GGRNA Home | Help | Advanced search

2020-10-24 06:30:16, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_013339               3371 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens ALG6, alpha-1,3-glucosyltransferase (ALG6), mRNA.
ACCESSION   NM_013339
VERSION     NM_013339.3  GI:215276978
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3371)
  AUTHORS   Goreta,S.S., Dabelic,S., Pavlinic,D., Lauc,G. and Dumic,J.
  TITLE     Frequency Determination of alpha-1,3 Glucosyltransferase p.Y131H
            and p.F304S Polymorphisms in the Croatian Population Revealed Five
            Novel Single Nucleotide Polymorphisms in the hALG6 Gene
  JOURNAL   Genet Test Mol Biomarkers 16 (1), 50-53 (2012)
   PUBMED   21899441
  REMARK    GeneRIF: Five novel base substitutions in the hALG6 gene were also
            found: three in exon 5 (c.383T>C, c.390G>A, and c.429G>C) and two
            in a downstream intervening sequence (IVS5+17C/T and IVS5+34G/A).
REFERENCE   2  (bases 1 to 3371)
  AUTHORS   Eklund,E.A., Sun,L., Yang,S.P., Pasion,R.M., Thorland,E.C. and
            Freeze,H.H.
  TITLE     Congenital disorder of glycosylation Ic due to a de novo deletion
            and an hALG-6 mutation
  JOURNAL   Biochem. Biophys. Res. Commun. 339 (3), 755-760 (2006)
   PUBMED   16321363
  REMARK    GeneRIF: Our findings extend the causes of CDG to larger DNA
            deletions and identify the first Japanese CDG-Ic mutation.
REFERENCE   3  (bases 1 to 3371)
  AUTHORS   Westphal,V., Xiao,M., Kwok,P.Y. and Freeze,H.H.
  TITLE     Identification of a frequent variant in ALG6, the cause of
            Congenital Disorder of Glycosylation-Ic
  JOURNAL   Hum. Mutat. 22 (5), 420-421 (2003)
   PUBMED   14517965
REFERENCE   4  (bases 1 to 3371)
  AUTHORS   Schollen,E., Martens,K., Geuzens,E. and Matthijs,G.
  TITLE     DHPLC analysis as a platform for molecular diagnosis of congenital
            disorders of glycosylation (CDG)
  JOURNAL   Eur. J. Hum. Genet. 10 (10), 643-648 (2002)
   PUBMED   12357336
REFERENCE   5  (bases 1 to 3371)
  AUTHORS   Oriol,R., Martinez-Duncker,I., Chantret,I., Mollicone,R. and
            Codogno,P.
  TITLE     Common origin and evolution of glycosyltransferases using
            Dol-P-monosaccharides as donor substrate
  JOURNAL   Mol. Biol. Evol. 19 (9), 1451-1463 (2002)
   PUBMED   12200473
REFERENCE   6  (bases 1 to 3371)
  AUTHORS   Westphal,V., Schottstadt,C., Marquardt,T. and Freeze,H.H.
  TITLE     Analysis of multiple mutations in the hALG6 gene in a patient with
            congenital disorder of glycosylation Ic
  JOURNAL   Mol. Genet. Metab. 70 (3), 219-223 (2000)
   PUBMED   10924277
REFERENCE   7  (bases 1 to 3371)
  AUTHORS   Imbach,T., Grunewald,S., Schenk,B., Burda,P., Schollen,E.,
            Wevers,R.A., Jaeken,J., de Klerk,J.B., Berger,E.G., Matthijs,G.,
            Aebi,M. and Hennet,T.
  TITLE     Multi-allelic origin of congenital disorder of glycosylation
            (CDG)-Ic
  JOURNAL   Hum. Genet. 106 (5), 538-545 (2000)
   PUBMED   10914684
REFERENCE   8  (bases 1 to 3371)
  AUTHORS   Imbach,T., Burda,P., Kuhnert,P., Wevers,R.A., Aebi,M., Berger,E.G.
            and Hennet,T.
  TITLE     A mutation in the human ortholog of the Saccharomyces cerevisiae
            ALG6 gene causes carbohydrate-deficient glycoprotein syndrome
            type-Ic
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 96 (12), 6982-6987 (1999)
   PUBMED   10359825
REFERENCE   9  (bases 1 to 3371)
  AUTHORS   Korner,C., Knauer,R., Holzbach,U., Hanefeld,F., Lehle,L. and von
            Figura,K.
