Home |
Help |
Advanced search
2024-04-20 19:44:49, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_012307 4446 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens erythrocyte membrane protein band 4.1-like 3
(EPB41L3), mRNA.
ACCESSION NM_012307
VERSION NM_012307.2 GI:32490571
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 4446)
AUTHORS Zhang,Y., Xu,R., Li,G., Xie,X., Long,J. and Wang,H.
TITLE Loss of expression of the differentially expressed in
adenocarcinoma of the lung (DAL-1) protein is associated with
metastasis of non-small cell lung carcinoma cells
JOURNAL Tumour Biol. 33 (6), 1915-1925 (2012)
PUBMED 22782504
REMARK GeneRIF: Loss of expression of the differentially expressed in
adenocarcinoma of the lung protein is associated with metastasis of
non-small cell lung carcinoma.
REFERENCE 2 (bases 1 to 4446)
AUTHORS Takahashi,Y., Iwai,M., Kawai,T., Arakawa,A., Ito,T.,
Sakurai-Yageta,M., Ito,A., Goto,A., Saito,M., Kasumi,F. and
Murakami,Y.
TITLE Aberrant expression of tumor suppressors CADM1 and 4.1B in invasive
lesions of primary breast cancer
JOURNAL Breast Cancer 19 (3), 242-252 (2012)
PUBMED 21526423
REMARK GeneRIF: aberrant CADM1 and 4.1B expression is involved in
progression of breast cancer, especially in invasion into the
stroma and metastasis
REFERENCE 3 (bases 1 to 4446)
AUTHORS Eijsink,J.J., Lendvai,A., Deregowski,V., Klip,H.G., Verpooten,G.,
Dehaspe,L., de Bock,G.H., Hollema,H., van Criekinge,W.,
Schuuring,E., van der Zee,A.G. and Wisman,G.B.
TITLE A four-gene methylation marker panel as triage test in high-risk
human papillomavirus positive patients
JOURNAL Int. J. Cancer 130 (8), 1861-1869 (2012)
PUBMED 21796628
REMARK GeneRIF: Data suggest that the four-gene methylation panel might
provide an alternative triage test after primary high-risk
papillomavirus (hr-HPV) testing.
REFERENCE 4 (bases 1 to 4446)
AUTHORS Li,X., Zhang,Y., Zhang,H., Liu,X., Gong,T., Li,M., Sun,L., Ji,G.,
Shi,Y., Han,Z., Han,S., Nie,Y., Chen,X., Zhao,Q., Ding,J., Wu,K.
and Daiming,F.
TITLE miRNA-223 promotes gastric cancer invasion and metastasis by
targeting tumor suppressor EPB41L3
JOURNAL Mol. Cancer Res. 9 (7), 824-833 (2011)
PUBMED 21628394
REMARK GeneRIF: miR-223, induced by the transcription factor Twist,
posttranscriptionally downregulates EPB41L3 expression by directly
targeting its 3'-untranslated regions.
REFERENCE 5 (bases 1 to 4446)
AUTHORS Busam,R.D., Thorsell,A.G., Flores,A., Hammarstrom,M., Persson,C.,
Obrink,B. and Hallberg,B.M.
TITLE Structural basis of tumor suppressor in lung cancer 1 (TSLC1)
binding to differentially expressed in adenocarcinoma of the lung
(DAL-1/4.1B)
JOURNAL J. Biol. Chem. 286 (6), 4511-4516 (2011)
PUBMED 21131357
REMARK GeneRIF: Structural basis of tumor suppressor in lung cancer 1
(TSLC1) binding to differentially expressed in adenocarcinoma of
the lung (DAL-1/4.1B).
REFERENCE 6 (bases 1 to 4446)
AUTHORS Gutmann,D.H., Donahoe,J., Perry,A., Lemke,N., Gorse,K.,
Kittiniyom,K., Rempel,S.A., Gutierrez,J.A. and Newsham,I.F.
