GGRNA Home | Help | Advanced search

2020-10-26 19:49:25, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_012090              17701 bp    mRNA    linear   PRI 17-JUN-2013
DEFINITION  Homo sapiens microtubule-actin crosslinking factor 1 (MACF1), mRNA.
ACCESSION   NM_012090 NM_033024
VERSION     NM_012090.5  GI:499591025
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 17701)
  AUTHORS   Margaron,Y., Fradet,N. and Cote,J.F.
  TITLE     ELMO recruits actin cross-linking family 7 (ACF7) at the cell
            membrane for microtubule capture and stabilization of cellular
            protrusions
  JOURNAL   J. Biol. Chem. 288 (2), 1184-1199 (2013)
   PUBMED   23184944
  REMARK    GeneRIF: uncovered a role for ELMO in the recruitment of ACF7 to
            the membrane to promote microtubule capture and stability
REFERENCE   2  (bases 1 to 17701)
  AUTHORS   Wu,X., Shen,Q.T., Oristian,D.S., Lu,C.P., Zheng,Q., Wang,H.W. and
            Fuchs,E.
  TITLE     Skin stem cells orchestrate directional migration by regulating
            microtubule-ACF7 connections through GSK3beta
  JOURNAL   Cell 144 (3), 341-352 (2011)
   PUBMED   21295697
REFERENCE   3  (bases 1 to 17701)
  AUTHORS   Lin,C.M., Chen,H.J., Leung,C.L., Parry,D.A. and Liem,R.K.
  TITLE     Microtubule actin crosslinking factor 1b: a novel plakin that
            localizes to the Golgi complex
  JOURNAL   J. Cell. Sci. 118 (PT 16), 3727-3738 (2005)
   PUBMED   16076900
  REMARK    GeneRIF: In two lung cell lines, MACF1b was chiefly localized to
            the Golgi complex. The domain of MACF1b that targets it to the
            Golgi was found at the N-terminal part of the region that contains
            the plakin repeats.
REFERENCE   4  (bases 1 to 17701)
  AUTHORS   Gong,T.W., Besirli,C.G. and Lomax,M.I.
  TITLE     MACF1 gene structure: a hybrid of plectin and dystrophin
  JOURNAL   Mamm. Genome 12 (11), 852-861 (2001)
   PUBMED   11845288
REFERENCE   5  (bases 1 to 17701)
  AUTHORS   Sun,D., Leung,C.L. and Liem,R.K.
  TITLE     Characterization of the microtubule binding domain of microtubule
            actin crosslinking factor (MACF): identification of a novel group
            of microtubule associated proteins
  JOURNAL   J. Cell. Sci. 114 (PT 1), 161-172 (2001)
   PUBMED   11112700
REFERENCE   6  (bases 1 to 17701)
  AUTHORS   Karakesisoglou,I., Yang,Y. and Fuchs,E.
  TITLE     An epidermal plakin that integrates actin and microtubule networks
            at cellular junctions
  JOURNAL   J. Cell Biol. 149 (1), 195-208 (2000)
   PUBMED   10747097
REFERENCE   7  (bases 1 to 17701)
  AUTHORS   Leung,C.L., Sun,D., Zheng,M., Knowles,D.R. and Liem,R.K.
  TITLE     Microtubule actin cross-linking factor (MACF): a hybrid of dystonin
            and dystrophin that can interact with the actin and microtubule
            cytoskeletons
  JOURNAL   J. Cell Biol. 147 (6), 1275-1286 (1999)
   PUBMED   10601340
REFERENCE   8  (bases 1 to 17701)
  AUTHORS   Sun,Y., Zhang,J., Kraeft,S.K., Auclair,D., Chang,M.S., Liu,Y.,
            Sutherland,R., Salgia,R., Griffin,J.D., Ferland,L.H. and Chen,L.B.
  TITLE     Molecular cloning and characterization of human trabeculin-alpha, a
            giant protein defining a new family of actin-binding proteins
  JOURNAL   J. Biol. Chem. 274 (47), 33522-33530 (1999)
   PUBMED   10559237
REFERENCE   9  (bases 1 to 17701)
  AUTHORS   Okuda,T., Matsuda,S., Nakatsugawa,S., Ichigotani,Y., Iwahashi,N.,
            Takahashi,M., Ishigaki,T. and Hamaguchi,M.
  TITLE     Molecular cloning of macrophin, a human homologue of Drosophila
            kakapo with a close structural similarity to plectin and dystrophin
  JOURNAL   Biochem. Biophys. Res. Commun. 264 (2), 568-574 (1999)
   PUBMED   10529403
REFERENCE   10 (bases 1 to 17701)
  AUTHORS   Byers,T.J., Beggs,A.H., McNally,E.M. and Kunkel,L.M.
  TITLE     Novel actin crosslinker superfamily member identified by a two step
            degenerate PCR procedure
  JOURNAL   FEBS Lett. 368 (3), 500-504 (1995)
   PUBMED   7635207
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DA512687.1, AB029290.1,
            AL442071.30, AK127519.1, AB007934.3, AF317696.1 and DR423112.1.
            On May 16, 2013 this sequence version replaced gi:325120977.
            
            Summary: This gene encodes a large protein containing numerous
            spectrin and leucine-rich repeat (LRR) domains. The encoded protein
            is a member of a family of proteins that form bridges between
            different cytoskeletal elements. This protein facilitates
            actin-microtubule interactions at the cell periphery and couples
            the microtubule network to cellular junctions. Alternative splicing
            results in multiple transcript variants, but the full-length nature
            of some of these variants has not been determined. [provided by
            RefSeq, May 2013].
            
            Sequence Note: This RefSeq encodes the Macf1a isoform of this gene
            (PMID: 16076900).
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB029290.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025082, ERS025084 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-272               DA512687.1         183-454
            273-822             AB029290.1         272-821
            823-823             AL442071.30        57159-57159
            824-1485            AB029290.1         823-1484
            1486-1889           AK127519.1         2147-2550
            1890-4510           AB029290.1         1889-4509
            4511-7079           AB007934.3         1859-4427
            7080-14060          AF317696.1         8654-15634
            14061-17519         AB029290.1         14060-17518
            17520-17701         DR423112.1         147-328
FEATURES             Location/Qualifiers
     source          1..17701
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1p32-p31"
     gene            1..17701
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="microtubule-actin crosslinking factor 1"
                     /db_xref="GeneID:23499"
                     /db_xref="HGNC:13664"
                     /db_xref="HPRD:09750"
                     /db_xref="MIM:608271"
     exon            1..272
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       18
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370944004"
     variation       30
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369480831"
     variation       44
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199946219"
     CDS             53..16345
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="620 kDa actin binding protein; macrophin 1;
                     trabeculin-alpha; actin cross-linking family protein 7"
                     /codon_start=1
                     /product="microtubule-actin cross-linking factor 1"
                     /protein_id="NP_036222.3"
                     /db_xref="GI:33188445"
                     /db_xref="CCDS:CCDS435.1"
                     /db_xref="GeneID:23499"
                     /db_xref="HGNC:13664"
                     /db_xref="HPRD:09750"
                     /db_xref="MIM:608271"
                     /translation="
MSSSDEETLSERSCRSERSCRSERSYRSERSGSLSPCPPGDTLPWNLPLHEQKKRKSQDSVLDPAERAVVRVADERDRVQKKTFTKWVNKHLMKVRKHINDLYEDLRDGHNLISLLEVLSGIKLPREKGRMRFHRLQNVQIALDFLKQRQVKLVNIRNDDITDGNPKLTLGLIWTIILHFQISDIYISGESGDMSAKEKLLLWTQKVTAGYTGIKCTNFSSCWSDGKMFNALIHRYRPDLVDMERVQIQSNRENLEQAFEVAERLGVTRLLDAEDVDVPSPDEKSVITYVSSIYDAFPKVPEGGEGISATEVDSRWQEYQSRVDSLIPWIKQHTILMSDKTFPQNPVELKALYNQYIHFKETEILAKEREKGRIEELYKLLEVWIEFGRIKLPQGYHPNDVEEEWGKLIIEMLEREKSLRPAVERLELLLQIANKIQNGALNCEEKLTLAKNTLQADAAHLESGQPVQCESDVIMYIQECEGLIRQLQVDLQILRDENYYQLEELAFRVMRLQDELVTLRLECTNLYRKGHFTSLELVPPSTLTTTHLKAEPLTKATHSSSTSWFRKPMTRAELVAISSSEDEGNLRFVYELLSWVEEMQMKLERAEWGNDLPSVELQLETQQHIHTSVEELGSSVKEARLYEGKMSQNFHTSYAETLGKLETQYCKLKETSSFRMRHLQSLHKFVSRATAELIWLNEKEEEELAYDWSDNNSNISAKRNYFSELTMELEEKQDVFRSLQDTAELLSLENHPAKQTVEAYSAAVQSQLQWMKQLCLCVEQHVKENTAYFQFFSDARELESFLRNLQDSIKRKYSCDHNTSLSRLEDLLQDSMDEKEQLIQSKSSVASLVGRSKTIVQLKPRSPDHVLKNTISVKAVCDYRQIEITICKNDECVLEDNSQRTKWKVISPTGNEAMVPSVCFLIPPPNKDAIEMASRVEQSYQKVMALWHQLHVNTKSLISWNYLRKDLDLVQTWNLEKLRSSAPGECHQIMKNLQAHYEDFLQDSRDSVLFSVADRLRLEEEVEACKARFQHLMKSMENEDKEETVAKMYISELKNIRLRLEEYEQRVVKRIQSLASSRTDRDAWQDNALRIAEQEHTQEDLQQLRSDLDAVSMKCDSFLHQSPSSSSVPTLRSELNLLVEKMDHVYGLSTVYLNKLKTVDVIVRSIQDAELLVKGYEIKLSQEEVVLADLSALEAHWSTLRHWLSDVKDKNSVFSVLDEEIAKAKVVAEQMSRLTPERNLDLERYQEKGSQLQERWHRVIAQLEIRQSELESIQEVLGDYRACHGTLIKWIEETTAQQEMMKPGQAEDSRVLSEQLSQQTALFAEIERNQTKLDQCQKFSQQYSTIVKDYELQLMTYKAFVESQQKSPGKRRRMLSSSDAITQEFMDLRTRYTALVTLTTQHVKYISDALRRLEEEEKVVEEEKQEHVEKVKELLGWVSTLARNTQGKATSSETKESTDIEKAILEQQVLSEELTTKKEQVSEAIKTSQIFLAKHGHKLSEKEKKQISEQLNALNKAYHDLCDGSANQLQQLQSQLAHQTEQKTLQKQQNTCHQQLEDLCSWVGQAERALAGHQGRTTQQDLSALQKNQSDLKDLQDDIQNRATSFATVVKDIEGFMEENQTKLSPRELTALREKLHQAKEQYEALQEETRVAQKELEEAVTSALQQETEKSKAAKELAENKKKIDALLDWVTSVGSSGGQLLTNLPGMEQLSGASLEKGALDTTDGYMGVNQAPEKLDKQCEMMKARHQELLSQQQNFILATQSAQAFLDQHGHNLTPEEQQMLQQKLGELKEQYSTSLAQSEAELKQVQTLQDELQKFLQDHKEFESWLERSEKELENMHKGGSSPETLPSLLKRQGSFSEDVISHKGDLRFVTISGQKVLDMENSFKEGKEPSEIGNLVKDKLKDATERYTALHSKCTRLGSHLNMLLGQYHQFQNSADSLQAWMQACEANVEKLLSDTVASDPGVLQEQLATTKQLQEELAEHQVPVEKLQKVARDIMEIEGEPAPDHRHVQETTDSILSHFQSLSYSLAERSSLLQKAIAQSQSVQESLESLLQSIGEVEQNLEGKQVSSLSSGVIQEALATNMKLKQDIARQKSSLEATREMVTRFMETADSTTAAVLQGKLAEVSQRFEQLCLQQQEKESSLKKLLPQAEMFEHLSGKLQQFMENKSRMLASGNQPDQDITHFFQQIQELNLEMEDQQENLDTLEHLVTELSSCGFALDLCQHQDRVQNLRKDFTELQKTVKEREKDASSCQEQLDEFRKLVRTFQKWLKETEGSIPPTETSMSAKELEKQIEHLKSLLDDWASKGTLVEEINCKGTSLENLIMEITAPDSQGKTGSILPSVGSSVGSVNGYHTCKDLTEIQCDMSDVNLKYEKLGGVLHERQESLQAILNRMEEVHKEANSVLQWLESKEEVLKSMDAMSSPTKTETVKAQAESNKAFLAELEQNSPKIQKVKEALAGLLVTYPNSQEAENWKKIQEELNSRWERATEVTVARQRQLEESASHLACFQAAESQLRPWLMEKELMMGVLGPLSIDPNMLNAQKQQVQFMLKEFEARRQQHEQLNEAAQGILTGPGDVSLSTSQVQKELQSINQKWVELTDKLNSRSSQIDQAIVKSTQYQELLQDLSEKVRAVGQRLSVQSAISTQPEAVKQQLEETSEIRSDLEQLDHEVKEAQTLCDELSVLIGEQYLKDELKKRLETVALPLQGLEDLAADRINRLQAALASTQQFQQMFDELRTWLDDKQSQQAKNCPISAKLERLQSQLQENEEFQKSLNQHSGSYEVIVAEGESLLLSVPPGEEKRTLQNQLVELKNHWEELSKKTADRQSRLKDCMQKAQKYQWHVEDLVPWIEDCKAKMSELRVTLDPVQLESSLLRSKAMLNEVEKRRSLLEILNSAADILINSSEADEDGIRDEKAGINQNMDAVTEELQAKTGSLEEMTQRLREFQESFKNIEKKVEGAKHQLEIFDALGSQACSNKNLEKLRAQQEVLQALEPQVDYLRNFTQGLVEDAPDGSDASQLLHQAEVAQQEFLEVKQRVNSGCVMMENKLEGIGQFHCRVREMFSQLADLDDELDGMGAIGRDTDSLQSQIEDVRLFLNKIHVLKLDIEASEAECRHMLEEEGTLDLLGLKRELEALNKQCGKLTERGKARQEQLELTLGRVEDFYRKLKGLNDATTAAEEAEALQWVVGTEVEIINQQLADFKMFQKEQVDPLQMKLQQVNGLGQGLIQSAGKDCDVQGLEHDMEEINARWNTLNKKVAQRIAQLQEALLHCGKFQDALEPLLSWLADTEELIANQKPPSAEYKVVKAQIQEQKLLQRLLDDRKATVDMLQAEGGRIAQSAELADREKITGQLESLESRWTELLSKAAARQKQLEDILVLAKQFHETAEPISDFLSVTEKKLANSEPVGTQTAKIQQQIIRHKALEEDIENHATDVHQAVKIGQSLSSLTSPAEQGVLSEKIDSLQARYSEIQDRCCRKAALLDQALSNARLFGEDEVEVLNWLAEVEDKLSSVFVKDFKQDVLHRQHADHLALNEEIVNRKKNVDQAIKNGQALLKQTTGEEVLLIQEKLDGIKTRYADITVTSSKALRTLEQARQLATKFQSTYEELTGWLREVEEELATSGGQSPTGEQIPQFQQRQKELKKEVMEHRLVLDTVNEVSRALLELVPWRAREGLDKLVSDANEQYKLVSDTIGQRVDEIDAAIQRSQQYEQAADAELAWVAETKRKLMALGPIRLEQDQTTAQLQVQKAFSIDIIRHKDSMDELFSHRSEIFGTCGEEQKTVLQEKTESLIQQYEAISLLNSERYARLERAQVLVNQFWETYEELSPWIEETRALIAQLPSPAIDHEQLRQQQEEMRQLRESIAEHKPHIDKLLKIGPQLKELNPEEGEMVEEKYQKAENMYAQIKEEVRQRALALDEAVSQSTQITEFHDKIEPMLETLENLSSRLRMPPLIPAEVDKIRECISDNKSATVELEKLQPSFEALKRRGEELIGRSQGADKDLAAKEIQDKLDQMVFFWEDIKARAEEREIKFLDVLELAEKFWYDMAALLTTIKDTQDIVHDLESPGIDPSIIKQQVEAAETIKEETDGLHEELEFIRILGADLIFACGETEKPEVRKSIDEMNNAWENLNKTWKERLEKLEDAMQAAVQYQDTLQAMFDWLDNTVIKLCTMPPVGTDLNTVKDQLNEMKEFKVEVYQQQIEMEKLNHQGELMLKKATDETDRDIIREPLTELKHLWENLGEKIAHRQHKLEGALLALGQFQHALEELMSWLTHTEELLDAQRPISGDPKVIEVELAKHHVLKNDVLAHQATVETVNKAGNELLESSAGDDASSLRSRLEAMNQCWESVLQKTEEREQQLQSTLQQAQGFHSEIEDFLLELTRMESQLSASKPTGGLPETAREQLDTHMELYSQLKAKEETYNQLLDKGRLMLLSRDDSGSGSKTEQSVALLEQKWHVVSSKMEERKSKLEEALNLATEFQNSLQEFINWLTLAEQSLNIASPPSLILNTVLSQIEEHKVFANEVNAHRDQIIELDQTGNQLKFLSQKQDVVLIKNLLVSVQSRWEKVVQRSIERGRSLDDARKRAKQFHEAWKKLIDWLEDAESHLDSELEISNDPDKIKLQLSKHKEFQKTLGGKQPVYDTTIRTGRALKEKTLLPEDSQKLDNFLGEVRDKWDTVCGKSVERQHKLEEALLFSGQFMDALQALVDWLYKVEPQLAEDQPVHGDLDLVMNLMDAHKVFQKELGKRTGTVQVLKRSGRELIENSRDDTTWVKGQLQELSTRWDTVCKLSVSKQSRLEQALKQAEVFRDTVHMLLEWLSEAEQTLRFRGALPDDTEALQSLIDTHKEFMKKVEEKRVDVNSAVAMGEVILAVCHPDCITTIKHWITIIRARFEEVLTWAKQHQQRLETALSELVANAELLEELLAWIQWAETTLIQRDQEPIPQNIDRVKALIAEHQTFMEEMTRKQPDVDRVTKTYKRKNIEPTHAPFIEKSRSGGRKSLSQPTPPPMPILSQSEAKNPRINQLSARWQQVWLLALERQRKLNDALDRLEELKEFANFDFDVWRKKYMRWMNHKKSRVMDFFRRIDKDQDGKITRQEFIDGILASKFPTTKLEMTAVADIFDRDGDGYIDYYEFVAALHPNKDAYRPTTDADKIEDEVTRQVAQCKCAKRFQVEQIGENKYRFGDSQQLRLVRILRSTVMVRVGGGWMALDEFLVKNDPCRARGRTNIELREKFILPEGASQGMTPFRSRGRRSKPSSRAASPTRSSSSASQSNHSCTSMPSSPATPASGTKVIPSSGSKLKRPTPTFHSSRTSLAGDTSNSSSPASTGAKTNRADPKKSASRPGSRAGSRAGSRASSRRGSDASDFDLLETQSACSDTSESSAAGGQGNSRRGLNKPSKIPTMSKKTTTASPRTPGPKR
"
     misc_feature    290..595
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="Calponin homology domain; actin-binding domain
                     which may be present as a single copy or in tandem repeats
                     (which increases binding affinity). The CH domain is found
                     in cytoskeletal and signal transduction proteins,
                     including actin-binding proteins like...; Region: CH;
                     cd00014"
                     /db_xref="CDD:28898"
     misc_feature    order(290..292,296..304,311..313,320..322,479..484,
