Home |
Help |
Advanced search
2024-04-25 16:36:58, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_014376 6615 bp mRNA linear PRI 15-JUN-2013
DEFINITION Homo sapiens cytoplasmic FMR1 interacting protein 2 (CYFIP2),
transcript variant 3, mRNA.
ACCESSION NM_014376 NM_030778
VERSION NM_014376.2 GI:82617629
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 6615)
AUTHORS Lauc,G., Huffman,J.E., Pucic,M., Zgaga,L., Adamczyk,B., Muzinic,A.,
Novokmet,M., Polasek,O., Gornik,O., Kristic,J., Keser,T.,
Vitart,V., Scheijen,B., Uh,H.W., Molokhia,M., Patrick,A.L.,
McKeigue,P., Kolcic,I., Lukic,I.K., Swann,O., van Leeuwen,F.N.,
Ruhaak,L.R., Houwing-Duistermaat,J.J., Slagboom,P.E., Beekman,M.,
de Craen,A.J., Deelder,A.M., Zeng,Q., Wang,W., Hastie,N.D.,
Gyllensten,U., Wilson,J.F., Wuhrer,M., Wright,A.F., Rudd,P.M.,
Hayward,C., Aulchenko,Y., Campbell,H. and Rudan,I.
TITLE Loci associated with N-glycosylation of human immunoglobulin G show
pleiotropy with autoimmune diseases and haematological cancers
JOURNAL PLoS Genet. 9 (1), E1003225 (2013)
PUBMED 23382691
REFERENCE 2 (bases 1 to 6615)
AUTHORS Hoeffer,C.A., Sanchez,E., Hagerman,R.J., Mu,Y., Nguyen,D.V.,
Wong,H., Whelan,A.M., Zukin,R.S., Klann,E. and Tassone,F.
TITLE Altered mTOR signaling and enhanced CYFIP2 expression levels in
subjects with fragile X syndrome
JOURNAL Genes Brain Behav. 11 (3), 332-341 (2012)
PUBMED 22268788
REMARK GeneRIF: Increased expression of the cytoplasmic FMR1-interacting
protein 2 (CYFIP2), a known FMRP interactor, is detected in fragile
X syndrome.
REFERENCE 3 (bases 1 to 6615)
AUTHORS Nachmany,H., Wald,S., Abekasis,M., Bulvik,S. and Weil,M.
TITLE Two potential biomarkers identified in mesenchymal stem cells and
leukocytes of patients with sporadic amyotrophic lateral sclerosis
JOURNAL Dis. Markers 32 (4), 211-220 (2012)
PUBMED 22430187
REMARK GeneRIF: blood samples of lateral sclerosis patients were found to
have significantly different levels of expression of CyFIP2 and
RbBP9 compared to the levels of expression in control subjects.
REFERENCE 4 (bases 1 to 6615)
AUTHORS Mongroo,P.S., Noubissi,F.K., Cuatrecasas,M., Kalabis,J., King,C.E.,
Johnstone,C.N., Bowser,M.J., Castells,A., Spiegelman,V.S. and
Rustgi,A.K.
TITLE IMP-1 displays cross-talk with K-Ras and modulates colon cancer
cell survival through the novel proapoptotic protein CYFIP2
JOURNAL Cancer Res. 71 (6), 2172-2182 (2011)
PUBMED 21252116
REMARK GeneRIF: Studies identify a novel proapoptotic gene target, CYFIP2,
which is downregulated by IMP-1, and mediates the regulation of
cell survival and K-Ras expression in colon cancer cells.
REFERENCE 5 (bases 1 to 6615)
AUTHORS Anitei,M., Stange,C., Parshina,I., Baust,T., Schenck,A., Raposo,G.,
Kirchhausen,T. and Hoflack,B.
TITLE Protein complexes containing CYFIP/Sra/PIR121 coordinate Arf1 and
Rac1 signalling during clathrin-AP-1-coated carrier biogenesis at
the TGN
JOURNAL Nat. Cell Biol. 12 (4), 330-340 (2010)
PUBMED 20228810
REMARK GeneRIF: Protein complexes containing CYFIP/Sra/PIR121 coordinate
Arf1 and Rac1 signalling during clathrin-AP-1-coated carrier
biogenesis at the trans-golgi network.
