2024-04-25 15:41:45, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_012146 1227 bp mRNA linear PRI 18-APR-2013 DEFINITION Homo sapiens double homeobox 1 (DUX1), mRNA. ACCESSION NM_012146 VERSION NM_012146.1 GI:11120735 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1227) AUTHORS Ostlund,C., Garcia-Carrasquillo,R.M., Belayew,A. and Worman,H.J. TITLE Intracellular trafficking and dynamics of double homeodomain proteins JOURNAL Biochemistry 44 (7), 2378-2384 (2005) PUBMED 15709750 REMARK GeneRIF: Report shows that full-length DUX1 is actively transported into the nuclei of transfected C2C12 myoblasts, and that DUX1 homeodomains contain the signals required for this localization. REFERENCE 2 (bases 1 to 1227) AUTHORS Beckers,M., Gabriels,J., van der Maarel,S., De Vriese,A., Frants,R.R., Collen,D. and Belayew,A. TITLE Active genes in junk DNA? Characterization of DUX genes embedded within 3.3 kb repeated elements JOURNAL Gene 264 (1), 51-57 (2001) PUBMED 11245978 REFERENCE 3 (bases 1 to 1227) AUTHORS Ding,H., Beckers,M.C., Plaisance,S., Marynen,P., Collen,D. and Belayew,A. TITLE Characterization of a double homeodomain protein (DUX1) encoded by a cDNA homologous to 3.3 kb dispersed repeated elements JOURNAL Hum. Mol. Genet. 7 (11), 1681-1694 (1998) PUBMED 9736770 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AJ001481.1. Summary: The human genome contains hundreds of repeats of the 3.3-kb family in regions associated with heterochromatin. The DUX gene family, including DUX1, resides within these 3.3-kb repeated elements (Beckers et al., 2001 [PubMed 11245978]). See DUX4 (MIM 606009).[supplied by OMIM, Mar 2008]. ##Evidence-Data-START## Transcript exon combination :: AJ001481.1 [ECO:0000332] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..1227 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="10" /map="10" gene 1..1227 /gene="DUX1" /note="double homeobox 1" /db_xref="GeneID:26584" /db_xref="HGNC:3079" /db_xref="HPRD:10609" /db_xref="MIM:611441" CDS 113..625 /gene="DUX1" /function="transcription factor" /note="double homeobox, 1" /codon_start=1 /product="double homeobox protein 1" /protein_id="NP_036278.1" /db_xref="GI:11120736" /db_xref="GeneID:26584" /db_xref="HGNC:3079" /db_xref="HPRD:10609" /db_xref="MIM:611441" /translation="
MALLTALDDTLPEEAQGPGRRMILLSTPSQSDALRACFERNLYPGIATKEELAQGIDIPEPRVQIWFQNERSCQLRQHRRQSRPWPGRRDPQKGRRKRTAITGSQTALLLRAFEKDRFPGIAAREELARETGLPESRIQIWFQNRRARHRGQSGRAPTQASIRCNAAPIG
" misc_feature 191..346 /gene="DUX1" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:28970" misc_feature order(239..241,257..259,296..298,302..307,314..319, 323..331,335..340) /gene="DUX1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:28970" misc_feature order(305..307,314..319,326..328) /gene="DUX1" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:28970" misc_feature 395..571 /gene="DUX1" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:28970" misc_feature order(395..409,413..415,464..466,482..484,521..523, 527..532,539..544,548..556,560..565) /gene="DUX1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:28970" misc_feature order(401..403,410..412,530..532,539..544,551..553) /gene="DUX1" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:28970" misc_feature 167..346 /gene="DUX1" /note="homeobox" variation complement(212) /gene="DUX1" /replace="a" /replace="g" /db_xref="dbSNP:36134074" misc_feature 392..571 /gene="DUX1" /note="homeobox" ORIGIN
caggcctcctggcagcacctgcgcagtgaacaggctggctgaggtgcacgggagcccgcccgcctctctctgcccgtgtcagtccgtgaaattccggccggggctccctgagatggccctcctgacagctttggacgacaccctccccgaggaagcccagggaccgggaaggcgaatgatactcctttcgaccccgagtcaaagtgatgccctgcgagcctgctttgagcggaacctgtacccgggcattgccaccaaagaagagctggcccagggcatcgacattccggagcccagggtccagatttggtttcagaatgagagatcatgccagttgaggcagcaccggcggcaatctcggccctggcccgggagacgtgacccgcaaaaaggcagacgaaagcggactgccatcaccggatcccaaaccgccctgctcctccgagcctttgagaaggatcgctttccaggcattgctgccagggaagagctggccagagagacgggcctcccggagtccaggattcagatctggtttcagaatcgaagagccaggcaccggggacagtctggcagggcgcccacgcaggcaagcatccggtgcaatgcagccccaattgggtgacaccctgctctctcgtgggtcgcctttgcccacactggcgcatggggaaaggggcttcctgcaccacacatgctctcccacagtgggctttcgtgagccatggattgagggccgtccctgtgctcctgcccagccaggccgcgcaggcagaagggatctcccaacctgccccagcacatggggattttgcctacaccgcccaggctcctccagaaggggcgctctcccacactcacactcctaggtggcatccacacaagggcaaaatccggaaggactgggacgcgcagcgcgacggccttccgggcacttgcgcggtgggacagcctgggccctctcaagcggggccacagggccaaggtgtgcttgcgccacccgcgtcccagggaagtccgtggtgggggtggagcaggggtacccaggtcgccggtgtggcgtggaacctcaagcaggggcaattccacctcaccagcccacgcccccagaggcctccacacggcaggggcagatgcaaggcatctcagcaccctcccaggcgctcctggagccagggtgctcgtctgcactccactccatcctgctgctggatgagctcctggcga
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:26584 -> Molecular function: GO:0000976 [transcription regulatory region sequence-specific DNA binding] evidence: IEA GeneID:26584 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA GeneID:26584 -> Biological process: GO:0006366 [transcription from RNA polymerase II promoter] evidence: TAS GeneID:26584 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.