                     491..493,500..502,506..508,551..556,563..568,572..577,
                     584..589)
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="putative actin binding surface [polypeptide
                     binding]; other site"
                     /db_xref="CDD:28898"
     misc_feature    494..565
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9UPN3.4);
                     Region: LRR 1"
     misc_feature    635..946
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="Calponin homology domain; actin-binding domain
                     which may be present as a single copy or in tandem repeats
                     (which increases binding affinity). The CH domain is found
                     in cytoskeletal and signal transduction proteins,
                     including actin-binding proteins like...; Region: CH;
                     cd00014"
                     /db_xref="CDD:28898"
     misc_feature    order(635..640,644..652,659..661,668..670,827..832,
                     839..841,848..850,854..856,902..907,914..919,923..928,
                     935..940)
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="putative actin binding surface [polypeptide
                     binding]; other site"
                     /db_xref="CDD:28898"
     misc_feature    770..844
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9UPN3.4);
                     Region: LRR 2"
     misc_feature    890..892
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q9UPN3.4); phosphorylation site"
     misc_feature    1181..1249
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9UPN3.4);
                     Region: LRR 3"
     misc_feature    1373..1444
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9UPN3.4);
                     Region: LRR 4"
     misc_feature    1808..2404
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    2093..2104
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    2171..2665
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    2405..2422
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    3200..3271
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9UPN3.4);
                     Region: LRR 5"
     misc_feature    3434..3514
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9UPN3.4);
                     Region: LRR 6"
     misc_feature    3611..3682
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9UPN3.4);
                     Region: LRR 7"
     misc_feature    3821..3898
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9UPN3.4);
                     Region: LRR 8"
     misc_feature    4178..4180
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q9UPN3.4); phosphorylation site"
     misc_feature    4424..5035
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    4688..4705
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    5498..6184
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    5630..5632
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    5636..5638
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    order(5840..5845,5849..5860)
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    6233..6826
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    6506..6523
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    6833..7576
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    7238..7255
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    7247..7912
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    7337..7339
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    7412..7414
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    7574..7591
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    7925..8572
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    order(8237..8248,8252..8257)
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    8252..8890
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    8567..8584
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    8897..9538
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    9227..9244
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    9893..10534
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    10202..10219
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    10541..11188
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    10856..10873
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    10874..11512
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    11183..11200
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    11198..11839
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    11510..11527
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    12191..12844
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    12509..12526
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    12851..13501
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    13169..13186
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    13406..13408
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    13514..14158
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    13823..13840
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    14171..14800
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    14477..14494
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    14486..15220
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    14804..14821
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    15311..15499
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="EF-hand, calcium binding motif; A diverse
                     superfamily of calcium sensors and calcium signal
                     modulators; most examples in this alignment model have 2
                     active canonical EF hands. Ca2+ binding induces a
                     conformational change in the EF-hand motif, leading to...;
                     Region: EFh; cd00051"
                     /db_xref="CDD:28933"
     misc_feature    order(15338..15340,15344..15346,15350..15352,15371..15373,
                     15446..15448,15452..15454,15458..15460,15479..15481)
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:28933"
     misc_feature    15347..15496
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="EF-hand domain pair; Region: EF_hand_6; pfam13833"
                     /db_xref="CDD:206004"
     misc_feature    15536..15754
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /note="Growth-Arrest-Specific Protein 2 Domain; Region:
                     GAS2; smart00243"
                     /db_xref="CDD:128539"
     variation       79..80
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace=""
                     /replace="agtgagcggtcatgtcggagtgagcggtcttgtcgg"
                     /db_xref="dbSNP:6143196"
     variation       80..81
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace=""
                     /replace="agtgagcggtcatgtcggagtgagcggtcttgtcgg"
                     /db_xref="dbSNP:35529903"
     variation       86
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186743740"
     variation       87
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200446050"
     variation       91
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:368210104"
     variation       94
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201610193"
     variation       95
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372419962"
     variation       96
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199750582"
     variation       104
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369843705"
     variation       105..106
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace=""
                     /replace="gtcttgtcggagtgagcg"
                     /db_xref="dbSNP:376408478"
     variation       105
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372116509"
     variation       109
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:449805"
     variation       113
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141313177"
     variation       133
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:78058438"
     variation       145
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3736890"
     variation       232
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375441750"
     exon            273..334
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       301
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149539890"
     exon            335..424
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       351
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143548063"
     variation       371
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377731994"
     variation       372
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370298136"
     variation       393
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140873304"
     exon            425..502
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       435
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138393446"
     exon            503..595
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     exon            596..762
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       625
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369222802"
     variation       649
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147380893"
     variation       655
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143261539"
     exon            763..875
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       772
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201774392"
     variation       773
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374283116"
     variation       807
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377721676"
     variation       811
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371386732"
     variation       823
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2275188"
     variation       855
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373982422"
     exon            876..982
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       928
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150686066"
     variation       932
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373830261"
     variation       940
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200224717"
     variation       981
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191298596"
     exon            983..1102
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       1021
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370717175"
     variation       1030
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374378896"
     variation       1046
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143546862"
     exon            1103..1198
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       1117
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140603202"
     exon            1199..1326
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       1285
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143192678"
     variation       1314
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371808833"
     variation       1315
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141137606"
     exon            1327..1420
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       1352
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370951650"
     exon            1421..1575
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       1434
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:78563508"
     variation       1449
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138060421"
     variation       1455
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373306443"
     variation       1458
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112959843"
     variation       1558
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201761092"
     variation       1568
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186809071"
     variation       1575
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:193920913"
     exon            1576..1852
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       1584
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373188019"
     variation       1610
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375922773"
     variation       1624
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201011358"
     variation       1645
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150465013"
     variation       1688
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370525180"
     variation       1753
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149606868"
     variation       1764
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374067607"
     variation       1778
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376145097"
     exon            1853..1981
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       1866
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139794027"
     variation       1907
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141659809"
     variation       1919