  TITLE     Carbohydrate-deficient glycoprotein syndrome type V: deficiency of
            dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 95 (22), 13200-13205 (1998)
   PUBMED   9789065
REFERENCE   10 (bases 1 to 3371)
  AUTHORS   Burda,P., Borsig,L., de Rijk-van Andel,J., Wevers,R., Jaeken,J.,
            Carchon,H., Berger,E.G. and Aebi,M.
  TITLE     A novel carbohydrate-deficient glycoprotein syndrome characterized
            by a deficiency in glucosylation of the dolichol-linked
            oligosaccharide
  JOURNAL   J. Clin. Invest. 102 (4), 647-652 (1998)
   PUBMED   9710431
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BI819904.1, BC001253.1 and
            AL592218.8.
            This sequence is a reference standard in the RefSeqGene project.
            On Nov 29, 2008 this sequence version replaced gi:38026891.
            
            Summary: This gene encodes a member of the ALG6/ALG8
            glucosyltransferase family. The encoded protein catalyzes the
            addition of the first glucose residue to the growing lipid-linked
            oligosaccharide precursor of N-linked glycosylation. Mutations in
            this gene are associated with congenital disorders of glycosylation
            type Ic. [provided by RefSeq, Jul 2008].
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data because no single transcript was available
            for the full length of the gene. The extent of this transcript is
            supported by transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF063604.2, AK022700.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025084, ERS025085 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-68                BI819904.1         1-68
            69-1215             BC001253.1         1-1147
            1216-1216           AL592218.8         4447-4447
            1217-2010           BC001253.1         1149-1942
            2011-3371           AL592218.8         25768-27128
FEATURES             Location/Qualifiers
     source          1..3371
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1p31.3"
     gene            1..3371
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /note="ALG6, alpha-1,3-glucosyltransferase"
                     /db_xref="GeneID:29929"
                     /db_xref="HGNC:23157"
                     /db_xref="MIM:604566"
     exon            1..98
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /inference="alignment:Splign:1.39.8"
     exon            99..387
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    297..299
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /note="upstream in-frame stop codon"
     CDS             306..1829
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /EC_number="2.4.1.267"
                     /note="Man(9)GlcNAc(2)-PP-Dol
                     alpha-1,3-glucosyltransferase; asparagine-linked
                     glycosylation 6 homolog (S. cerevisiae,
                     alpha-1,3-glucosyltransferase); asparagine-linked
                     glycosylation 6 homolog (yeast,
                     alpha-1,3-glucosyltransferase);
                     dolichyl-P-Glc:Man9GlcNAc2-PP-dolichylglucosyltransferase;
                     dolichyl pyrophosphate Man9GlcNAc2
                     alpha-1,3-glucosyltransferase; asparagine-linked
                     glycosylation protein 6 homolog;
                     dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl
                     glucosyltransferase; dol-P-Glc:Man(9)GlcNAc(2)-PP-Dol
                     alpha-1,3-glucosyltransferase; asparagine-linked
                     glycosylation 6, alpha-1,3-glucosyltransferase homolog;
                     dolichyl-P-Glc:Man(9)GlcNAc(2)-PP-dolichol alpha-
                     1->3-glucosyltransferase"
                     /codon_start=1
                     /product="dolichyl pyrophosphate Man9GlcNAc2
                     alpha-1,3-glucosyltransferase precursor"
                     /protein_id="NP_037471.2"
                     /db_xref="GI:38026892"
                     /db_xref="CCDS:CCDS30735.1"
                     /db_xref="GeneID:29929"
                     /db_xref="HGNC:23157"
                     /db_xref="MIM:604566"
                     /translation="
MEKWYLMTVVVLIGLTVRWTVSLNSYSGAGKPPMFGDYEAQRHWQEITFNLPVKQWYFNSSDNNLQYWGLDYPPLTAYHSLLCAYVAKFINPDWIALHTSRGYESQAHKLFMRTTVLIADLLIYIPAVVLYCCCLKEISTKKKIANALCILLYPGLILIDYGHFQYNSVSLGFALWGVLGISCDCDLLGSLAFCLAINYKQMELYHALPFFCFLLGKCFKKGLKGKGFVLLVKLACIVVASFVLCWLPFFTEREQTLQVLRRLFPVDRGLFEDKVANIWCSFNVFLKIKDILPRHIQLIMSFCSTFLSLLPACIKLILQPSSKGFKFTLVSCALSFFLFSFQVHEKSILLVSLPVCLVLSEIPFMSTWFLLVSTFSMLPLLLKDELLMPSVVTTMAFFIACVTSFSIFEKTSEEELQLKSFSISVRKYLPCFTFLSRIIQYLFLISVITMVLLTLMTVTLDPPQKLPDLFSVLVCFVSCLNFLFFLVYFNIIIMWDSKSGRNQKKIS
