Home |
Help |
Advanced search
2024-04-20 10:39:37, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_014281 1897 bp mRNA linear PRI 07-JUL-2013
DEFINITION Homo sapiens poly-U binding splicing factor 60KDa (PUF60),
transcript variant 2, mRNA.
ACCESSION NM_014281
VERSION NM_014281.4 GI:402794051
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1897)
AUTHORS Kajiwara,T., Matsushita,K., Itoga,S., Tamura,M., Tanaka,N.,
Tomonaga,T., Matsubara,H., Shimada,H., Habara,Y., Matsuo,M. and
Nomura,F.
TITLE SAP155-mediated c-myc suppressor far-upstream element-binding
protein-interacting repressor splicing variants are activated in
colon cancer tissues
JOURNAL Cancer Sci. 104 (2), 149-156 (2013)
PUBMED 23113893
REMARK GeneRIF: Circulating FIR variant mRNA in the peripheral blood of
cancer patients were significantly overexpressed compared to that
in healthy volunteers.
REFERENCE 2 (bases 1 to 1897)
AUTHORS Matsushita,K., Kajiwara,T., Tamura,M., Satoh,M., Tanaka,N.,
Tomonaga,T., Matsubara,H., Shimada,H., Yoshimoto,R., Ito,A.,
Kubo,S., Natsume,T., Levens,D., Yoshida,M. and Nomura,F.
TITLE SAP155-mediated splicing of FUSE-binding protein-interacting
repressor serves as a molecular switch for c-myc gene expression
JOURNAL Mol. Cancer Res. 10 (6), 787-799 (2012)
PUBMED 22496461
REMARK GeneRIF: Data indicate that altered FIR and c-myc pre-mRNA
splicing, in addition to c-Myc expression by augmented
FIR/FIRDeltaexon2-SAP155 complex, potentially contribute to
colorectal cancer development.
REFERENCE 3 (bases 1 to 1897)
AUTHORS Hsiao,H.H., Nath,A., Lin,C.Y., Folta-Stogniew,E.J., Rhoades,E. and
Braddock,D.T.
TITLE Quantitative characterization of the interactions among c-myc
transcriptional regulators FUSE, FBP, and FIR
JOURNAL Biochemistry 49 (22), 4620-4634 (2010)
PUBMED 20420426
REMARK GeneRIF: FIR is monomeric in solution but dimerizes upon DNA
binding; DNA-induced dimerization is mediated by FIR's RNA
recognition motif.
REFERENCE 4 (bases 1 to 1897)
AUTHORS Matsushita,K., Tomonaga,T., Kajiwara,T., Shimada,H., Itoga,S.,
Hiwasa,T., Kubo,S., Ochiai,T., Matsubara,H. and Nomura,F.
TITLE c-myc suppressor FBP-interacting repressor for cancer diagnosis and
therapy
JOURNAL Front. Biosci. 14, 3401-3408 (2009)
PUBMED 19273283
REMARK Publication Status: Online-Only
REFERENCE 5 (bases 1 to 1897)
AUTHORS Matsushita,K., Tomonaga,T., Shimada,H., Shioya,A., Higashi,M.,
Matsubara,H., Harigaya,K., Nomura,F., Libutti,D., Levens,D. and
Ochiai,T.
TITLE An essential role of alternative splicing of c-myc suppressor
FUSE-binding protein-interacting repressor in carcinogenesis
JOURNAL Cancer Res. 66 (3), 1409-1417 (2006)
PUBMED 16452196
REFERENCE 6 (bases 1 to 1897)
AUTHORS Poleev,A., Hartmann,A. and Stamm,S.
TITLE A trans-acting factor, isolated by the three-hybrid system, that
influences alternative splicing of the amyloid precursor protein
minigene
JOURNAL Eur. J. Biochem. 267 (13), 4002-4010 (2000)
PUBMED 10866799
REFERENCE 7 (bases 1 to 1897)
AUTHORS Liu,J., He,L., Collins,I., Ge,H., Libutti,D., Li,J., Egly,J.M. and
Levens,D.