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142880288"
     variation       1925
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202093559"
     variation       1944
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371233861"
     variation       1973
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372118518"
     exon            1982..2059
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       1983
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139995582"
     variation       2031
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113924428"
     exon            2060..2221
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       2116
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201559278"
     variation       2140
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147861117"
     variation       2193
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372718984"
     variation       2197
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375978863"
     exon            2222..2326
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       2280
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376228353"
     variation       2294
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371647149"
     exon            2327..2422
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       2374
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:116026083"
     exon            2423..2548
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       2439
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149023763"
     variation       2496
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148207245"
     variation       2519
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201616111"
     exon            2549..2701
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       2618
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369570247"
     variation       2634
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373088168"
     variation       2647
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377295691"
     variation       2661
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371976515"
     exon            2702..2856
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       2746
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374974130"
     variation       2755
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367990338"
     variation       2762
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145102581"
     variation       2800
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142232464"
     variation       2812
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368207735"
     variation       2821
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139266313"
     variation       2839
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:183823103"
     exon            2857..2983
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       2860
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74718295"
     variation       2866
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199567536"
     variation       2918
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139801751"
     variation       2967
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147633586"
     exon            2984..3167
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       3057
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375931922"
     variation       3066
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369062828"
     variation       3079
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141246822"
     variation       3117
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:78818778"
     variation       3121
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138972929"
     variation       3134
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199616867"
     variation       3141
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145898034"
     exon            3168..3337
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       3192
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141861752"
     variation       3193
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138834555"
     variation       3209
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374390979"
     variation       3219
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183919369"
     variation       3222
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201607258"
     variation       3250
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201601385"
     variation       3288
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368579432"
     variation       3316
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199899784"
     variation       3319
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146950475"
     exon            3338..3516
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       3397
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112618944"
     variation       3411
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:145184556"
     variation       3446
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:62623398"
     variation       3461
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148687589"
     variation       3474
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151139850"
     variation       3503
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200785161"
     variation       3511
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144057132"
     exon            3517..3655
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       3517
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147586507"
     variation       3536
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140670221"
     variation       3542
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376968248"
     variation       3543
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369150719"
     variation       3625
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372475203"
     exon            3656..3849
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       3728
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376146349"
     variation       3739
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138353260"
     variation       3758
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370839433"
     variation       3763
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74066738"
     variation       3783
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138873333"
     variation       3795
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:62622784"
     exon            3850..4012
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       3850
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143805726"
     variation       3932
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371935380"
     variation       3952
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376860713"
     variation       3962
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369419637"
     variation       3991
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150560748"
     variation       4011
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202144547"
     exon            4013..4096
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       4020
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372722405"
     variation       4030
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116588275"
     variation       4035
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139099001"
     variation       4061
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146466275"
     variation       4093
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:144430912"
     exon            4097..4204
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       4112
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141025026"
     variation       4164
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371941087"
     variation       4167
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377459189"
     variation       4169
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371011730"
     variation       4170
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200487900"
     variation       4192
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145841002"
     variation       4193
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367571121"
     exon            4205..4303
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       4223
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:202118871"
     variation       4231
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147033221"
     variation       4287
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148253091"
     exon            4304..4456
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       4329
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:150801039"
     variation       4372
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369858108"
     variation       4408
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372205121"
     variation       4429
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142403927"
     variation       4452
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375455743"
     exon            4457..4545
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       4472
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181842165"
     variation       4476
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186908155"
     variation       4487
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374911872"
     variation       4511
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3116392"
     exon            4546..4681
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       4567
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188618759"
     variation       4587
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144722126"
     exon            4682..4831
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       4742
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138039241"
     variation       4747
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138127207"
     variation       4815
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149604772"
     exon            4832..5065
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       4857
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373418940"
     variation       4887
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:59084124"
     variation       4908
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376646815"
     variation       4921
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41270815"
     variation       4922
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200157842"
     variation       4927
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373411724"
     variation       4937
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138510790"
     variation       4946
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146297503"
     variation       4949
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370128972"
     variation       4961
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201516371"
     variation       4983
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185778539"
     variation       4985
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201477943"
     variation       4987
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41270817"
     variation       5001
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116162513"
     variation       5041
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145670523"
     variation       5042
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367562249"
     exon            5066..5290
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       5126
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:79847802"
     variation       5147
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141916250"
     variation       5173
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:148218605"
     variation       5186
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368225497"
     variation       5191
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150239827"
     variation       5242
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377665968"
     variation       5276
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372604202"
     exon            5291..5809
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       5314
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202073883"
     variation       5330
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374690401"
     variation       5338
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368999283"
     variation       5363
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138216559"
     variation       5374
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372724873"
     variation       5379
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146102906"