TITLE Loss of DAL-1, a protein 4.1-related tumor suppressor, is an
important early event in the pathogenesis of meningiomas
JOURNAL Hum. Mol. Genet. 9 (10), 1495-1500 (2000)
PUBMED 10888600
REFERENCE 7 (bases 1 to 4446)
AUTHORS Tran,Y.K., Bogler,O., Gorse,K.M., Wieland,I., Green,M.R. and
Newsham,I.F.
TITLE A novel member of the NF2/ERM/4.1 superfamily with growth
suppressing properties in lung cancer
JOURNAL Cancer Res. 59 (1), 35-43 (1999)
PUBMED 9892180
REFERENCE 8 (bases 1 to 4446)
AUTHORS Peters,L.L., Weier,H.U., Walensky,L.D., Snyder,S.H., Parra,M.,
Mohandas,N. and Conboy,J.G.
TITLE Four paralogous protein 4.1 genes map to distinct chromosomes in
mouse and human
JOURNAL Genomics 54 (2), 348-350 (1998)
PUBMED 9828140
REFERENCE 9 (bases 1 to 4446)
AUTHORS Adams,M.D., Kerlavage,A.R., Fleischmann,R.D., Fuldner,R.A.,
Bult,C.J., Lee,N.H., Kirkness,E.F., Weinstock,K.G., Gocayne,J.D.,
White,O. et al.
TITLE Initial assessment of human gene diversity and expression patterns
based upon 83 million nucleotides of cDNA sequence
JOURNAL Nature 377 (6547 SUPPL), 3-174 (1995)
PUBMED 7566098
REFERENCE 10 (bases 1 to 4446)
AUTHORS Adams,M.D., Soares,M.B., Kerlavage,A.R., Fields,C. and Venter,J.C.
TITLE Rapid cDNA sequencing (expressed sequence tags) from a
directionally cloned human infant brain cDNA library
JOURNAL Nat. Genet. 4 (4), 373-380 (1993)
PUBMED 8401585
COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final
NCBI review. The reference sequence was derived from AB023204.1.
On Jul 10, 2003 this sequence version replaced gi:6912469.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AB023204.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025084, ERS025088 [ECO:0000348]
##Evidence-Data-END##
FEATURES Location/Qualifiers
source 1..4446
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="18"
/map="18p11.32"
gene 1..4446
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/note="erythrocyte membrane protein band 4.1-like 3"
/db_xref="GeneID:23136"
/db_xref="HGNC:3380"
/db_xref="HPRD:05622"
/db_xref="MIM:605331"
exon 1..75
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/inference="alignment:Splign:1.39.8"
exon 76..269
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/inference="alignment:Splign:1.39.8"
CDS 87..3350
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/note="differentially expressed in adenocarcinoma of the
lung protein 1"
/codon_start=1
/product="band 4.1-like protein 3"
/protein_id="NP_036439.2"
/db_xref="GI:32490572"
/db_xref="CCDS:CCDS11838.1"
/db_xref="GeneID:23136"
/db_xref="HGNC:3380"
/db_xref="HPRD:05622"
/db_xref="MIM:605331"
/translation="
MTTESGSDSESKPDQEAEPQEAAGAQGRAGAPVPEPPKEEQQQALEQFAAAAAHSTPVRREVTDKEQEFAARAAKQLEYQQLEDDKLSQKSSSSKLSRSPLKIVKKPKSMQCKVILLDGSEYTCDVEKRSRGQVLFDKVCEHLNLLEKDYFGLTYRDAENQKNWLDPAKEIKKQVRSGAWHFSFNVKFYPPDPAQLSEDITRYYLCLQLRDDIVSGRLPCSFVTLALLGSYTVQSELGDYDPDECGSDYISEFRFAPNHTKELEDKVIELHKSHRGMTPAEAEMHFLENAKKLSMYGVDLHHAKDSEGVEIMLGVCASGLLIYRDRLRINRFAWPKVLKISYKRNNFYIKIRPGEFEQFESTIGFKLPNHRAAKRLWKVCVEHHTFFRLLLPEAPPKKFLTLGSKFRYSGRTQAQTRRASALIDRPAPYFERSSSKRYTMSRSLDGEVGTGQYATTKGISQTNLITTVTPEKKAEEERDEEEDKRRKGEEVTPISAIRHEGKSPGLGTDSCPLSPPSTHCAPTSPTELRRRCKENDCKLPGYEPSRAEHLPGEPALDSDGPGRPYLGDQDVAFSYRQQTGKGTTLFSFSLQLPESFPSLLDDDGYLSFPNLSETNLLPQSLQHYLPIRSPSLVPCFLFIFFFLLSASFSVPYALTLSFPLALCLCYLEPKAASLSASLDNDPSDSSEEETDSERTDTAADGETTATESDQEEDAELKAQELEKTQDDLMKHQTNISELKRTFLETSTDTAVTNEWEKRLSTSPVRLAARQEDAPMIEPLVPEETKQSSGEKLMDGSEIFSLLESARKPTEFIGGVTSTSQSWVQKMETKTESSGIETEPTVHHLPLSTEKVVQETVLVEERRVVHASGDASYSAGDSGDAAAQPAFTGIKGKEGSALTEGAKEEGGEEVAKAVLEQEETAAASRERQEEQSAAIHISETLEQKPHFESSTVKTETISFGSVSPGGVKLEISTKEVPVVHTETKTITYESSQVDPGTDLEPGVLMSAQTITSETTSTTTTTHITKTVKGGISETRIEKRIVITGDADIDHDQALAQAIKEAKEQHPDMSVTKVVVHKETEITPEDGED
