inference="alignment:Splign:1.39.8"
     variation       1872
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199543560"
     exon            1968..2181
                     /gene="CCDC144A"
                     /inference="alignment:Splign:1.39.8"
     exon            2182..2365
                     /gene="CCDC144A"
                     /inference="alignment:Splign:1.39.8"
     exon            2366..2494
                     /gene="CCDC144A"
                     /inference="alignment:Splign:1.39.8"
     variation       2373
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199988293"
     variation       2476
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76075914"
     variation       2494
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61179727"
     exon            2495..3448
                     /gene="CCDC144A"
                     /inference="alignment:Splign:1.39.8"
     variation       2637
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202224055"
     variation       2787
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201842501"
     variation       2807
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371239375"
     variation       2814
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:375496328"
     variation       2836
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188939473"
     variation       2895
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201061368"
     variation       3213
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368391103"
     variation       3233
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370611046"
     variation       3234
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199644397"
     variation       3269
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371588258"
     exon            3449..3742
                     /gene="CCDC144A"
                     /inference="alignment:Splign:1.39.8"
     variation       3632
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200769219"
     variation       3646
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367684538"
     variation       3651
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201631905"
     variation       3659
                     /gene="CCDC144A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376628352"
     variation       3676
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369683294"
     variation       3701
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145983138"
     variation       3705
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376880657"
     variation       3721
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369332209"
     exon            3743..3963
                     /gene="CCDC144A"
                     /inference="alignment:Splign:1.39.8"
     variation       3814
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201355748"
     variation       3869
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200919178"
     variation       3892
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:147053829"
     exon            3964..4174
                     /gene="CCDC144A"
                     /inference="alignment:Splign:1.39.8"
     variation       3979
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376312770"
     variation       4052
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373439070"
     variation       4053
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377456200"
     variation       4079
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370800974"