     variation       5391
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202136338"
     variation       5401
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376279263"
     variation       5403
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142179968"
     variation       5410
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200372565"
     variation       5420
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369559992"
     variation       5422
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:145299069"
     variation       5501
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373723596"
     variation       5515
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201528133"
     variation       5550
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142001499"
     variation       5577
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:144202640"
     variation       5587
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:192201614"
     variation       5596
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369806786"
     variation       5607
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148847012"
     variation       5609
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148356076"
     variation       5621
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145899609"
     variation       5623
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374553228"
     variation       5738
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:77561254"
     variation       5744
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377323910"
     variation       5787
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370430599"
     variation       5804
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373955060"
     exon            5810..5986
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       5817
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376039171"
     variation       5839
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192146426"
     variation       5845
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:138839092"
     variation       5860
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148458151"
     variation       5866
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147231277"
     variation       5886
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:140590169"
     variation       5909
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144873442"
     variation       5914
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144925198"
     variation       5926
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145792948"
     variation       5979
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141410561"
     variation       5986
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148300193"
     exon            5987..6110
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       5990
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145847511"
     variation       6047
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201462187"
     variation       6104
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150440292"
     exon            6111..6319
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       6137
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138693822"
     variation       6159
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201574478"
     variation       6167
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138390862"
     variation       6169
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147189398"
     variation       6190
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142917322"
     variation       6192
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148404744"
     variation       6233
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150969133"
     variation       6265
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146610918"
     variation       6269
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150273938"
     variation       6273
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371937349"
     variation       6292
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375208671"
     exon            6320..6637
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       6339
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143377519"
     variation       6346
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148941386"
     variation       6349
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375091527"
     variation       6368
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185769891"
     variation       6411
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377017457"
     variation       6432
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369591214"
     variation       6452
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374316302"
     variation       6453
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377759390"
     variation       6463
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138428016"
     variation       6487
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146501848"
     variation       6560
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141234977"
     variation       6575
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113689565"
     variation       6576
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202091396"
     variation       6617
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:146231118"
     exon            6638..6804
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       6644
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:145646053"
     variation       6651
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138189653"
     variation       6677
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372470650"
     variation       6691
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142878941"
     variation       6741
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201878865"
     variation       6804
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376448874"
     exon            6805..6961
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       6816
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145935087"
     variation       6848
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143291154"
     variation       6849
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374060078"
     variation       6920
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2296172"
     variation       6933
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:151333396"
     variation       6946
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150053411"
     exon            6962..7079
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       6972
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:142318271"
     variation       6975
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200223302"
     variation       6985
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:80197726"
     variation       7011
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148069432"
     variation       7042
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149366946"
     variation       7055
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143141361"
     variation       7063
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:368920409"
     variation       7079
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146021397"
     exon            7080..7142
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       7101
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116023049"
     exon            7143..7384
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       7149
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139081523"
     variation       7217
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:79990239"
     variation       7241
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377263950"
     variation       7292
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370834104"
     variation       7294
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146987379"
     variation       7372
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199786125"
     exon            7385..7514
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       7414
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370217927"
     variation       7445
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:75661507"
     variation       7454
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140898090"
     variation       7461
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199814209"
     variation       7503
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192489722"
     variation       7507
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6673570"
     exon            7515..7714
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       7541
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:187137636"
     variation       7559
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:140489965"
     variation       7620
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:79306726"
     variation       7629
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:141560933"
     variation       7645
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147972692"
     exon            7715..8210
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       7741
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150524232"
     variation       7824
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368196379"
     variation       7826
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372108361"
     variation       7830
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201119773"
     variation       7848
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201099014"
     variation       7863
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202136571"
     variation       7884
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187312070"
     variation       7886
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200187833"
     variation       7887
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143981052"
     variation       7909
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192209319"
     variation       7910
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116066974"
     variation       7937
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140996874"
     variation       7954
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368764590"
     variation       7966
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145717007"
     variation       7972
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142872079"
     variation       8032
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146766404"
     variation       8036
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145533329"
     variation       8044
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:16826105"
     variation       8081
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372278096"
     variation       8108
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148218837"
     variation       8130
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147294270"
     variation       8180
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202080967"
     variation       8185
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:143338205"
     exon            8211..9682
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       8212
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200233678"
     variation       8235
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139258331"
     variation       8336
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145271544"
     variation       8337
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143660961"
     variation       8342
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72661966"
     variation       8348
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188910967"
     variation       8349
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375379796"
     variation       8365
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369766662"
     variation       8453
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373220335"
     variation       8461
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199779097"
     variation       8493
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374695144"
     variation       8495
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150081691"
     variation       8497
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201618029"
     variation       8515
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:79901102"
     variation       8537
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:370757240"
     variation       8556
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:617368"
     variation       8562
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201524349"
     variation       8563