Erratum:[Nat Cell Biol. 2010 May;12(5):520]
REFERENCE 6 (bases 1 to 6615)
AUTHORS Eden,S., Rohatgi,R., Podtelejnikov,A.V., Mann,M. and Kirschner,M.W.
TITLE Mechanism of regulation of WAVE1-induced actin nucleation by Rac1
and Nck
JOURNAL Nature 418 (6899), 790-793 (2002)
PUBMED 12181570
REFERENCE 7 (bases 1 to 6615)
AUTHORS Schenck,A., Bardoni,B., Moro,A., Bagni,C. and Mandel,J.L.
TITLE A highly conserved protein family interacting with the fragile X
mental retardation protein (FMRP) and displaying selective
interactions with FMRP-related proteins FXR1P and FXR2P
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 98 (15), 8844-8849 (2001)
PUBMED 11438699
REFERENCE 8 (bases 1 to 6615)
AUTHORS Saller,E., Tom,E., Brunori,M., Otter,M., Estreicher,A., Mack,D.H.
and Iggo,R.
TITLE Increased apoptosis induction by 121F mutant p53
JOURNAL EMBO J. 18 (16), 4424-4437 (1999)
PUBMED 10449408
REFERENCE 9 (bases 1 to 6615)
AUTHORS Witke,W., Podtelejnikov,A.V., Di Nardo,A., Sutherland,J.D.,
Gurniak,C.B., Dotti,C. and Mann,M.
TITLE In mouse brain profilin I and profilin II associate with regulators
of the endocytic pathway and actin assembly
JOURNAL EMBO J. 17 (4), 967-976 (1998)
PUBMED 9463375
REFERENCE 10 (bases 1 to 6615)
AUTHORS Kitamura,T., Kitamura,Y., Yonezawa,K., Totty,N.F., Gout,I.,
Hara,K., Waterfield,M.D., Sakaue,M., Ogawa,W. and Kasuga,M.
TITLE Molecular cloning of p125Nap1, a protein that associates with an
SH3 domain of Nck
JOURNAL Biochem. Biophys. Res. Commun. 219 (2), 509-514 (1996)
PUBMED 8605018
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
BC011762.1, AL136549.1 and AC008676.6.
On Nov 23, 2005 this sequence version replaced gi:24307954.
Transcript Variant: This variant (3) uses a different segment for
its 5' UTR, compared to variant 2. Variants 1, 2, and 3 all encode
the same protein.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BC021008.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025084, ERS025085 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-2566 BC011762.1 11-2576
2567-4241 AL136549.1 2450-4124
4242-6615 AC008676.6 158750-161123 c
FEATURES Location/Qualifiers
source 1..6615
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="5"
/map="5q33.3"
gene 1..6615
/gene="CYFIP2"
/gene_synonym="PIR121"
/note="cytoplasmic FMR1 interacting protein 2"
/db_xref="GeneID:26999"
/db_xref="HGNC:13760"
/db_xref="MIM:606323"
exon 1..232
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
variation 62
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:767006"
variation 134
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="g"
/db_xref="dbSNP:767007"
variation 139..140
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace=""
/replace="c"
/db_xref="dbSNP:149802355"
variation 159
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:375891852"
variation 185
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="g"
/replace="t"
/db_xref="dbSNP:146714317"
misc_feature 229..231
/gene="CYFIP2"
/gene_synonym="PIR121"
/note="upstream in-frame stop codon"
exon 233..372
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
CDS 256..4017
/gene="CYFIP2"
/gene_synonym="PIR121"
/note="p53 inducible protein; p53-inducible protein 121"
/codon_start=1
/product="cytoplasmic FMR1-interacting protein 2"
/protein_id="NP_055191.2"
/db_xref="GI:82617630"
/db_xref="GeneID:26999"
/db_xref="HGNC:13760"
/db_xref="MIM:606323"
/translation="
MTTHVTLEDALSNVDLLEELPLPDQQPCIEPPPSSIMYQANFDTNFEDRNAFVTGIARYIEQATVHSSMNEMLEEGHEYAVMLYTWRSCSRAIPQVKCNEQPNRVEIYEKTVEVLEPEVTKLMKFMYFQRKAIERFCSEVKRLCHAERRKDFVSEAYLLTLGKFINMFAVLDELKNMKCSVKNDHSAYKRAAQFLRKMADPQSIQESQNLSMFLANHNRITQCLHQQLEVIPGYEELLADIVNICVDYYENKMYLTPSEKHMLLKVMGFGLYLMDGNVSNIYKLDAKKRINLSKIDKFFKQLQVVPLFGDMQIELARYIKTSAHYEENKSKWTCTQSSISPQYNICEQMVQIRDDHIRFISELARYSNSEVVTGSGLDSQKSDEEYRELFDLALRGLQLLSKWSAHVMEVYSWKLVHPTDKFCNKDCPGTAEEYERATRYNYTSEEKFAFVEVIAMIKGLQVLMGRMESVFNQAIRNTIYAALQDFAQVTLREPLRQAVRKKKNVLISVLQAIRKTICDWEGGREPPNDPCLRGEKDPKGGFDIKVPRRAVGPSSTQLYMVRTMLESLIADKSGSKKTLRSSLDGPIVLAIEDFHKQSFFFTHLLNISEALQQCCDLSQLWFREFFLELTMGRRIQFPIEMSMPWILTDHILETKEPSMMEYVLYPLDLYNDSAYYALTKFKKQFLYDEIEAEVNLCFDQFVYKLADQIFAYYKAMAGSVLLDKRFRAECKNYGVIIPYPPSNRYETLLKQRHVQLLGRSIDLNRLITQRISAAMYKSLDQAISRFESEDLTSIVELEWLLEINRLTHRLLCKHMTLDSFDAMFREANHNVSAPYGRITLHVFWELNFDFLPNYCYNGSTNRFVRTAIPFTQEPQRDKPANVQPYYLYGSKPLNIAYSHIYSSYRNFVGPPHFKTICRLLGYQGIAVVMEELLKIVKSLLQGTILQYVKTLIEVMPKICRLPRHEYGSPGILEFFHHQLKDIIEYAELKTDVFQSLREVGNAILFCLLIEQALSQEEVCDLLHAAPFQNILPRVYIKEGERLEVRMKRLEAKYAPLHLVPLIERLGTPQQIAIAREGDLLTKERLCCGLSMFEVILTRIRSYLQDPIWRGPPPTNGVMHVDECVEFHRLWSAMQFVYCIPVGTNEFTAEQCFGDGLNWAGCSIIVLLGQQRRFDLFDFCYHLLKVQRQDGKDEIIKNVPLKKMADRIRKYQILNNEVFAILNKYMKSVETDSSTVEHVRCFQPPIHQSLATTC