"
     sig_peptide     306..371
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     misc_feature    315..377
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Y672.1);
                     transmembrane region"
     misc_feature    339..1778
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /note="ALG6, ALG8 glycosyltransferase family; Region:
                     Alg6_Alg8; pfam03155"
                     /db_xref="CDD:111992"
     misc_feature    648..710
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Y672.1);
                     transmembrane region"
     misc_feature    735..797
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Y672.1);
                     transmembrane region"
     misc_feature    822..884
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Y672.1);
                     transmembrane region"
     misc_feature    984..1046
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Y672.1);
                     transmembrane region"
     misc_feature    1197..1259
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Y672.1);
                     transmembrane region"
     misc_feature    1275..1337
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Y672.1);
                     transmembrane region"
     misc_feature    1389..1451
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Y672.1);
                     transmembrane region"
     misc_feature    1467..1529
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Y672.1);
                     transmembrane region"
     misc_feature    1617..1679
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Y672.1);
                     transmembrane region"
     misc_feature    1722..1784
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Y672.1);
                     transmembrane region"
     exon            388..472
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /inference="alignment:Splign:1.39.8"
     exon            473..562
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /inference="alignment:Splign:1.39.8"
     exon            563..651
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /inference="alignment:Splign:1.39.8"
     exon            652..734
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(696)
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35383149"
     exon            735..799
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /inference="alignment:Splign:1.39.8"
     exon            800..985
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /inference="alignment:Splign:1.39.8"
     exon            986..1121
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /inference="alignment:Splign:1.39.8"
     exon            1122..1207
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /inference="alignment:Splign:1.39.8"
     exon            1208..1292
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /inference="alignment:Splign:1.39.8"
     exon            1293..1363
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /inference="alignment:Splign:1.39.8"
     exon            1364..1432
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /inference="alignment:Splign:1.39.8"
     STS             1365..1574
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /standard_name="MARC_31587-31588:1062527482:1"
                     /db_xref="UniSTS:269200"
     exon            1433..1631
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /inference="alignment:Splign:1.39.8"
     exon            1632..3371
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /inference="alignment:Splign:1.39.8"
     STS             1636..2201
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /standard_name="ALG6_9608"
                     /db_xref="UniSTS:468276"
     STS             1686..1835
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /standard_name="SHGC-34347"
                     /db_xref="UniSTS:45640"
     STS             1692..1900
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
                     /standard_name="RH68218"
                     /db_xref="UniSTS:32936"
     polyA_signal    1988..1993
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
     polyA_site      2010
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
     polyA_signal    3326..3331
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
     polyA_site      3362
                     /gene="ALG6"