"
misc_feature 348..350
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9Y2J2.2); phosphorylation site"
misc_feature 420..989
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/note="Band 4.1 homologues; Region: B41; smart00295"
/db_xref="CDD:197635"
misc_feature 426..656
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/note="FERM N-terminal domain; Region: FERM_N; pfam09379"
/db_xref="CDD:204220"
misc_feature 672..989
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/note="FERM central domain; Region: FERM_M; pfam00373"
/db_xref="CDD:201187"
misc_feature 969..1250
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/note="FERM_C domain; Region: FERM_C; cd00836"
/db_xref="CDD:176273"
misc_feature order(981..1004,1011..1034,1038..1058,1086..1091,
1098..1109,1122..1142,1170..1184,1209..1235)
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/note="PH/PTB-like core; other site"
/db_xref="CDD:176273"
misc_feature order(1095..1097,1101..1106,1110..1118,1140..1142,
1215..1217,1227..1229,1236..1238,1248..1250)
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/note="peptide binding site [polypeptide binding]; other
site"
/db_xref="CDD:176273"
misc_feature 1206..1208
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/note="lipid binding site [chemical binding];
lipid-binding site"
/db_xref="CDD:176273"
misc_feature 1266..1625
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q9Y2J2.2);
Region: Hydrophilic"
misc_feature 1275..1415
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/note="FERM adjacent (FA); Region: FA; pfam08736"
/db_xref="CDD:192138"
misc_feature 1311..1313
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1464..1466
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9Y2J2.2); phosphorylation site"
misc_feature 1464..1466
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1491..1493
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine; propagated from
UniProtKB/Swiss-Prot (Q9Y2J2.2); phosphorylation site"
misc_feature 1491..1493
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1626..2666
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q9Y2J2.2);
Region: Spectrin--actin-binding (Potential)"
misc_feature 2208..2210
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 2235..2381
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/note="SAB domain; Region: SAB; pfam04382"
/db_xref="CDD:113163"
misc_feature 2667..3335
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q9Y2J2.2);
Region: C-terminal (CTD)"
misc_feature 2970..2972
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9Y2J2.2); phosphorylation site"
misc_feature 2970..2972
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 2985..3326
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/note="4.1 protein C-terminal domain (CTD); Region:
4_1_CTD; pfam05902"