"
misc_feature 1405..3924
/gene="CYFIP2"
/gene_synonym="PIR121"
/note="Cytoplasmic Fragile-X interacting family; Region:
FragX_IP; pfam05994"
/db_xref="CDD:218846"
misc_feature 3364..3366
/gene="CYFIP2"
/gene_synonym="PIR121"
/experiment="experimental evidence, no additional details
recorded"
/note="N6-acetyllysine; propagated from
UniProtKB/Swiss-Prot (Q96F07.2); acetylation site"
variation 264
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:371578292"
variation 294
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:376687042"
variation 336
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:367998009"
variation 364
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:371710290"
variation 366
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="g"
/replace="t"
/db_xref="dbSNP:369640959"
exon 373..462
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
variation 417
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:375350435"
variation 453
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:369941644"
exon 463..537
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
variation 488
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:373074465"
variation 495
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:376568198"
variation 534..536
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace=""
/replace="c"
/db_xref="dbSNP:5872508"
variation 534
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:200051515"
exon 538..642
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
variation 549
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:368093712"
variation 552
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:139530784"
exon 643..824
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
variation 654
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:148895189"
variation 693
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:375762537"
variation 752
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:369872275"
variation 789
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:369062847"
variation 795
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:373151265"
exon 825..921
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
variation 852
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:185022541"
variation 876
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:199855067"
exon 922..1050
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
exon 1051..1155
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
exon 1156..1247
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
variation 1213
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:3207362"
exon 1248..1365
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
variation 1248
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:376920120"
variation 1253
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:148350606"
variation 1296
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:373676501"
variation 1308
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:372848474"
variation 1338
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:376982797"
exon 1366..1485
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
variation 1404
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:368645883"
variation 1425
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:139943836"
exon 1486..1611
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
variation 1542
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:17054446"
variation 1548
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:369323669"
variation 1554
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:372259482"
exon 1612..1778
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
variation 1617
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:6885590"
variation 1662
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:377728487"