                     /gene_synonym="CDG1C"
ORIGIN      
cggaaggccggaggggcagtccgccgcgggggcgagcgcgcatgcgccttcctgggacccacggcaggcgcgaatcccagcggccggcgggcggcggggatacttctacatagacataatcaagttttgactatttggaaaccaagcatcattaaaattctctcaaactcctaattgcgaagaatcgataacatttcaagaagtgataacatttctctgaacaagaaaagaagtgattgaccacgttttaaaagtactctggcactggtgctgtgttttcttcccctccctaaatttgaagaactatggagaaatggtacttgatgacagtagtggttttaataggactaacagtacgatggacagtgtctcttaattcttattcaggtgctggtaaaccgcctatgtttggtgattatgaagctcagagacactggcaagaaataacttttaatttaccggtcaaacaatggtattttaacagcagtgataacaatttacagtattggggattggattacccacctcttacagcttatcatagtctcctatgtgcatatgtggcaaagtttataaatccagactggattgctctccatacatcacgtggatatgagagtcaggcacataagctcttcatgcgtacaacagttttaattgctgatctgctgatttacatacctgcagtggttttgtactgttgttgcttaaaagaaatctcaactaagaaaaagattgctaatgcattatgcatcttgctgtatccaggccttattcttatagactatggacattttcaatataattctgtgagtcttggctttgctttgtggggtgttcttggaatatcttgtgactgcgacctcctagggtcactggcattttgcttagctataaattataaacagatggaactttaccacgccttgccatttttttgctttttacttggcaagtgttttaaaaaaggcctcaaaggaaaggggtttgtgttgctagttaagctagcttgtattgttgtggcttccttcgttctctgctggctgccattctttacagaaagggaacaaaccctgcaggttctaagaagactcttcccggttgatcgtggattatttgaggataaagtagccaatatttggtgcagcttcaatgtctttctgaagattaaggatattttgccacgtcacatccaattaataatgagcttttgttctacgtttttgagcctgcttcctgcatgcataaaattaatacttcagccctcttccaaaggattcaaatttacactggttagctgtgcgctatcattctttttattttctttccaagtacatgaaaaatccattctcttggtgtcactaccagtctgcttagttttaagtgaaattccttttatgtctacttggtttttacttgtgtcaacatttagtatgctacctcttctattgaaggatgaactcctaatgccctctgttgtgacaacaatggcattttttatagcttgtgtaacttccttttcaatatttgaaaagacttctgaagaagaactgcagttgaaatccttttccatttctgtgaggaaatatcttccatgttttacatttctttccagaattatacaatatttgtttcttatctcagtcatcactatggtgcttctgacgttgatgactgtcacactggatcctcctcagaaactaccggacttgttttctgtattggtgtgttttgtatcttgcttgaacttcctgttcttcttggtatactttaacattattattatgtgggattccaaaagtggaagaaatcagaagaaaatcagctagctgtattcctaaacaaattgtttcctaaacaaatgtgaaaatgtgaacagtgctgaaaggttttgtgaactttttgctatgtataaatgaaattaccattttgagaaccatggaaccacaggaaaggaaatggtgaaaagtcattgttgtctacacaaaataaatgtatatggagaccaaagaccaatggaggcttgtctaagtactgcttggccaaaacatgtggttttattattcacagctattcaagtggggaaaaaagagaaacatgtccttaatcccattgtttactcaggaaatgcactttttaaatgtctttaaaaaactgagaaatatttcttgatatttgctttgtctaaacctacttccttcatcagaccatatagtgagcttcatgggagaattgagccccttctttttaatggaaatcactaattttggtattcaaacttacattttagaatgcaagtagtgtgtatttcactgtttagaagtcatatcttagggaattaaatttgtgataatctttttaattactgagaaggcaatttaaactgcttgaagtttgaatatgccttattacacatgcaaatttgattgttttaacaaggcaaataaaccataatcttatttatttccaagaatgcatattttaatacaattaaaaatgaattttcctgaatttaaatgtaagctttaacttaactttaagtggtttgagtgaagtcttctaaattacacataatcactggttctaaacttccagaaccattctgtttaattaaacattatattatatatatattattattgacatggttcagggttaccactgccagagcattgattcatgttaacttcatcctattaatactgtatcaccctgtattagcagaagccaatatttattatagtattcaactggtaaaaataatacatgatatccatgttgcagtttctcatataaagatatgttttctttagcctctgtaataaagataatcattttcccatcaacattttttaaggaatatatttcttctttcataagatagccattaaactatattaagtggtggtatattttaatatagtgcaaatcaaaccacatacaaaaaaaaactggttctagacacggacagtcacaggctgatataagaaggtatgtgtttctaagtctggtaaaggaagtgggtttagacaaagcaaaaatctagaaaggtttctttctcaaagcaaatgtgcataaagactcaaagggcaggtcaacgcagaatagcagccttgaatcactgccgaatcagcaagaacattgctgtccatggtcaccatctgtaatcactgtgcccaaatgtcagcatcttggctggctggtgtagctttatttttaaaaatattttttgtaatagtacacttgtgtttaacatagaatgttgacttagataaatgatgaggaagttataaataattggagtagcataactttattatttggaaataaaagtattatgtacatatattagtaaaatgaaatgcacctga
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:29929 -> Molecular function: GO:0046527 [glucosyltransferase activity] evidence: IDA
            GeneID:29929 -> Biological process: GO:0006487 [protein N-linked glycosylation] evidence: IDA
            GeneID:29929 -> Biological process: GO:0006487 [protein N-linked glycosylation] evidence: IGI
            GeneID:29929 -> Biological process: GO:0006488 [dolichol-linked oligosaccharide biosynthetic process] evidence: TAS
            GeneID:29929 -> Biological process: GO:0018279 [protein N-linked glycosylation via asparagine] evidence: TAS
            GeneID:29929 -> Biological process: GO:0043687 [post-translational protein modification] evidence: TAS
            GeneID:29929 -> Biological process: GO:0044267 [cellular protein metabolic process] evidence: TAS
            GeneID:29929 -> Cellular component: GO:0005575 [cellular_component] evidence: ND
            GeneID:29929 -> Cellular component: GO:0005789 [endoplasmic reticulum membrane] evidence: TAS
            GeneID:29929 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_037471 -> EC 2.4.1.267

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.