/db_xref="CDD:147837"
variation 179
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:11548490"
exon 270..467
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/inference="alignment:Splign:1.39.8"
exon 468..572
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/inference="alignment:Splign:1.39.8"
exon 573..615
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/inference="alignment:Splign:1.39.8"
exon 616..691
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/inference="alignment:Splign:1.39.8"
exon 692..910
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/inference="alignment:Splign:1.39.8"
exon 911..998
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/inference="alignment:Splign:1.39.8"
exon 999..1151
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/inference="alignment:Splign:1.39.8"
exon 1152..1249
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/inference="alignment:Splign:1.39.8"
exon 1250..1425
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/inference="alignment:Splign:1.39.8"
exon 1426..1592
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/inference="alignment:Splign:1.39.8"
exon 1593..2153
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/inference="alignment:Splign:1.39.8"
exon 2154..2207
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/inference="alignment:Splign:1.39.8"
variation 2198
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/replace="c"
/replace="t"
/db_xref="dbSNP:3817466"
exon 2208..2243
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/inference="alignment:Splign:1.39.8"
exon 2244..2435
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/inference="alignment:Splign:1.39.8"
exon 2436..2558
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/inference="alignment:Splign:1.39.8"
exon 2559..2927
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/inference="alignment:Splign:1.39.8"
exon 2928..3059
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/inference="alignment:Splign:1.39.8"
exon 3060..3158
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/inference="alignment:Splign:1.39.8"
exon 3159..3239
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/inference="alignment:Splign:1.39.8"
variation 3233
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1802388"
exon 3240..3356
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/inference="alignment:Splign:1.39.8"
exon 3357..4446
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/inference="alignment:Splign:1.39.8"
variation 3644
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1140830"
STS 4276..4394
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/standard_name="D18S920E"
/db_xref="UniSTS:150520"
STS 4278..4427
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/standard_name="D18S1246"
/db_xref="UniSTS:21551"
STS 4278..4425
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/standard_name="EPB41L3"
/db_xref="UniSTS:504224"
STS 4278..4403
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/standard_name="RH98322"
/db_xref="UniSTS:90717"
variation 4311
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1140836"
variation 4366
/gene="EPB41L3"
/gene_synonym="4.1B; DAL-1; DAL1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1140837"
ORIGIN