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374186178"
     variation       8564
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144861088"
     variation       8570
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:617401"
     variation       8575
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:617405"
     variation       8584
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:617422"
     variation       8599
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370194996"
     variation       8613
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:141858850"
     variation       8617
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140010098"
     variation       8672
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:617863"
     variation       8681
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368402627"
     variation       8693
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146321347"
     variation       8720
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147252386"
     variation       8730
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140695276"
     variation       8755
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372152652"
     variation       8770
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111406676"
     variation       8787
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:377013987"
     variation       8800
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369582426"
     variation       8808
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374309845"
     variation       8836
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377757339"
     variation       8881
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369137678"
     variation       8882
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372693965"
     variation       8900
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377026177"
     variation       8902
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149107306"
     variation       8903
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111539040"
     variation       8907
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201155014"
     variation       8950
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:183960224"
     variation       8990
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:75912199"
     variation       8992
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:147777128"
     variation       8993
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144760259"
     variation       8995
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141782558"
     variation       9011
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:191256950"
     variation       9020
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370428200"
     variation       9039
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:151273405"
     variation       9049
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200924386"
     variation       9053
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:687425"
     variation       9078
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374026577"
     variation       9092
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144367111"
     variation       9149
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141949859"
     variation       9152
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6691379"
     variation       9170
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:687895"
     variation       9192
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:620234"
     variation       9223
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376131402"
     variation       9244
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:590751"
     variation       9245
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184827427"
     variation       9246
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199498174"
     variation       9252
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199851077"
     variation       9253
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150565788"
     variation       9274
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149746077"
     variation       9289
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374530248"
     variation       9311
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141166701"
     variation       9334
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:621075"
     variation       9343
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147597953"
     variation       9344
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181850215"
     variation       9354
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185233667"
     variation       9409
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373592718"
     variation       9414
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201770692"
     variation       9424
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371461097"
     variation       9459
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143064678"
     variation       9508
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141023728"
     variation       9510
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139015549"
     variation       9522
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371560140"
     variation       9544
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145629410"
     variation       9563
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376859455"
     variation       9595
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72661968"
     variation       9635
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372543301"
     variation       9660
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199845418"
     variation       9667
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201871066"
     exon            9683..9844
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       9690
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149593573"
     variation       9786
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:368467363"
     variation       9795..9796
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35438168"
     variation       9801
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:376100884"
     variation       9822
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148666575"
     variation       9832
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147443359"
     variation       9833
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145278746"
     variation       9834
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201648926"
     exon            9845..10015
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       9847
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375250102"
     variation       9852
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200491748"
     variation       9880
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372115428"
     variation       9900
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377023267"
     variation       9922
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139439033"
     variation       9951
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368494057"
     variation       9957
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145508527"
     exon            10016..10182
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       10025
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201400155"
     variation       10040
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145098670"
     variation       10058
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377568190"
     variation       10086
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140724379"
     variation       10108
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200516627"
     variation       10128
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:148087181"
     variation       10134
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200855192"
     variation       10172
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200772852"
     exon            10183..10342
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       10226..10227
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:36057977"
     variation       10233
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150229499"
     variation       10279
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114556513"
     variation       10337
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78918472"
     variation       10339
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372606214"
     variation       10340
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371581281"
     exon            10343..10669
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       10348
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41307884"
     variation       10385
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:191687628"
     variation       10386
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202165997"
     variation       10393
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:139676942"
     variation       10416
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:202226966"
     variation       10422
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183587769"
     variation       10469
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376262010"
     variation       10476
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188914563"
     variation       10478
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369581844"
     variation       10508
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142060317"
     variation       10533
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201218871"
     variation       10573
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142029347"
     variation       10619
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139086219"
     variation       10631
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:146853404"
     variation       10637
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376918561"
     exon            10670..10754
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       10708
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145899698"
     variation       10733
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377337112"
     exon            10755..10996
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       10773
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375048326"
     STS             10776..10894
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /standard_name="SHGC-74734"
                     /db_xref="UniSTS:36713"
     variation       10783
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149150778"
     variation       10791
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148290248"
     variation       10807
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147050519"
     variation       10808
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200410266"
     variation       10900
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200167441"
     variation       10902
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367931654"
     variation       10941
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202052424"
     variation       10983
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:145430083"
     exon            10997..11203
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       11046
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369551970"
     variation       11105
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371775179"
     variation       11152
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143622071"
     variation       11153
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376321803"
     variation       11155
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369620780"
     variation       11158
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61779301"
     variation       11200
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199717931"
     exon            11204..11323
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       11213
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201602708"
     variation       11276
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138634100"
     variation       11280
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144615050"
     exon            11324..11431
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       11360
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144042918"
     variation       11382
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139726571"
     variation       11395
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371189732"
     variation       11420
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151124023"
     variation       11427..11428
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:34409384"
     exon            11432..11650