variation 1735
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:370137201"
exon 1779..1926
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
variation 1779
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:370084969"
variation 1780
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:372630008"
variation 1785
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:1823035"
variation 1902
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:185026624"
exon 1927..2080
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
variation 2000
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:370992962"
variation 2010
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:142973944"
exon 2081..2237
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
variation 2106
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="g"
/db_xref="dbSNP:367974123"
variation 2154
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="c"
/db_xref="dbSNP:372104693"
variation 2160
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:375426388"
variation 2172
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:369858004"
exon 2238..2334
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
variation 2268
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:199725246"
variation 2274
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:372517333"
variation 2277
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="c"
/db_xref="dbSNP:375703811"
variation 2316
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:11551374"
exon 2335..2411
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
exon 2412..2520
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
variation 2457
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:374669553"
variation 2468
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:367713994"
variation 2469
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:141399379"
variation 2478
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:147011006"
variation 2486
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:376060688"
variation 2496
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:116817896"
exon 2521..2640
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
variation 2532
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:375270131"
variation 2567
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:17850790"
variation 2602
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:139353471"
variation 2603
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:373467559"
variation 2628
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="g"
/db_xref="dbSNP:13354242"
exon 2641..2840
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
variation 2655
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:377148423"
variation 2656
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="g"
/db_xref="dbSNP:201559066"
variation 2676
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:369405267"
variation 2678
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:374132627"
variation 2699
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="g"
/replace="t"
/db_xref="dbSNP:377648376"
variation 2703
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:371132555"
variation 2729
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:58005665"
variation 2749
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:11551375"
variation 2751
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:373107748"
variation 2752
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:377031549"
exon 2841..2928
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
variation 2854
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="g"
/db_xref="dbSNP:371766099"
variation 2875
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="g"
/db_xref="dbSNP:375088064"
variation 2895
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:7705781"
variation 2914
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="g"
/db_xref="dbSNP:373799565"
exon 2929..3072
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
variation 2964
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:371615057"
variation 3001
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:9313557"