TITLE The FBP interacting repressor targets TFIIH to inhibit activated
transcription
JOURNAL Mol. Cell 5 (2), 331-341 (2000)
PUBMED 10882074
REFERENCE 8 (bases 1 to 1897)
AUTHORS Bouffard,P., Barbar,E., Briere,F. and Boire,G.
TITLE Interaction cloning and characterization of RoBPI, a novel protein
binding to human Ro ribonucleoproteins
JOURNAL RNA 6 (1), 66-78 (2000)
PUBMED 10668799
REFERENCE 9 (bases 1 to 1897)
AUTHORS Page-McCaw,P.S., Amonlirdviman,K. and Sharp,P.A.
TITLE PUF60: a novel U2AF65-related splicing activity
JOURNAL RNA 5 (12), 1548-1560 (1999)
PUBMED 10606266
REFERENCE 10 (bases 1 to 1897)
AUTHORS Bouffard,P., Briere,F., Wellinger,R.J. and Boire,G.
TITLE Identification of ribonucleoprotein (RNP)-specific protein
interactions using a yeast RNP interaction trap assay (RITA)
JOURNAL BioTechniques 27 (4), 790-796 (1999)
PUBMED 10524322
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from CN371576.1, AF217197.2 and
AW249619.1.
On Sep 1, 2012 this sequence version replaced gi:17978510.
Summary: This gene encodes a nucleic acid-binding protein that
plays a role in a variety of nuclear processes, including pre-mRNA
splicing and transcriptional regulation. The encoded protein forms
a complex with the far upstream DNA element (FUSE) and FUSE-binding
protein at the myelocytomatosis oncogene (MYC) promoter. This
complex represses MYC transcription through the core-TFIIH basal
transcription factor. Alternatively spliced transcript variants
encoding multiple isoforms have been observed for this gene.
[provided by RefSeq, Aug 2012].
Transcript Variant: This variant (2) lacks an alternate in-frame
exon in the coding region, compared to variant 1. The encoded
isoform (b) is shorter than isoform a.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BC008875.2, AF217197.2 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-73 CN371576.1 4-76
74-1855 AF217197.2 1-1782
1856-1897 AW249619.1 1-42 c
FEATURES Location/Qualifiers
source 1..1897
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="8"
/map="8q24.3"
gene 1..1897
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/note="poly-U binding splicing factor 60KDa"
/db_xref="GeneID:22827"
/db_xref="HGNC:17042"
/db_xref="HPRD:18051"
/db_xref="MIM:604819"
exon 1..107
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/inference="alignment:Splign:1.39.8"
CDS 84..1712
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/note="isoform b is encoded by transcript variant 2; FBP
interacting repressor; pyrimidine tract binding splicing
factor; Ro ribonucleoprotein-binding protein 1;
FUSE-binding protein-interacting repressor;
poly(U)-binding-splicing factor PUF60; Siah binding
protein 1"
/codon_start=1
/product="poly(U)-binding-splicing factor PUF60 isoform b"
/protein_id="NP_055096.2"
/db_xref="GI:17298690"
/db_xref="CCDS:CCDS47933.1"
/db_xref="GeneID:22827"
/db_xref="HGNC:17042"
/db_xref="HPRD:18051"
/db_xref="MIM:604819"
/translation="
MATATIALQVNGQQGGGSEPAAAAAVVAAGDKWKPPQGTDSIKMENGQSTAAKLGLPPLTPEQQEALQKAKKYAMEQSIKSVLVKQTIAHQQQQLTNLQMAAQRQRALAIMCRVYVGSIYYELGEDTIRQAFAPFGPIKSIDMSWDSVTMKHKGFAFVEYEVPEAAQLALEQMNSVMLGGRNIKVGRPSNIGQAQPIIDQLAEEARAFNRIYVASVHQDLSDDDIKSVFEAFGKIKSCTLARDPTTGKHKGYGFIEYEKAQSSQDAVSSMNLFDLGGQYLRVGKAVTPPMPLLTPATPGGLPPAAAVAAAAATAKITAQEAVAGAAVLGTLGTPGLVSPALTLAQPLGTLPQAVMAAQAPGVITGVTPARPPIPVTIPSVGVVNPILASPPTLGLLEPKKEKEEEELFPESERPEMLSEQEHMSISGSSARHMVMQKLLRKQESTVMVLRNMVDPKDIDDDLEGEVTEECGKFGAVNRVIIYQEKQGEEEDAEIIVKIFVEFSIASETHKAIQALNGRWFAGRKVVAEVYDQERFDNSDLSA
"
misc_feature 420..644
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/note="RRM (RNA recognition motif), also known as RBD (RNA
binding domain) or RNP (ribonucleoprotein domain), is a
highly abundant domain in eukaryotes found in proteins
involved in post-transcriptional gene expression processes
including mRNA and rRNA...; Region: RRM; cd00590"
/db_xref="CDD:100104"
misc_feature order(426..428,546..548,552..554)
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/note="RNA/DNA binding site [nucleotide binding]; other
site"
/db_xref="CDD:100104"
misc_feature 636..644
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/note="RRM dimerization site [polypeptide binding]; other
site"
/db_xref="CDD:100104"
misc_feature 711..935
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/note="RRM (RNA recognition motif), also known as RBD (RNA
binding domain) or RNP (ribonucleoprotein domain), is a
highly abundant domain in eukaryotes found in proteins
involved in post-transcriptional gene expression processes
including mRNA and rRNA...; Region: RRM; cd00590"
/db_xref="CDD:100104"
misc_feature order(717..719,837..839,843..845)
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/note="RNA/DNA binding site [nucleotide binding]; other
site"
/db_xref="CDD:100104"
misc_feature 927..935
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/note="RRM dimerization site [polypeptide binding]; other
site"
/db_xref="CDD:100104"
misc_feature 1446..1667
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/note="RRM (RNA recognition motif), also known as RBD (RNA
binding domain) or RNP (ribonucleoprotein domain), is a
highly abundant domain in eukaryotes found in proteins
involved in post-transcriptional gene expression processes
including mRNA and rRNA...; Region: RRM; cd00590"
/db_xref="CDD:100104"
misc_feature order(1572..1574,1578..1580)
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/note="RNA/DNA binding site [nucleotide binding]; other
site"
/db_xref="CDD:100104"
misc_feature 1662..1667
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/note="RRM dimerization site [polypeptide binding]; other
site"
/db_xref="CDD:100104"
exon 108..194
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/inference="alignment:Splign:1.39.8"
variation 164
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:11540342"
exon 195..290
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/inference="alignment:Splign:1.39.8"
exon 291..380
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/inference="alignment:Splign:1.39.8"
exon 381..542
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/inference="alignment:Splign:1.39.8"
variation 467
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:11540345"
exon 543..635
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/inference="alignment:Splign:1.39.8"
exon 636..849
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/inference="alignment:Splign:1.39.8"
exon 850..1040
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/inference="alignment:Splign:1.39.8"
variation 947
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/replace="c"
/replace="g"
/db_xref="dbSNP:11540343"
exon 1041..1176
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/inference="alignment:Splign:1.39.8"
exon 1177..1412
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/inference="alignment:Splign:1.39.8"
exon 1413..1888