cgcaccgccgccgaggacgcgcgcccgagcctagtccccacgccgcggcgcgcccgggctccctgctgatcccagaacaatcaaccatgacgaccgaatctggatcagactcggaatccaagccggaccaggaggccgagccccaggaggcggcgggggcgcaggggcgcgcgggggcgcccgtgccggagccgcccaaggaggagcagcagcaggccctggagcagttcgccgccgctgcagcgcacagcaccccggtgcggagggaggtcactgacaaggaacaggagtttgctgccagggctgcaaaacagctcgaatatcagcaattagaagacgataaactttctcagaaatcatctagcagtaaactctctcggtctccattaaagattgtcaaaaagcctaaaagcatgcagtgcaaagtgatacttctcgatggatcagaatatacctgtgatgtagagaaacgctccagaggacaagtgctgtttgataaagtgtgtgaacacttgaacttgctagagaaagactactttgggcttacgtatcgagatgctgaaaaccagaagaattggttggaccctgctaaggaaataaaaaaacaggttcgaagtggtgcttggcacttttcatttaatgtgaaattttatccaccagaccctgcccaactatctgaagatatcaccaggtactacctctgcttgcagttgcgagatgacatcgtgtccggaaggctgccctgctcctttgttaccctggccttgctgggctcctacactgtccagtcagagctcggagactatgacccagatgaatgtgggagcgattacattagtgagttccgctttgcaccaaaccacactaaagaactggaagacaaagtgatcgagctgcacaagagccacagaggaatgacgccagcagaagcagagatgcatttcttggaaaatgccaaaaaattatcaatgtatggggtagatttacatcatgctaaggactcagaaggggtagaaattatgttaggagtttgtgcaagtggtctgttgatatatcgcgaccggctgcgaataaacagatttgcctggcccaaggttctaaagatttcatacaaacggaacaacttttacattaagatccggccgggagagtttgaacaatttgaaagcaccattgggtttaagctgccaaaccatcgagctgccaagcgtttatggaaagtatgtgttgagcatcatacatttttcagactactgttaccagaagcacctcccaagaaattcctaaccttgggttccaagtttcgttatagtggcaggacacaagcgcaaacgagaagagccagtgcgttgatagatcgcccagcaccttactttgaacgctcatccagcaaacgttataccatgtctcgcagcttggatggagaggttggtactggccagtacgccacaacaaaaggcatctctcagaccaacttgatcaccactgtgactccggagaagaaggctgaggaggagcgggacgaggaagaggacaaacggaggaagggggaagaagtcacgcccatctcggccatccggcacgagggaaagtcacctgggcttggcactgactcatgtcccttgtcacccccatccacccattgtgcccccacatctcccacagagctccgtaggaggtgtaaggagaatgactgcaaactgccaggttatgagccgtccagagctgagcacctgcctggagagcccgccttggactctgatggcccagggaggccttacctaggggatcaagatgtggcttttagctacagacagcaaactggcaaggggaccaccctgttctccttctccttgcagctccctgagtcattcccctccctcctagatgatgatggatacctctctttccccaacctttctgaaaccaacctcctgccccagagcttgcagcattacctcccgatccgctcaccgtcccttgtgccctgtttcctcttcatctttttctttctgctgtctgcctccttctcagtgccatacgctctcactctctccttccctctggctctgtgcctctgctacctggagcccaaggcggcctccttgagcgcctccctagacaatgacccgagtgacagttcagaggaagagactgacagtgagcgcacggacaccgcagccgacggggagaccaccgccactgagtcggaccaggaggaagatgcagagctcaaggcacaggagctagaaaaaactcaagatgacctgatgaaacatcaaaccaacattagcgagctgaaaagaaccttcttagaaacctcaacagacactgccgtaacgaatgaatgggagaagaggctttccacctcccccgtgcgactggccgccaggcaggaggatgcccccatgatcgaaccacttgtccctgaagagactaagcagtcttctggggaaaagctcatggatggctctgaaatcttcagtttattagagtctgcgcgaaaaccaacagaattcataggaggggttacttctacttctcaaagctgggttcagaaaatggaaaccaagacggagtccagtggaatagagacggaacccaccgtgcaccacctgccgcttagcactgagaaggtggtgcaggagaccgtgttggtggaggagcggcgtgtggtgcacgcgagtggggatgcttcttactcggcgggagacagcggggatgctgcagcacagcccgcattcacaggcattaaagggaaagagggctctgccttgacggagggggctaaagaggaaggaggggaggaggtcgctaaagctgtcctggaacaggaagagacagccgctgcttcccgtgagcgacaagaggagcagagtgcagccatccacatttcagaaactttggaacaaaaacctcattttgagtcctcaacggtgaagacggaaaccatcagttttggcagtgtttcaccgggaggagtaaagctagaaatttccacgaaggaagtgccagtagttcacaccgaaaccaaaaccatcacatatgaatcatcacaggtcgatccaggcacagatctggagccaggcgtgctgatgagtgcacagacgatcacatctgaaaccaccagtaccaccaccactacgcacatcaccaaaactgtgaaagggggcatttcagagacaagaattgagaagcgaatagtcatcacgggggatgcagacattgaccatgaccaggcgctggctcaggcaattaaagaggccaaagagcagcaccctgacatgtcagtgaccaaagtagtggtccataaagagacagagatcacaccagaagatggagaggattgaccagaggaataacttagcttgcacatgaatgcagtcatgcaaaccgttaggaaaaccagagcctatatggagttccctcttctaacccaactgacttgtatctgtccgtggaaaatttcagtccagaagaattgaccttgaccattaataaagacactggcagagagatcttcccataataaagcaatctgattcagcatcactaaaccgataatgcatgaagcaacgataaaattacaaaagagcagcatttttaattttcacaaaatgtctcagttttcagctatacctgcacgttcataaccaacaatataaaccgtggtctcatgtaacacataaacaattcatgcctttcatagtttattattattaaagtctaaacaaaattgcaatttcttaggtaaccttatatttacaataaatgaagattaccctcaaatgctagaagctgtctaggtccgtccggtgtgtcagattttcctcagattagatgtgccaataaccaagtttattcagtaaacaacttgtacttgtttcatctggttttattactctcacccataaacagtaatgactctctgaccctctggaaatatgtaatgcttccaatcttgctttgtgtatctcatttaatttgttataaggtagtactgattttagcatattaatgcgatttcttccttgttgtttgctttggtctgtgttcaatccagagagcttaaattgtcattattttgggaagaaaacctgtatttttgttagtttacaatattatgaaatttcacttcaggagaaactgctgggcttcctgtggctttgttttcttagttactttttccgtgccgtgtattttttaattgatttttcttcttttacttgaaaagaaagtgttttattttcaaatctggtccatatttacattctagttcagagccaagccttaaactgtacagaatttccactgtaattaaaactatttagtgttagttataaatagccttcaaaaagagagattctccattacacgatcacctgcatcacagcccatggtgaatgtatgtttctgcatagcgaaataaaaatggcaaatgcactg
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:23136 -> Molecular function: GO:0003779 [actin binding] evidence: IEA
GeneID:23136 -> Molecular function: GO:0005200 [structural constituent of cytoskeleton] evidence: TAS
GeneID:23136 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:23136 -> Biological process: GO:0002175 [protein localization to paranode region of axon] evidence: ISS
GeneID:23136 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA
GeneID:23136 -> Biological process: GO:0007016 [cytoskeletal anchoring at plasma membrane] evidence: TAS
GeneID:23136 -> Biological process: GO:0008150 [biological_process] evidence: ND
GeneID:23136 -> Biological process: GO:0008360 [regulation of cell shape] evidence: ISS
GeneID:23136 -> Biological process: GO:0030865 [cortical cytoskeleton organization] evidence: TAS
GeneID:23136 -> Biological process: GO:0030866 [cortical actin cytoskeleton organization] evidence: IEA
GeneID:23136 -> Biological process: GO:0030913 [paranodal junction assembly] evidence: ISS
GeneID:23136 -> Biological process: GO:0043217 [myelin maintenance] evidence: ISS
GeneID:23136 -> Biological process: GO:0048812 [neuron projection morphogenesis] evidence: ISS
GeneID:23136 -> Biological process: GO:0071205 [protein localization to juxtaparanode region of axon] evidence: ISS
GeneID:23136 -> Biological process: GO:0072659 [protein localization to plasma membrane] evidence: ISS
GeneID:23136 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
GeneID:23136 -> Cellular component: GO:0005856 [cytoskeleton] evidence: IEA
GeneID:23136 -> Cellular component: GO:0005886 [plasma membrane] evidence: NAS
GeneID:23136 -> Cellular component: GO:0005911 [cell-cell junction] evidence: IDA
GeneID:23136 -> Cellular component: GO:0019898 [extrinsic to membrane] evidence: IEA
GeneID:23136 -> Cellular component: GO:0030673 [axolemma] evidence: ISS
GeneID:23136 -> Cellular component: GO:0033270 [paranode region of axon] evidence: ISS
GeneID:23136 -> Cellular component: GO:0044224 [juxtaparanode region of axon] evidence: ISS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.