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       11494
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149844422"
     variation       11499
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368717141"
     variation       11534
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199831371"
     variation       11537
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141504077"
     variation       11558
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138392909"
     variation       11576
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138450442"
     variation       11579
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201926226"
     exon            11651..11854
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       11695
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111288196"
     variation       11706
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376947701"
     variation       11734
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141369169"
     variation       11742
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368279342"
     variation       11763
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201353828"
     variation       11814
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372488737"
     variation       11837
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:137887503"
     exon            11855..11863
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     exon            11864..12095
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       11879
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201968058"
     variation       11895
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145983422"
     variation       11915
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370673790"
     variation       11939
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78528384"
     variation       11948
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150044588"
     variation       11973
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200924206"
     variation       12035
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199850991"
     variation       12036
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111674835"
     variation       12039
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148757960"
     variation       12053
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376249585"
     variation       12054
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202113892"
     exon            12096..12322
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       12122
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371766361"
     variation       12131
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371375394"
     variation       12150
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201207653"
     variation       12162
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200319787"
     variation       12184
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200132996"
     variation       12211
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151323961"
     variation       12247
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145339018"
     variation       12255
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:142453957"
     variation       12260
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:367680576"
     exon            12323..12445
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     exon            12446..12547
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       12455
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:193920879"
     variation       12457
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:188613265"
     variation       12520
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372899294"
     exon            12548..12649
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       12550
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112386326"
     variation       12551
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184077740"
     variation       12559
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202117254"
     variation       12573
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142380450"
     exon            12650..12823
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       12722
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138510628"
     variation       12741
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377031601"
     variation       12742
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370347610"
     variation       12745
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111880300"
     variation       12780
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:682351"
     exon            12824..12979
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       12857
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147544102"
     variation       12905
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147673829"
     variation       12910
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150571393"
     variation       12936
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370478712"
     variation       12967
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148704119"
     exon            12980..13177
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       13024
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:11206102"
     variation       13032
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141128754"
     variation       13040
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:372134963"
     variation       13042
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138532677"
     variation       13100
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:587404"
     variation       13105
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141541905"
     variation       13113
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140057477"
     variation       13131
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375449162"
     variation       13135
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147314336"
     variation       13174
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139563893"
     exon            13178..13306
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       13219
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148529836"
     variation       13247
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372268152"
     variation       13280
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200974304"
     variation       13290
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:368976182"
     exon            13307..13480
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       13323
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201860067"
     variation       13339
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377362749"
     variation       13372
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369814070"
     variation       13381
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374486121"
     variation       13385
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370434058"
     variation       13386
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200611539"
     variation       13391
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376583802"
     variation       13395
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:680728"
     variation       13402
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146492586"
     variation       13435
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371104926"
     variation       13450
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143526587"
     variation       13473
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140123363"
     exon            13481..13636
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       13513
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200264259"
     exon            13637..13843
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       13675
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181287038"
     variation       13728
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199754020"
     variation       13729
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372179124"
     variation       13741
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375422279"
     variation       13746
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372631852"
     variation       13760
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369605640"
     variation       13762
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374421978"
     variation       13808
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:137872321"
     variation       13833
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200696333"
     exon            13844..13963
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       13886
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201044159"
     variation       13914
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112275059"
     variation       13917
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201641483"
     exon            13964..14133
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       13975
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373353949"
     variation       13977
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376728302"
     variation       13982
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370882110"
     variation       13997
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374494774"
     variation       14054
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181571305"
     variation       14061
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:668556"
     exon            14134..14293
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       14195
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147337818"
     variation       14213
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200471504"
     variation       14242
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367715036"
     variation       14245
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201606413"
     variation       14251
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201702375"
     variation       14254
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141432493"
     variation       14270
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:139238480"
     exon            14294..14488
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       14330
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146089082"
     variation       14338
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143354848"
     variation       14354
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1746838"
     variation       14422
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373978640"
     variation       14424
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141918077"
     variation       14433
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2296174"
     exon            14489..14617
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       14506
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138718991"
     variation       14509
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369175368"
     variation       14521
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146732157"
     variation       14550
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:180745507"
     variation       14614
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372863764"
     exon            14618..14761
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       14625
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:149436586"
     variation       14641
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199628828"
     variation       14704
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183443732"
     variation       14723
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368734203"
     variation       14741
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12068423"
     exon            14762..14950
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       14767
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368970987"
     variation       14788
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371601268"
     variation       14807
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200312184"
     variation       14827
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201053350"
     variation       14849
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202135814"
     variation       14907
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145113396"
     variation       14908
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147729421"
     variation       14938
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369524203"
     variation       14939
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142006710"
     exon            14951..15071