variation 3030
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:183570769"
variation 3039
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:186955009"
exon 3073..3163
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
variation 3132
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:373712469"
exon 3164..3294
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
variation 3198
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:372286637"
variation 3210
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:377070210"
variation 3211
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:377125065"
variation 3261
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:150652041"
exon 3295..3367
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
STS 3306..3370
/gene="CYFIP2"
/gene_synonym="PIR121"
/standard_name="STS-M62008"
/db_xref="UniSTS:55216"
variation 3336
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:372902849"
exon 3368..3462
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
variation 3377
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="g"
/replace="t"
/db_xref="dbSNP:368529367"
variation 3393
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:371277463"
variation 3397
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:374707103"
variation 3408
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:73307968"
variation 3417
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:372007539"
variation 3450
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:376770442"
exon 3463..3701
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
variation 3480
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:369693364"
variation 3581
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:200428535"
variation 3584
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="g"
/db_xref="dbSNP:374666951"
variation 3591
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:114967929"
variation 3606
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:373142413"
variation 3618
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:199725841"
variation 3637
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:376484231"
variation 3643
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="g"
/replace="t"
/db_xref="dbSNP:199945789"
variation 3646
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:201475685"
variation 3649
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:369611074"
variation 3667
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="t"
/db_xref="dbSNP:148677157"
variation 3699
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="t"
/db_xref="dbSNP:377656882"
exon 3702..3849
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
variation 3714
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="c"
/db_xref="dbSNP:368047583"
variation 3783
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:200774279"
exon 3850..6615
/gene="CYFIP2"
/gene_synonym="PIR121"
/inference="alignment:Splign:1.39.8"
variation 3900
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:375350614"
STS 3940..4223
/gene="CYFIP2"
/gene_synonym="PIR121"
/standard_name="RH18378"
/db_xref="UniSTS:21434"
variation 3947
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:182717318"
variation 3953
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:370184404"
variation 3970
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:371399881"
variation 3971
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:201882855"
variation 3981
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:1803834"
STS 3987..4117
/gene="CYFIP2"
/gene_synonym="PIR121"
/standard_name="RH15890"
/db_xref="UniSTS:66388"
variation 4008
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="c"
/db_xref="dbSNP:375865980"
variation 4041
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:150599988"
variation 4063
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:373854212"
variation 4069
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:199652534"
variation 4076
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="c"
/db_xref="dbSNP:13174378"
variation 4166
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:73307980"
variation 4201
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:188974329"
