2024-04-25 11:24:09, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_012148 594 bp mRNA linear PRI 07-JAN-2013 DEFINITION Homo sapiens double homeobox 3 (DUX3), mRNA. ACCESSION NM_012148 VERSION NM_012148.2 GI:63985944 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 594) AUTHORS Beckers,M., Gabriels,J., van der Maarel,S., De Vriese,A., Frants,R.R., Collen,D. and Belayew,A. TITLE Active genes in junk DNA? Characterization of DUX genes embedded within 3.3 kb repeated elements JOURNAL Gene 264 (1), 51-57 (2001) PUBMED 11245978 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AF133130.1. On May 13, 2005 this sequence version replaced gi:6912343. Summary: The human genome contains hundreds of repeats of the 3.3-kb family in regions associated with heterochromatin. The DUX gene family, including DUX3, resides within these 3.3-kb repeated elements (Beckers et al., 2001 [PubMed 11245978]). See DUX4 (MIM 606009).[supplied by OMIM, Mar 2008]. Sequence Note: The 5'-most translation start codon is selected for this RefSeq. The use of an alternative downstream start codon would result in a protein that is 27 aa shorter at the N-terminus. In vitro translation studies in PMID:11245978 indicate that both the longer and shorter proteins can be produced from this transcript. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-594 AF133130.1 266-859 FEATURES Location/Qualifiers source 1..594 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" gene 1..594 /gene="DUX3" /note="double homeobox 3" /db_xref="GeneID:26582" /db_xref="HGNC:3081" /db_xref="MIM:611443" CDS 1..594 /gene="DUX3" /note="double homeobox, 3" /codon_start=1 /product="putative double homeobox protein 3" /protein_id="NP_036280.2" /db_xref="GI:207442678" /db_xref="GeneID:26582" /db_xref="HGNC:3081" /db_xref="MIM:611443" /translation="
MPAEVHGSPPASLCPCPSVKFRPGLPAMALLTALDDTLPEEAQGPGRRMILLSTPSQSDALRACFERNLYPGIATKEQLAQGIDIPEPRVQIWFQNERSCQLRQHRRQSRPWPGRRDPQKGRRKRTAITGSQTALLLRAFEKDRFPGIPAREELARETGLPESRIQLWFQNRRARHWGQSGRAPTQASIRCNAAPIG
" misc_feature 160..315 /gene="DUX3" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:28970" misc_feature order(208..210,226..228,265..267,271..276,283..288, 292..300,304..309) /gene="DUX3" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:28970" misc_feature order(274..276,283..288,295..297) /gene="DUX3" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:28970" misc_feature 364..540 /gene="DUX3" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:28970" misc_feature order(364..378,382..384,433..435,451..453,490..492, 496..501,508..513,517..525,529..534) /gene="DUX3" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:28970" misc_feature order(370..372,379..381,499..501,508..513,520..522) /gene="DUX3" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:28970" exon 1..594 /gene="DUX3" /inference="alignment:Splign:1.39.8" variation complement(80) /gene="DUX3" /replace="a" /replace="c" /db_xref="dbSNP:74198112" variation complement(174) /gene="DUX3" /replace="c" /replace="t" /db_xref="dbSNP:74220307" variation 400 /gene="DUX3" /replace="a" /replace="g" /db_xref="dbSNP:36183646" ORIGIN
atgccggctgaggtgcacgggagcccgcccgcctctctctgcccgtgtccgtccgtgaaattccggccggggctccctgcgatggccctcctgacagctttggacgacaccctccccgaggaagcccagggaccgggaaggcgaatgatactcctttcgaccccgagtcaaagcgatgccctgcgagcctgctttgagcggaacctgtacccgggcattgccaccaaagaacagctggcccagggcatcgacattccggagcccagggtccagatttggtttcagaatgagagatcatgccagttgaggcagcaccggcggcaatctcggccctggcccgggagacgcgacccgcaaaaaggcagacgaaagcggactgccatcaccggatcccaaaccgccctgctcctccgagcctttgagaaggatcgctttccaggcattcctgccagggaagagctggccagagagacgggcctcccggagtccaggattcagctctggtttcagaatcgaagagccaggcactggggacagtctggcagggcgcccacgcaggcaagcatccggtgcaatgcagccccaattgggtga
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:26582 -> Molecular function: GO:0000976 [transcription regulatory region sequence-specific DNA binding] evidence: IEA GeneID:26582 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA GeneID:26582 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.