     variation       4105
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:373902524"
     exon            4175..4217
                     /gene="CCDC144A"
                     /inference="alignment:Splign:1.39.8"
     exon            4218..4327
                     /gene="CCDC144A"
                     /inference="alignment:Splign:1.39.8"
     variation       4248
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201462518"
     variation       4257
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367741901"
     exon            4328..5828
                     /gene="CCDC144A"
                     /inference="alignment:Splign:1.39.8"
     variation       5064
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200664138"
     variation       5596
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2628365"
     variation       5651
                     /gene="CCDC144A"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:200499133"
     variation       5692
                     /gene="CCDC144A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371652534"
     variation       5814
                     /gene="CCDC144A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200931728"
ORIGIN      
cggtcctcctttcgcagattggaaaccgcgggctatcctgctgggaggttgtggccgaggcagtagctcgctactgatggcctcctggggtggagaaaagcggggaggggctgaggggtctccgaagccggcagtctacgccacgaggaagacccctagcgtcgggagccagggggaccagtggtacttgggctacccgggggaccagtggtcctcgggcttcccctacagctggtggaaaaacagcgtcggcagcgagagcaagcacggtgagggcgccttagaccagccccagcacgacgtccgcctggaagatcttggcgagctccacagagctgcccggtcgggcgacgtccctggggtggagcacatcttagctcctggagacactggcgtggacaagagggataggaagaagagcattcagcaactagttcctgaatataaggaaaaacagacacctgaaagtcttcctcaaaataacaatccagattggcatcctactaatttgacccttagtgatgagacttgtcagagatccaagaatctgaaagttgatgataaatgtccatctgtatcaccatcaatgcctgaaaatcagtcagcaaccaaagaactgggacagatgaacttaacagaacgagaaaagatggacactggagttgtacttctctcagggaatgatactctccatgacctgtgccaatcacagctaccagaaaacaaagagagcaaagaagcagaacaagactcggagctgacatcagaggaagagcaagaaagacttaaaggatgcgaaaataagcagccacagaaaacgtctcaagaaccagaaatggctaaggattgcgatagagaggatatacctatatatccagtacttcctcatgtgcaaaaatctgaggaaatgtggattgaacaaggcaaattagagtggaaaaaccaattaaaactcgtcataaatgagttaaagcagaggtttggtgaaatttatgaaaaatacaaaattccggcttgtcctgaggaagagccactacttgataactctacaagaggaacagatgtaaaggatattccctttaatttgacaaataacatacctggttgtgaggaagaagatgcatctgaaatatctgtctcagtggtattcgagacatttcctgaacaaaaagaacccagtctcaaaaatatcatccatccatactatcatccatactctgggtcccaggaacatgtttgccagtcatcttctaagtttcatttacatgaaaataaattagactgcgacaatgataacaaaccaggcattggacatatttttagtacagataagaactttcataatgatgcaagcactaagaaagcaaggaacccagaagtggttatggttgaaatgaaagaagaccaagagtttgatttgcaaatgacaaaaaatatgaaccaaaatagtgacagtggcagtacaaacaactataaaagcctgaaacctaaattagaaaatctgagttctttaccaccagattctgacagaacatcagaagtatatctacatgaagaattacagcaagacatgcaaaagtttaagaatgaggtcaacacattagaagaagagttcctggctttgaagaaagaagatgttcaacttcataaagatgttgaagaagaaatggagaagcacagaagtaatagcacagaattatcaggaaccctaactgatggtactactgttggcaatgatgatgatggactaaatcagcagattcctaggaaggaaaatggagagcatgacaggcctgcagataaaacatctaatgaaaagaacgaggtcaaaaaccaaatatatcctgaggctgactttgctgactcaatggagccatctgaaatagcctcagaggattgtgaattgtctcactctgtttatgagaattttatgttgctgattgaacaacttagaatggagtataaagattctgctagcctaccaagaatccaagacacattttgtttgtgtgaacacttactgaaacttaagaataatcactgtgaccaacttacagtaaaacttaaacaaatggaaaatatggtcagtgtactacaaaatgagctatctgaaacaaaaaagacaaaattacagttagaacttcaaaaaattgaatgggagaaagagctgtacgatttgagacttgccttaaaacaagaaaatgaggagaaaagaaatgccgatatgttgtataataaagatagtgaacagttaagaataaaagaagaggagtgtgggaaagtggttgaaacaaagcaacaacttaaatggaatctgagaagacttgttaaggaattgaggacagtaagaaataacttggatctggttgtgcaggagagaaacgatgcccagaagcaactttctgaagaacaggatgccagaatattacaagatcagattctgacgagtaaacaaaaggaactagaaatggctcgaaagaaaatgaattctgagatttctcataggcatcagaaagaaaaggatctctttcatgaagattgcatgttgcaggaagaaattgccttgctgagactggaaatagatacaataaaaaatcagaacaagcaaaaggaaaagaaatattttgaggacattgaggctgtgaaagaaaagaatgataaccttcaaaaaattataaaactaaatgaggaaacattaacagaaacaatactccagtacagtggacagctgaacaatctgacagctgagaacaaaatactcaattctgaactggagaatgggaaacagaaccaagaaagactagaaatagaaatggaatcataccgttgtagactagctgctgctgtacgtgactgtgatcaaagtcagacagcaagagacctaaaacttgatttccagagaacaagacaagagtgggttcgtttacatgacaaaatgaaggttgatatgtctggcctacaagctaagaatgagattctttctgaaaaactttctaatgctgaaagtaaaattaacagcctacaaattcagctccataacacaagagatgctcttggaagagagagtttgattttggaacgtgtgcaaagagacctcagccaaacacagtgtcagaagaaagaaactgaacaaatgtaccaaattgaacaaagcaaactgaagaaatacattgccaagcaggaatctgtagaggagagattatctcaactacaaagtgaaaatatgttgcttcgacagcaactggatgatgctcacaagaaagctaacagtcaagaaaagacaagcagtactatccaagaccagtttcattctgctgccaaaaatcttcaagctgagagtgaaaagcagattctttcactacaagagaagaacaaggagctgatggatgaatataatcatttaaaagaaagaatggatcaatgtgagaaagagaaagcaggaagaaaaattgaccttacagaagcacaggaaactgtaccttcacgatgtctacatctggatgcagagaatgaagttcttcaacttcaacagacattattctctatgaaagcaatacaaaagcaatgtgaaacactacagaagaataagaagcagctgaaacaagaagtagtaaacctcaaaagttatatggaaagaaatatgttagaacgtggtaaagctgaatggcataaactgttgattgaagaaagagcaaggaaggagatagaagaaaaattaaacgaagccattctcaccttgcagaaacaagcagcagtatctcatgaacagttagtacagttaagggaggataatactacttcaataaaaactcagatggaactcacaatcaaagatctggaatctgaaatctccagaataaaaacttcgcaagccgactttaataaaaccgaattggaaagatataaggaactctacctagaagaagtgaaagttagagaatccttgtcaaatgaactcagtagaactaatgagatgatagcagaggtcagtacgcaacttactgtggagaaagagcagaccagatccagatctctattcactgcttatgctacaaggccagtcctagagtcaccttgcgttggaaatcttaatgatagtgaaggtctcaacagaaaacatattccaagaaaaaagaggtctgctcttaaggacatggagagctacttgttgaagatgcagcagaagttgcaaaatgatctaactgcagaagtagcaggatccagccagactggactgcacagaattccacagtgctcgtccttctcctccagctctttgcacttgcttctttgctctatctgccaacctttttttctcatccttcagctgctactaaatatgaacctggatcctatatagcttctcctctaggatttacacacaaggaaaatctgaatcaagatccagttttggaagtaacaaaagaatatgcacagattttaagaagaaaatacatactctgaaagataaggcaattttatttgggctattcacatgatattttgtttcccattaaatatatgatgtgaacatttttactaaagggaaatattctatattatacatgtctgatgaaaatttatatagtattttaaataatgtttcttggcctcttcagctaacttttaagtggattttgcaaatgaaaaccagtattactgagttttacatactcgaactgcccaaatgtttgctgtttaaacagccaaataatcaagttgccattagtaatttagtggagccaattgatggcttgtttgtattttataattttatctttatacatagtgatagatttaagtttagatagacatcattttggtatactggtactgtggtcattgtcaatgtttggatgtattacgattgttatagtgcaatcaaacttagataattttaattttaagcactgatttatttagatctttccttgtggaaaaataaggtttgcctaaggctttttgcttttttatttattgtttcatttctttattagattaacttttgggaaacagtcttaaaattggagaaaatttccacattttaggaaaaacagctttccccctgtgggccatttgagagtaaattgctgacattatgccatcacatctggtatgtgggtattcccacaagtcaggacattttatataactacttcataatcggaaagttaacatcaatacacttgatcatttaattctcagtttcttttcaagttttcttaattgtctataatgttctttgtagcagaaggatcccattcaggtccatgaatttcatttagttgtcatgactctttcagtctggaacagttcctcagtttttctttgacctttatgaccttaaatcttttgaagagtaaagtccaataatacagaatgtccctccattggatttctctgaactttttttatgataagatttagatgataattttttttttggcaagagtatcacagaagttatcccatgatcttctcactgcattctatcaggtgacctgcaattattattattttttattttcatcttttaagttcaggggtacatgtgcaggatgtgcaggatgtccaggtttgttacataggtaaatatgtgccatggtggtttgctgcacagatcatcccatcacctaggtattaataatagcccagcatccattagctgttcttcacgatgctctcccttctttcacccgccaccatcccacatgcccctgtgtgtgttgttccccgccatgtgtccatgtgttctcattattcagctcccacttgtaagtgagagcatgcagtatttcattttctatttctgcgttggtttgctgagg
//

Annotations:



by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.