variation 4225..4226
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace=""
/replace="a"
/db_xref="dbSNP:33954943"
variation 4225
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace=""
/replace="a"
/replace="aa"
/db_xref="dbSNP:3052310"
variation 4238..4241
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace=""
/replace="aaaa"
/db_xref="dbSNP:77677846"
variation 4278
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="c"
/db_xref="dbSNP:367860573"
variation 4436
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:73309941"
variation 4444
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="g"
/db_xref="dbSNP:368328314"
variation 4464
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:62387481"
variation 4512
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:149305788"
variation 4561..4562
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace=""
/replace="cc"
/db_xref="dbSNP:201743820"
variation 4562..4563
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace=""
/replace="tggcttcccaaagccccattcta"
/db_xref="dbSNP:372558922"
variation 4567
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace=""
/replace="a"
/db_xref="dbSNP:199925015"
variation 4587
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="g"
/db_xref="dbSNP:147411422"
variation 4609
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="g"
/replace="t"
/db_xref="dbSNP:140777310"
variation 4610
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace=""
/replace="c"
/db_xref="dbSNP:375776712"
variation 4610
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="g"
/db_xref="dbSNP:144727795"
variation 4675
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:192134177"
variation 4693
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:147444680"
STS 4718..4929
/gene="CYFIP2"
/gene_synonym="PIR121"
/standard_name="A006W02"
/db_xref="UniSTS:11242"
variation 4831
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="g"
/replace="t"
/db_xref="dbSNP:182865053"
variation 4894
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="g"
/replace="t"
/db_xref="dbSNP:6555991"
variation 4966
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:6555992"
variation 4981
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:367959403"
variation 5137
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:376881838"
variation 5177
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:148519938"
variation 5226
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:3734034"
variation 5322
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:6862302"
variation 5334
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:187411866"
variation 5363
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:1058517"
variation 5413
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:61736011"
variation 5498
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:142969781"
variation 5631..5632
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="gc"
/replace="tt"
/db_xref="dbSNP:377513219"
variation 5631
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="g"
/replace="t"
/db_xref="dbSNP:6880851"
variation 5632
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:6882097"
variation 5659
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="g"
/db_xref="dbSNP:76594372"
variation 5663..5664
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace=""
/replace="g"
/db_xref="dbSNP:370196582"
variation 5694
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:141032109"
variation 5753
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:375360183"
variation 5777
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:184072551"
variation 5907
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:11545337"
variation 5957
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="c"
/db_xref="dbSNP:80098745"
variation 6012
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:113243312"
variation 6098
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:143764472"
variation 6139
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="g"
/db_xref="dbSNP:146850512"
variation 6158
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:140263633"
variation 6189
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace=""