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/inference="alignment:Splign:1.39.8"
STS 1510..1760
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/standard_name="WI-19511"
/db_xref="UniSTS:31309"
STS 1701..1844
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
/standard_name="RH70666"
/db_xref="UniSTS:37443"
polyA_site 1855
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
polyA_site 1888
/gene="PUF60"
/gene_synonym="FIR; RoBPI; SIAHBP1"
ORIGIN
tccgtgcaccggcacccagatcgcgcgagacagcggaaggagcaagagtgggaggcgcgcgcggaggccgcgacggacgcaagatggcgacggcgaccatagctctccaggtcaatggccagcaaggaggggggtccgagccggcggcggcggcggcagtggtggcagcgggagacaaatggaaacctccacagggcacagactccatcaagatggagaacgggcagagcacagccgccaagctggggctgcctcccctgacgcccgagcagcaggaggcccttcagaaggccaagaagtacgccatggagcagagcatcaagagtgtgctggtgaagcagaccatcgcgcaccagcagcagcagctcaccaacctgcagatggcggctcagcggcagcgggcgctggccatcatgtgccgcgtctacgtgggctctatctactatgagctgggggaggacaccatccgccaggcctttgccccctttggccccatcaagagcatcgacatgtcctgggactccgtcaccatgaagcacaagggctttgccttcgtggagtatgaggtccccgaagctgcacagctggccttggagcagatgaactcggtgatgctggggggcaggaacatcaaggtgggcagacccagcaacatagggcaggcccagcccatcatagaccagttggctgaggaggcacgggccttcaaccgcatctacgtggcctctgtgcaccaggacctctcagacgatgacatcaagagcgtgtttgaggcctttggcaagatcaagtcctgcacactggcccgggaccccacaactggcaagcacaagggctacggcttcattgagtacgagaaggcccagtcgtcccaagatgctgtgtcttccatgaacctctttgacctgggtggccagtacttgcgggtgggcaaggctgtcacaccgcccatgcccctactcacaccagccacgcctggaggcctcccacctgccgctgctgtggcagctgctgcagccactgccaagatcacagctcaggaagcagtggccggagcagcggtgctgggtaccctgggcacacctggactggtgtccccagcactgaccctggcccagcccctgggcactttgccccaggctgtcatggctgcccaggcacctggagtcatcacaggtgtgaccccagcccgtcctcctatcccggtcaccatcccctcggtgggagtggtgaaccccatcctggccagccctccaacgctgggtctcctggagcccaagaaggagaaggaagaagaggagctgtttcccgagtcagagcggccagagatgctgagcgagcaggagcacatgagcatctcgggcagtagcgcccgacacatggtgatgcagaagctgctccgcaagcaggagtctacagtgatggttctgcgcaacatggtggaccccaaggacatcgatgatgacctggaaggggaggtgacagaggagtgtggcaagttcggggccgtgaaccgcgtcatcatctaccaagagaaacaaggcgaggaggaggatgcagaaatcattgtcaagatctttgtggagttttccatagcctctgagactcataaggccatccaggccctcaatggccgctggtttgctggccgcaaggtggtggctgaagtgtacgaccaggagcgttttgataacagtgacctctctgcgtgacagtggtccctctccccggacttgcacttgttccttgtttcctctgggttttatagtgatacagtggtgtccccggggccaggcgcgctctgcccagcccagcctacagtgcggataaaggtgcggatgctgctggccctgaacgtccgtgtgtctgccgtcggtcctgtcaccgaaaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:22827 -> Molecular function: GO:0000166 [nucleotide binding] evidence: IEA
GeneID:22827 -> Molecular function: GO:0003677 [DNA binding] evidence: IEA
GeneID:22827 -> Molecular function: GO:0003723 [RNA binding] evidence: IEA
GeneID:22827 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:22827 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
GeneID:22827 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: IEA
GeneID:22827 -> Biological process: GO:0006397 [mRNA processing] evidence: IEA
GeneID:22827 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA
GeneID:22827 -> Biological process: GO:0008380 [RNA splicing] evidence: IEA
GeneID:22827 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:22827 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
GeneID:22827 -> Cellular component: GO:0019907 [cyclin-dependent protein kinase activating kinase holoenzyme complex] evidence: IDA
GeneID:22827 -> Cellular component: GO:0030529 [ribonucleoprotein complex] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.