/replace="t"
/db_xref="dbSNP:111840775"
variation 6205
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:3087968"
variation 6239
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="a"
/replace="g"
/db_xref="dbSNP:10073822"
variation 6305
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="g"
/replace="t"
/db_xref="dbSNP:115781943"
variation 6463
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:375053822"
variation 6464
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="g"
/db_xref="dbSNP:186546184"
variation 6490
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="t"
/db_xref="dbSNP:145397143"
variation 6553
/gene="CYFIP2"
/gene_synonym="PIR121"
/replace="c"
/replace="g"
/db_xref="dbSNP:371519970"
ORIGIN
ggaagggcctcttcctctgtgagaattcagcattttgcaaccatccaaaaatgttgagggcatgctttgcttccagggcagacagagcagcacagtgagcatgggacacaggatccctgacttgctgtgtgcccttaaaccagccactacctctctgacgttcaaaattgagcaatggaaggcagcctgcccaactgttacctgcctgtcatcatgaaagcctgcggatgagtgcagaatacagaaactgcagccatgaccacgcacgtcaccctggaagatgccctgtccaacgtggacctgcttgaagagcttcccctccccgaccagcagccatgcatcgagcctccaccttcctccatcatgtaccaggctaactttgacacaaactttgaggacaggaatgcatttgtcacgggcattgcaaggtacattgagcaggctacagtccactccagcatgaatgagatgctggaggaaggacatgagtatgcggtcatgctgtacacctggcgcagctgttcccgggccattccccaggtgaaatgcaacgagcagcccaaccgagtagagatctatgagaagacagtagaggtgctggagccggaggtcaccaagctcatgaagttcatgtattttcagcgcaaggccatcgagcggttctgcagcgaggtgaagcggctgtgccatgccgagcgcaggaaggactttgtctctgaggcctacctcctgacccttggcaagttcatcaacatgtttgctgtcctggatgagctaaagaacatgaagtgcagcgtcaagaatgaccactctgcctacaagagggcagcacagttcctgcggaagatggcagatccccagtctatccaggagtcgcagaacctttccatgttcctggccaaccacaacaggatcacccagtgtctccaccagcaacttgaagtgatcccaggctatgaggagctgctggctgacattgtcaacatctgtgtggattactacgagaacaagatgtacctgactcccagtgagaaacatatgctcctcaaggtgatgggctttggcctctacctaatggatggaaatgtcagtaacatttacaaactggatgccaagaagagaattaatcttagcaaaattgataaattctttaagcagctgcaggtggtgccccttttcggcgacatgcagatagagctggccagatacattaagaccagtgctcactatgaagagaacaagtccaagtggacgtgcacccagagcagcatcagcccccagtacaatatctgcgagcagatggttcagatccgggatgaccacatccgcttcatctccgagctcgctcgctacagcaacagtgaggtggtgacgggctcagggctggacagccagaagtcagacgaggagtatcgcgagctcttcgacctagccctgcggggtctgcagcttctatccaagtggagcgcccacgtcatggaggtgtactcttggaagctggttcatcccacagacaagttctgcaacaaggactgtcctggcaccgcggaggaatatgagagagccacacgctacaattacaccagtgaggaaaaatttgccttcgttgaggtgatcgccatgatcaaaggcctgcaggtgctcatgggcaggatggagagcgtcttcaaccaggccatcaggaacaccatctacgcggcattgcaggacttcgcccaggtgacgctgcgtgagcccctgcggcaggcggtacggaagaagaagaatgtcctcatcagcgtcctacaggcaattcgaaagaccatctgtgactgggagggagggcgagagccccctaatgacccatgcttgagaggggagaaggaccccaaaggtggatttgatatcaaggtgccccggcgtgctgtggggccatccagcacacagctgtacatggtgcggaccatgcttgaatcactcattgcagacaaaagcggctccaagaagaccctgaggagcagcctggatggacccattgtcctcgccatagaggactttcacaaacagtccttcttcttcacacatctgctcaacatcagtgaagccctgcagcagtgttgtgacctctcccagctctggttccgagaattcttcctggagttaaccatgggccgacgaatccagttccccatcgagatgtccatgccctggattctaacggaccatatcctggaaaccaaagaaccttccatgatggagtatgtcctctaccctctggatctgtacaacgacagcgcctactatgctctgaccaagtttaaaaagcagttcctgtacgatgagatagaagctgaggtgaacctgtgttttgatcagtttgtctacaagctggcagaccagatctttgcttactacaaagccatggctggcagtgtcctgttggataaacgttttcgagctgagtgtaagaattatggcgtcatcattccgtatccaccgtccaatcgctatgaaacactgctgaagcagagacacgtccagctgttgggtagatcaattgacttgaacagactcattacccagcgcatctctgccgccatgtataaatccttggaccaagctatcagccgctttgagagtgaggacctgacctccattgtggagctggagtggctgctggagattaaccggctcacgcatcggctgctctgtaagcatatgacgctggacagcttcgatgccatgttccgagaggccaatcacaatgtgtccgccccctatggccgtatcaccctgcatgtcttctgggaactgaactttgactttctccccaactactgctacaatgggtccactaaccgttttgtgcggactgccattcctttcacccaagaaccacaacgagacaaacctgccaacgtccagccttattacctctatggatccaagcctctcaacattgcctacagccacatctacagctcctacaggaatttcgtggggccacctcatttcaagactatctgcagactcctgggttatcagggcatcgctgtggtcatggaggaactgctaaagattgtgaagagcttgctccaaggaaccattctccagtatgtgaaaacactgatagaggtgatgcccaagatatgccgcttgccccgacatgagtatggctccccagggatcctggagttcttccaccaccagctgaaggacatcattgagtacgcagagctcaaaacagacgtgttccagagcctgagggaagtgggcaatgccatcctcttctgcctcctcatagagcaagctctgtctcaggaggaggtctgcgatttgctccatgccgcacccttccaaaacatcttgcctagagtctacatcaaagagggggagcgcctggaggtccggatgaaacgtctggaagccaagtatgccccgctccacctggtccctctgatcgagcggctggggacccctcagcaaatcgccattgctcgcgagggtgacctcctgaccaaggagcggctgtgctgtggcctgtccatgttcgaggtcatcctgacccgcattcggagctacctgcaggaccccatctggcggggcccaccgcccaccaatggcgtcatgcacgtcgatgagtgtgtggagttccaccggctgtggagcgccatgcagttcgtgtactgcatccctgtgggaaccaacgagttcacagctgagcagtgtttcggcgatggcttgaactgggctggttgctccatcattgtcctgctgggccagcagcgtcgctttgacctgttcgacttctgttaccacctgctaaaagtgcagaggcaggacgggaaggatgaaatcattaagaatgtgcccctgaagaagatggccgaccggatcaggaagtatcagatcttgaacaatgaggtttttgccatcctgaacaaatacatgaagtccgtggagacagacagttccactgtggagcatgtgcgctgcttccagccacccatccaccagtccttggccaccacttgctaagcagaagatcctgcagacccttatctggaggaggaagagaagcaggagagagaaagccacagccagcctgccataggatccaactggacaacgtgtgggatggacctggaaacaagcacctccccaaacacatcaccactccctagggcggggcctgtgcatgctctcccatgacatctccatgctggtttctccatagcataaatgaaaaaaaaaaaaaaaaagtaaacagggcagtgtgtgctttttcttttctcccccctcaactatattaagaactcctagtttcaccctttctccatcccatcatcccacctatctgtggttgcttcccaagacctcctcccaagatagacatctcctacccagtgcccttgtgtgaccccaggactcaagtctcagactgtgaacagatgtggccatgcccagagacgccagcctggccagaagggcatgcctcagcttactacttcatctctcctggttccctccctgcagtgccccgggtgtcatcttctcccactctgggtaccagggattctaccacataggcttcccaaagccccattctaactcccctctctcagggaagccctagagagaggtccaaaaagcattcacagctgtatcacactctatgcaggtggggtaggagactgatcaggcctgctgtggggaagcagtatgtatgaacacagccagaaatgtcatagtccaaacaggatgctttcaggccatctcagctgcttgatggtgagatggttcccttattccttcaggaaaggcttagcattgggccacataggggaagcagctttgaacaaatcagtcatagcactgcctatagcattagccagtgaccaaattagggacaacgtcttggcacagaattgcttatcaaggaacatttccacaagaaagaaaatattaaggggttatttccacagaagcccaaaacgtcttggaaacacagaggtgaggaggaggaatagtaattgtcaatgagcttttaataccaagatacaccccctgcccccaaagaagagtcctcttttagggaatcagaaccttcattgtcctagaagctgaaagattcttggaacattttagcttttactctcaacttgctgttctctttacattccttaagttagactttcgggtgtggcttctctcccaggggtaacatttacttccattttctagactgaaccaaaagtcttctgcagaatctcccaccgagtgtggtaagaaggaaggacaaaaggctttaggatataaatttcatgttacagagcatgtcattgtcaaaggaaatctgtggccctgagattttaagaacataaaatgtgacatttgatatttctccagcccagggaagtaagatggttagcaatggttgccttaatcaaatggtcccatttttaaccccaaaggaagtgcccacagcaagaggtttgtgtgatgcacttatgtcctccggtgaggaaagggggccacatatgaaaggccccttaggtcagatcctgagagtagcacatttgagtgcagattcctgggccccacctcaaacctactaattctgaatctctgggaatagggccaggaaatctgccctttctacaaactacccaagttgttctgttgcacatcaatgtttgggaaccactgctgtaagggaatcattctggtcaccttgagctttgagctaccactaagccatgaaagaaaatacatcatacagggaagagagaagggaggaggttccaagtagtaactggcagatcctcctgtctggaggtaccaccttctattctggtttctgacttttccttcttgatgaccatagatgtgttccagaggcaaaagagacacattatcccagatggcagaacatgctttcaaaacatataaaatgtcaaagttccagatccttctacatctttagtcctgtctgaggatggtagctggctctctgtagctgatagatggctagagttccatccaaatccttgaccacgacttcatggagatttgaataatctatttgatgagatttctatttcaataacccacctctctcaccccacattcatatccctaaatttgaccctctgggccgagtcacattaccttcaggagacttgatcccagtagactgaggtcttccctttcagcagaaagatttcatttccctggcttgccagtggcactgatttccgaacacccaatgagtttaatattctttcctccttggcattactgccccagcctctttttattttttttgtgtgtgtctaataaccaggaaaaaaataaagcttaggttttaaaaagttttaaaaataatctgtttcagaaactgtcaaatgtaccatatttgtattaagagttgttgggaatttttgtacaatgaatttacatttatttatggtgacatatttacgcttgtgatcaaataatgatgttaaattcttaaatcatatttgctatgcagctgaagatgatattttgatttgtattttgggggtacctgtgttgagttgataaacatttccatcttcattaaaactgcttccaaactagtaaaaccagcaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:26999 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:26999 -> Biological process: GO:0006915 [apoptotic process] evidence: IDA
GeneID:26999 -> Biological process: GO:0016337 [cell-cell adhesion] evidence: IDA
GeneID:26999 -> Biological process: GO:0038096 [Fc-gamma receptor signaling pathway involved in phagocytosis] evidence: TAS
GeneID:26999 -> Biological process: GO:0045087 [innate immune response] evidence: TAS
GeneID:26999 -> Biological process: GO:0045862 [positive regulation of proteolysis] evidence: IDA
GeneID:26999 -> Biological process: GO:0097202 [activation of cysteine-type endopeptidase activity] evidence: IDA
GeneID:26999 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:26999 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
GeneID:26999 -> Cellular component: GO:0030054 [cell junction] evidence: IEA
GeneID:26999 -> Cellular component: GO:0043005 [neuron projection] evidence: IEA
GeneID:26999 -> Cellular component: GO:0045202 [synapse] evidence: IDA
GeneID:26999 -> Cellular component: GO:0048471 [perinuclear region of cytoplasm] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.