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       14973
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:183077332"
     variation       14989
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377235408"
     variation       14995
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200147555"
     variation       15004
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201643105"
     variation       15023
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139123483"
     variation       15060
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188161549"
     variation       15064
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367941329"
     variation       15065
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201043233"
     variation       15071
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145079541"
     exon            15072..15235
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       15079
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:142411922"
     variation       15080
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374419950"
     variation       15084
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112897114"
     variation       15102
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368764004"
     variation       15110
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373082989"
     variation       15162
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376254871"
     variation       15180..15181
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace=""
                     /replace="ggggg"
                     /db_xref="dbSNP:150902088"
     variation       15182
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:79639036"
     variation       15234
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199563327"
     exon            15236..15398
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       15251
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151300948"
     variation       15266
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371067459"
     variation       15380
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150495633"
     exon            15399..15553
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       15412
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200883556"
     variation       15413
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375373352"
     variation       15435
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187250526"
     variation       15503
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:74984567"
     variation       15514
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142801936"
     variation       15519
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116746108"
     variation       15529
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116271948"
     exon            15554..15628
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     exon            15629..15746
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       15652
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141731743"
     variation       15657
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200234738"
     variation       15676
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200044531"
     variation       15688
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201768116"
     exon            15747..15958
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       15768
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112372806"
     variation       15784
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148653007"
     variation       15824
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374622508"
     variation       15830
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367667922"
     variation       15834
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370344773"
     variation       15858
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183345423"
     variation       15938
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:202091916"
     exon            15959..16088
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       15979
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140592136"
     variation       15998
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368303728"
     variation       16021
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191949645"
     variation       16024
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372771982"
     variation       16030
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111693992"
     variation       16044
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376015198"
     variation       16062
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202106473"
     variation       16063
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72930231"
     variation       16067
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144945460"
     exon            16089..17689
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /inference="alignment:Splign:1.39.8"
     variation       16121
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143755803"
     variation       16122
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77696779"
     variation       16138
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201356281"
     variation       16141
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201273333"
     variation       16158
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141451252"
     variation       16172
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373899622"
     variation       16183
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138819868"
     variation       16213
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377022334"
     variation       16232
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371553978"
     variation       16320
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150441015"
     variation       16321
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149519812"
     variation       16356
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201526091"
     variation       16363..16364
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:376820746"
     variation       16363
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200755289"
     variation       16372
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372785869"
     variation       16376
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377200423"
     variation       16380
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201016369"
     variation       16389
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190039408"
     variation       16391
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373063201"
     STS             16404..16610
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /standard_name="A009U48"
                     /db_xref="UniSTS:56632"
     STS             16404..16610
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /standard_name="G32864"
                     /db_xref="UniSTS:117443"
     STS             16458..16611
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /standard_name="RH70142"
                     /db_xref="UniSTS:74741"
     variation       16622
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:3839022"
     STS             16633..16745
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /standard_name="SHGC-74632"
                     /db_xref="UniSTS:77242"
     variation       16633
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200349226"
     variation       16654
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147054377"
     polyA_signal    16751..16756
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
     polyA_site      16768
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
     variation       16807
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116861168"
     variation       16918
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181300014"
     variation       17006
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12409928"
     variation       17025
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:117993747"
     variation       17326..17327
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:201047979"
     STS             17339..17502
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /standard_name="SHGC-74638"
                     /db_xref="UniSTS:57569"
     variation       17417
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138404184"
     polyA_signal    17513..17518
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
     polyA_site      17536
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
     variation       17613
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371672724"
     variation       17624
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:710915"
     variation       17672
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149551194"
     polyA_site      17689
                     /gene="MACF1"
                     /gene_synonym="ABP620; ACF7; MACF; OFC4"
ORIGIN      
atcacttctccctgggctcccaggccctcctgcagcagcccccgcctgggccatgtcttcctcagatgaagagacgctcagtgagcggtcatgtcggagtgagcggtcttgtcggagtgagcgatcttacaggagcgagcggtcggggagcctgtctccctgtcccccaggggacaccttgccctggaacctgccactgcatgagcagaaaaagcggaaaagccaggattcggtgctggaccctgcagagcgtgctgtggtcagagtcgctgatgaacgggaccgggttcagaagaaaacgttcaccaagtgggtcaacaagcacttaatgaaggtccgcaagcacatcaatgatctttatgaagatctgcgggatggccataacctgatctctctgttggaggtcctctcaggcatcaaactgccccgggagaagggcaggatgcgttttcataggctgcagaatgtgcagattgccctggacttcctaaagcagcgacaggtgaaactagtgaatattcgcaatgatgacatcacagatggcaaccccaagttgaccctgggtctgatctggaccattattttgcatttccagatctctgacatctacattagtggagaatcaggggatatgtcagccaaggagaaactactcctgtggacccagaaggtgacagctggttacacaggaatcaaatgcaccaacttttcctcctgctggagtgatgggaagatgttcaatgcactcattcaccgataccgacccgatctagtagacatggagagggtgcaaatccaaagtaaccgagagaatctggaacaggcttttgaagtggcagaaagactgggggtcactcgcctgctggatgcagaagatgtggatgtgccatctccagatgaaaagtctgtaatcacttatgtgtcttcgatttatgatgccttccctaaagttcctgagggtggagaagggatcagtgctacggaagtggactccaggtggcaagaataccaaagccgagtggactccctcattccctggatcaaacagcatacaatactgatgtcagataaaacttttccccaaaaccctgttgaactaaaggcactttataaccaatatatacacttcaaagaaacagaaattctggccaaggagagagaaaaaggaagaattgaggaattatataaattactagaggtgtggattgaatttggccgaattaaactgcctcaaggttatcaccctaatgatgtggaagaagagtggggaaagctcatcatagagatgctggaacgagagaaatcacttcggccggctgtggagaggctggaattgctgctacagattgcaaacaaaatccagaatggtgctttgaactgtgaagaaaaactgacactagctaagaatacactgcaggctgatgctgctcacctggaatcaggacaaccggtacaatgtgagtcagatgtcattatgtacattcaggagtgtgaaggtctcatcaggcagctgcaggtggatctccagatcctgcgggatgagaattactaccagctagaagagctggcttttagggtcatgcgtcttcaggatgagctggtcaccttgcgtctagagtgtacaaacctgtaccggaagggtcatttcacttcacttgaattggttccaccctctactttaaccaccactcatctgaaagcagaacccttaaccaaggcaacccattcttcttctacctcctggttccgaaagcctatgactcgggctgaacttgtggccatcagctcctctgaagatgaaggcaatctccgatttgtgtatgaactactgtcttgggtagaagagatgcagatgaaactggagcgagcagagtggggcaatgacctgcctagtgtggagttgcagctagaaacacagcagcacatccatacgagtgtagaagagctgggctcaagtgtcaaggaggccaggttgtatgagggaaagatgtcccagaatttccataccagctatgctgaaactcttggaaagctggagacacagtattgtaaattgaaggaaacttctagcttccggatgaggcaccttcagagcctgcataaatttgtttccagagctacagctgagttgatctggttgaatgagaaggaggaggaggaactagcatatgactggagtgacaacaattccaatatctcagccaagagaaattacttctctgagttgacaatggaactggaggagaaacaggatgtgtttcgttctctacaagatacagcagaactactttcacttgagaaccacccagccaagcagacagtggaggcttacagtgctgctgtccagtcccagttgcagtggatgaagcagctgtgcctgtgtgttgagcagcatgtgaaagagaatactgcttattttcagttcttcagtgatgcacgagagctggagtcattcttgaggaacctccaagattccattaaacgaaaatattcctgtgaccacaacaccagcttatcccgccttgaagacctgctccaggactccatggatgaaaaggagcagcttatacagtccaagagttccgttgccagtctcgttgggagatcaaaaaccatcgttcagctaaaaccacgcagtccagaccatgtgttaaagaacaccatttctgtcaaggctgtctgtgactacaggcagatcgagattactatttgcaaaaatgatgaatgtgtgctagaagataattctcagcggaccaaatggaaagtgatcagccccacagggaacgaggcaatggtgccgtcagtctgcttcctcatccccccacccaataaggatgccattgagatggccagcagggtcgaacaatcttatcagaaggttatggccctttggcatcagctgcatgttaacaccaaaagccttatctcttggaactatctgcgtaaagaccttgaccttgtacagacctggaacctagaaaagcttcgatcctcagcaccaggggagtgccatcagattatgaagaaccttcaggcccactatgaagactttctgcaggatagtcgtgactctgtgctgttctcagtggctgatcgcttgcgcttggaagaggaggtggaagcttgtaaagcccgcttccagcacctgatgaagtccatggagaatgaggacaaagaggagactgtggccaagatgtacatttcagagttgaagaacatccggctacgcctggaggagtatgaacagagggtggtcaaacgaattcagtctctagccagctctaggactgacagagatgcctggcaggacaatgcattaaggattgcagagcaagagcacacccaggaggatttacagcaattgaggtcagacttggatgcagtttctatgaaatgtgacagctttctccatcagtctccatctagttcaagtgtcccaactctgcgctcagaactgaatctgctggtggagaagatggaccatgtctatggtctctctactgtatatctgaataagttaaagacagttgatgttatagtacgtagcatacaggatgctgaactcttggtcaaaggttatgagattaagctgagtcaagaagaagtagtactggcagatctctcagctctggaggcccattggtcgacattacggcactggcttagtgatgtgaaggacaagaattcagtgttttcagtcctggatgaggaaattgccaaggccaaggtagtggcagagcagatgagtcgtctgacaccagagcgaaatctggatttggagcgctatcaggaaaaaggctcccagctgcaggagcgttggcaccgagtcattgcccagctcgagattcgccaatctgagctagaaagtatccaggaagttctgggagattaccgagcctgccatggaactctcatcaagtggattgaggaaaccactgcccagcaggaaatgatgaagccaggccaggcagaggatagcagagtgctttcggagcagctcagccagcagacggccctatttgcagaaattgagagaaatcagacaaaactggatcaatgtcaaaaattttcccagcagtactctactattgtaaaggactatgaattgcaactgatgacatacaaggcctttgtggaatcgcagcagaaatcccctggcaagcgccgtcgcatgctttcctcttcagatgccatcactcaagagttcatggacttaaggactcgctacacggcattggtgactttaacaactcagcacgtgaaatacatcagtgatgcactccggcgtctggaggaggaggagaaagtggtagaagaggagaaacaagaacatgtggagaaggttaaagaacttttgggctgggtgtctaccctagcgaggaatacacaaggaaaagctacctcatccgagaccaaagaatcaacagacattgaaaaagctattttggaacagcaggttctgtcagaagagctgacaacaaagaaagaacaagtctctgaagctattaaaacatcacagatcttcttggccaagcatggtcataagctctcagaaaaagagaagaaacaaatatctgagcaattgaatgccctaaacaaggcttaccatgacctttgtgatggttctgcaaatcagcttcagcagcttcagagccagttggctcaccagacagaacaaaagaccctgcagaaacaacaaaatacctgtcaccagcaactggaggatctttgcagttgggtaggacaggcagaaagagcactggcaggccaccaaggcagaaccacccagcaggatctctctgctttgcagaagaaccaaagtgacttgaaggatttacaggatgacattcagaatcgtgccacctcatttgccactgttgtcaaggacattgaggggttcatggaagagaatcagaccaagctgagcccacgtgagttgacagctcttcgggaaaagcttcatcaggctaaggagcaatatgaggcgctccaggaagagacacgtgtggcccagaaggaactggaggaagcagtgacctccgccttacagcaggagactgaaaagagtaaagcagcaaaggaactggcagagaacaagaagaagatcgatgctctcctggattgggtaacttcagtaggatcatctggtggacagctgctgaccaaccttccaggaatggagcagctctcgggagctagcttggagaaaggagccttggacaccactgatggttacatgggggtgaatcaagccccagagaaactggacaagcaatgtgagatgatgaaggcccgtcaccaagaattgctgtcccagcagcaaaatttcattctggccacccagtcagctcaggccttcttggatcagcatggccacaatctcacacctgaggagcaacagatgctgcaacagaagctgggagagctaaaggaacaatactctacttccctggcccaatcagaggcagaactgaagcaggtgcagacacttcaggatgagttgcagaaatttctgcaggatcataaagagtttgaaagctggttggaacgatccgagaaagagctggagaacatgcataagggaggcagcagccccgagacccttccctccctgctaaagcggcaaggaagcttctcagaggatgtcatttcccacaaaggagacttgagatttgtgactatctcaggacagaaagtcttggacatggaaaacagttttaaggaaggcaaagaaccatcagaaattggaaacttagtaaaggacaagttgaaggatgcaacagaaagatacactgctctccactcaaagtgtacacgattaggatctcacctgaatatgctgttaggccagtatcatcaattccaaaacagtgctgacagcctgcaggcctggatgcaggcttgtgaggccaacgtggagaagctcctctcagatactgttgcctctgaccctggagttctccaggagcagcttgcaacaacaaagcagttgcaggaggaattggctgagcaccaagtacctgtggaaaaactccaaaaagtagctcgtgacataatggaaattgaaggggagccagccccagaccacaggcatgttcaagaaactacagattccatactcagccacttccaaagcctctcctatagcctggctgagcgatcttctctgctgcagaaagcaattgcccaatctcagagtgtccaggaaagcctggagagcctgttgcagtctattggggaagttgaacaaaacctggaagggaagcaggtgtcatcactctcatcaggagtcatccaggaagccttagccacaaatatgaaattgaagcaggacattgctcggcaaaagagcagcttggaggccacccgtgagatggtgacccgattcatggagacagcagacagtactacagcagcagtgctgcagggcaaactggcagaggtgagccagcggttcgaacagctctgtctacagcagcaagaaaaggagagctccctaaagaagcttctaccccaggcagagatgtttgaacacctctctggtaagctgcagcagttcatggaaaacaaaagtcggatgctggcctctggaaatcagccagatcaagatattacacatttcttccaacagatccaggagctcaatttggaaatggaagaccaacaggagaacctagatactcttgagcacctggtcactgaactgagctcttgtggctttgcgctggacttgtgccagcatcaggacagggtacagaatctaagaaaagacttcacagagctacagaagacagttaaagagagagagaaagatgcatcatcttgccaggaacagttggatgaattccggaagctggtcaggaccttccagaaatggttgaaagaaactgaagggagtattccacctacggaaacttctatgagtgctaaagagttagaaaagcagattgaacacctgaagagtctactagatgactgggcaagtaagggaactctggtggaagaaatcaattgcaaaggtacttctttagaaaatctcatcatggaaatcacagcacctgattcccaaggcaagacaggttccatactgccctctgtaggaagctctgtaggcagtgtaaacggataccacacctgcaaagatctgacggagatccagtgtgacatgtcagatgtaaacttgaagtatgagaaactagggggagtacttcatgaacgccaggaaagccttcaggctatcctcaacagaatggaggaggttcacaaggaggcaaactctgtgctgcagtggctggaatcaaaagaggaagtcctgaaatccatggatgccatgtcatctccaaccaagacagaaacagtgaaagcccaagctgaatctaacaaggccttcctggctgagttggaacagaattctccaaaaattcaaaaagtaaaggaagccctggctggattactggtgacatatcccaactcacaggaagcagaaaattggaagaaaattcaggaagaactcaattcccgatgggaaagggccactgaggttactgtggctcggcaaaggcagctagaggaatctgcaagtcatctggcctgcttccaggctgcagaatcccagctccggccgtggctgatggagaaagaactgatgatgggagtgctggggcccctgtctattgaccccaacatgttgaatgcacaaaagcaacaggtccagtttatgctaaaggaatttgaagcacgcaggcaacagcatgagcaactgaatgaggcagctcagggcatcctaacaggccctggagatgtctctctgtccaccagccaagtacagaaagaactccagagcatcaatcagaaatgggttgagctgactgacaaactcaactcccgttccagccaaattgaccaagctattgttaagagcacccagtaccaggaactgctccaggacttatcagagaaggtgagggcagttggacaacggctgagtgtccagtcagctatcagcacccaaccagaggctgtaaagcagcaattggaagagaccagtgaaattcgatctgacttggagcagttagaccacgaggttaaggaggctcagacactgtgcgatgaactctcagtgctcattggtgagcagtacctcaaggatgaactgaagaagcgtttggagacagttgccctgcctctccaaggtttagaagaccttgcagccgatcgcattaacagactccaggcagctcttgccagcacccagcagttccagcaaatgtttgatgagttgaggacctggttggatgataaacaaagccagcaagcaaaaaactgcccaatttctgcaaaattggagcggctacagtctcagctacaggagaatgaagagtttcagaaaagtcttaatcaacacagtggctcctatgaggtgattgtggctgaaggggaatctctacttctttctgtacctcctggagaagagaaaaggactctacaaaaccagttggttgagctcaaaaaccattgggaagagcttagtaaaaaaactgcagacagacaatccaggctcaaggattgtatgcagaaagctcagaaatatcagtggcatgtggaagaccttgtgccatggatagaagattgtaaagctaagatgtctgagttgcgagtcactctggatccagtgcagctagagtccagtctcctaagatcaaaggctatgctgaatgaggtggagaagcgccgctccctgctggaaatattgaatagtgctgctgacattctgatcaattcttcagaagcagatgaggatggaatccgggatgagaaggctgggatcaaccagaacatggatgctgttacagaagagctgcaggccaaaacagggtcactcgaagaaatgactcagaggctcagggagttccaggaaagctttaagaatattgaaaagaaggttgaaggagccaaacaccaacttgagatctttgatgctctgggttctcaagcctgtagcaacaagaacctggagaagctaagagctcaacaggaagtgctgcaggccctagagcctcaggtagactatctgaggaactttactcagggtctggtagaagatgccccagatggatctgatgcttctcaacttctccaccaagctgaggtcgcccagcaagagttcctcgaagttaagcaaagagtgaacagtggttgtgtgatgatggaaaacaagctggaggggattggccagtttcactgccgggtccgagagatgttctctcaattggcagacctggatgatgagctagatggcatgggtgctattggcagagacactgatagcctccagtcccaaatcgaggatgtccggctattccttaacaaaattcacgtcctcaaattagacatagaggcctctgaagcagagtgtcgacatatgctagaagaagaggggactctggatttgttaggtctcaaaagggagctagaagccctgaacaaacagtgtggcaaactgacagagagggggaaagctcgtcaggaacagctggaactgacactaggccgtgtagaggacttctacaggaaattgaaaggactcaatgacgcgaccacagcagcagaggaggcagaggccctccagtgggtagtggggaccgaagtggaaatcatcaaccaacaattagcagattttaaaatgtttcagaaagaacaagtggatcctcttcagatgaaattgcagcaggtgaatggacttggccagggattaattcagagtgcaggaaaagactgtgatgtacagggtttagaacatgacatggaagagatcaatgctcgatggaatacattgaataaaaaggtcgcacaaagaattgcacagctacaggaagctttgttgcattgtgggaagtttcaagatgccttggagccattgctcagctggttggcagataccgaggagctcatagccaatcagaaacctccatctgctgagtataaagtggtgaaagcacagatccaagaacagaagttgctccagcggctcctagatgatcgaaaggccacagtagacatgcttcaagcagaaggaggcagaatagcccagtcagcagagctggctgatagagagaaaatcactggacagctggagagtcttgaaagtagatggactgaactactcagtaaggcagcagccaggcaaaaacagctggaagacatcctggttctggccaaacagttccatgagacagctgagcctatttctgacttcttatctgtcacagagaaaaagcttgctaactcagaacctgttggcactcagactgccaaaatacagcagcagatcattcggcacaaggctctggaagaagacatagaaaaccatgcaacagatgtgcaccaggcagtcaaaattgggcagtccctctcctccctgacatctcctgcagaacagggtgtgctgtcagaaaagatagactcattgcaggcccgatacagtgaaattcaagaccgctgttgtcggaaggcagccctacttgaccaagctctgtctaatgctaggctgtttggggaggatgaggtggaggtgctcaactggctggctgaggttgaggacaagctcagttcagtgttcgtaaaggatttcaaacaggatgtcctgcacaggcagcatgctgaccacctggctttaaatgaagaaattgttaatagaaagaagaatgtagatcaagctattaaaaatggtcaggctcttctaaaacaaaccacaggtgaggaggtgttacttatccaggaaaaactagatggtataaagactcgttacgcagacatcacagttactagctccaaggccctcagaactttagagcaagcccggcagctggccaccaagttccagtctacttatgaggaactgaccgggtggctgagggaggtggaggaggagctggcaaccagtggaggacagtctcccacaggggaacagataccccagtttcagcagagacagaaggaattaaagaaggaggtcatggagcacaggctggtgttggacacagtgaatgaggtgagccgtgctctcttagagctggtgccctggagagccagagaagggctggataaacttgtgtccgatgctaacgagcagtacaaactagtcagtgacactattggacaaagggtggatgaaattgatgctgctattcagagatcacaacagtatgagcaagctgccgatgcagaactagcttgggttgctgaaacaaaacggaaactgatggctctgggtccaattcgcctggaacaggaccagaccacagctcagcttcaggtacagaaggctttctccattgacattattcgacacaaagattcaatggatgaactcttcagtcaccgtagtgaaatctttggcacatgtggggaggagcaaaaaactgtattacaggaaaagacagagtctctaatacagcaatatgaagccattagcctactcaattcagagcgttatgcccgcctagagcgggcccaggtcttagtaaaccagttttgggaaacttatgaagagctcagcccctggattgaggaaactcgggcactaatagcacagttaccctctccagccattgatcatgagcagctcaggcagcaacaagaggaaatgaggcaattaagggaatctattgctgaacacaaacctcatattgacaaactactaaagataggcccacaactaaaggaattaaaccctgaggaaggggaaatggtggaagaaaaataccagaaagcagaaaacatgtatgcccaaataaaggaggaggtgcgccagcgagccctggctctggatgaagccgtgtcccagtccacacagattacagagtttcatgataaaattgagcctatgttggagacactggagaatctttcctctcgcctgcgtatgccaccactgatccctgctgaagtagacaagatcagagagtgcatcagtgacaataagagtgccaccgtggagctagaaaaactgcagccatcctttgaggccttgaagcgccgtggagaggagcttattggacgatctcagggagcagacaaggatctggctgcaaaagaaatccaggataaattggatcaaatggtattcttctgggaggacatcaaagctcgggctgaagaacgagaaatcaaatttcttgatgtccttgaattagcagagaagttctggtatgacatggcagctctcctgaccaccatcaaagacacccaggatattgtccatgacttggaaagcccaggcattgatccttccatcatcaaacaacaggttgaagctgctgagactattaaggaagagacagatggtctgcatgaagagctggagtttattcggatccttggagcagatttgatttttgcctgtggagaaactgagaagcctgaagtgaggaagagcattgatgagatgaataatgcttgggagaacttaaacaaaacatggaaagagaggctagaaaaacttgaggatgctatgcaagctgctgtgcagtatcaggacactcttcaggctatgtttgactggctagataacactgtgattaaactctgcaccatgccccctgttggcactgacctcaatactgttaaagatcagttaaatgaaatgaaggagttcaaagtagaagtttaccaacagcaaattgagatggagaagcttaatcaccagggtgaactgatgttaaagaaagctactgatgagacggacagagacattatacgagaaccactgacagaactcaaacacctctgggagaacctgggtgagaaaattgcccaccgacagcacaaactagaaggggctctgttggcccttggtcagttccagcatgccttagaggaactaatgagttggctgactcataccgaagagttgttagatgctcagagaccaataagtggagacccaaaagtcattgaagttgagctcgcaaagcaccatgtcctaaaaaatgatgttttggctcatcaagccacagtggaaacagtcaacaaagctggcaatgagcttcttgaatccagtgctggagatgatgccagcagcttaaggagccgtttggaagccatgaaccaatgctgggagtcagtgttacagaaaacagaggagagggagcagcagcttcagtcaactctgcagcaggcccagggcttccacagtgaaattgaagatttcctcttggaacttactagaatggagagccagctttctgcatctaagcccacaggaggacttcctgaaactgctagggaacagcttgatacacatatggaactctattcccagctgaaagccaaggaagagacttataatcaactacttgacaagggcagactcatgcttctaagccgtgacgactctgggtctggctccaagacagaacagagtgtagcacttttggagcagaagtggcatgtggtcagcagtaagatggaagaaagaaagtcaaagctggaagaggccctcaacttggcaacagaattccagaattccctacaagaatttatcaactggctcactctagcagagcagagtttaaacatcgcttctccaccaagcctgattctaaatactgtcctttcccagatagaagagcacaaggtttttgctaatgaagtaaatgctcatcgagaccagatcattgagctggatcaaactgggaatcaattaaagttccttagccaaaagcaggatgttgttctgatcaagaatttgttggtgagcgtgcagtctcgatgggagaaggttgtccagcgatctattgaaagagggcgatcactagatgatgccaggaagcgggcaaaacaattccatgaagcttggaaaaaactgattgactggctagaagatgcagagagtcacctggactcagaactagagatatccaatgacccagacaaaattaaacttcagctttctaagcataaggagtttcagaagactcttggtggcaagcagcctgtgtatgataccacaattagaactggcagagcactgaaagaaaagactttgcttcccgaagatagtcagaaacttgacaatttcctaggagaagtcagagacaaatgggatactgtttgtggcaagtctgtggagcggcagcacaagttggaggaagccctgctcttttcgggtcagttcatggatgctttgcaggcattggttgactggttatacaaggtggagccacagctggctgaggaccagcccgtgcacggggaccttgacctcgtcatgaacctcatggatgcacacaaggttttccagaaggaactgggaaagcgaacaggaaccgttcaggtcctgaagcggtcaggccgagagctgattgagaatagtcgagatgacaccacttgggtaaaaggacagctccaggaactgagcactcgctgggacactgtctgtaaactctctgtttccaaacaaagccggcttgagcaggccttaaaacaagcggaagtgtttcgagacacagtccacatgctgttggagtggctttctgaagcagagcaaacgcttcgctttcggggagcacttcctgatgacacagaggccctgcagtctctcattgacacccataaggaattcatgaagaaagtagaagaaaagcgagtggacgttaactcagcagtagccatgggagaagtcatcctggctgtctgccaccccgattgcatcacaaccatcaaacactggatcaccatcatccgagctcgcttcgaggaggtcctgacatgggctaagcagcaccagcagcgtcttgaaacggccttgtcagaactggtggctaatgctgagctcctggaagaacttctggcatggatccagtgggctgagaccaccctcattcagcgggatcaggagccaatcccgcagaacattgaccgagttaaagcccttatcgctgagcatcagacatttatggaggagatgactcgcaaacagcctgacgtggaccgggtcaccaagacatacaaaaggaaaaacatagagcctactcacgcgcctttcatagagaaatcccgcagcggaggcaggaaatccctaagtcagccaacccctcctcccatgccaatcctttcacagtctgaagcaaaaaacccacggatcaaccagctttctgcccgctggcagcaggtgtggctgttagcactggagcggcaaaggaaactgaatgatgccttggatcggctggaggagttgaaagaatttgccaactttgactttgatgtctggaggaaaaagtatatgcgttggatgaatcacaaaaagtctcgagtgatggatttcttccggcgcattgataaggaccaggatgggaagataacacgtcaggagtttatcgatggcattttagcatccaagttccccaccaccaagttagagatgactgctgtggctgacattttcgaccgagatggggatggttacattgattattatgaatttgtggctgctcttcatcccaacaaggatgcgtatcgaccaacaaccgatgcagataaaatcgaagatgaggttacaagacaagtggctcagtgcaaatgtgcaaaaaggtttcaggtggagcagatcggagagaataaataccggtttggggattctcagcagttgcggctggtccgtattctgcgcagcaccgtgatggttcgcgttggtggaggatggatggccttggatgaatttttagtgaaaaatgatccctgccgagcacgaggtagaactaacattgaacttagagagaaattcatcctaccagagggagcatcccagggaatgacccccttccgctcacggggtcgaaggtccaaaccatcttcccgggcagcttcccctactcgttccagctccagtgctagtcagagtaaccacagctgtacatccatgccatcttctccagccaccccagccagtggaaccaaggttatcccatcatcaggtagcaagttgaaacgaccaacaccaacttttcattctagtcggacatcccttgctggtgataccagcaatagttcttccccggcctccacaggtgccaaaactaatcgggcagaccctaaaaagtctgccagtcgccctgggagtcgggctgggagtcgagccgggagtcgagccagcagccggcgaggaagtgacgcttctgactttgacctcttagagacgcagtctgcttgttccgacacttcagaaagcagcgctgcagggggccaaggcaactccaggagagggctaaacaaaccttccaaaatcccaaccatgtctaagaagaccaccactgcctcccccaggactccaggtcccaagcgataacactgtctaagcacccccaagccactatccactttgaatcctgctccatacattgggtgtatatttattctgaacgggagaagttatattgttaaaagtgtaaaagaataattgtgttatgaagctgccttattttttttctttttgtaagttactattttcatgtgaatatttatgtagataaaatttgcctcctggtaaccctgtaatggatggggcccagaaatgaaatatttgagaaaaacaagtgaaaaggtcaagatacaaatgtgtattaaaaaaaaaaaagcctattaatagggtttctgcgcggtgcagggttgtaaacctgctttatcttttaggattattcctaaatgcatcttctttataaacttgacttgctatctcagcaagataaattatattaaaaaaataagaatcctgcagtgtttaaggaactctttttttgtaaatcacggacacctcaattagcaagaactgaggggagggctttttccattgtttaatgttttgtgatttttagctaaagagagggaacctcatctaagtaacatttgcacatgatacagcaaaaggagttcattgcaatactgtctttggatattgtttcagtactgggtgtttaaaggacaaatagctgctagaattcaggggtaaatgtaagtgttcagaaaacgtcagaacatttggggttttaaactgatttgttgctccctatccagcctagacaccagtaactcttgtgttcaccaggacccagacccttggcaagggataggctcgttggtgacattgtgaatttcagatttgttttatccactttttttgctatttatttaaatggtcgatcaacttcccacaaactgaggaatgaattccacgagcctgttctgaaaatgtggacgtaagacaaacacgtgctcgtcctttaatggagttcaccagcacacttgttaaccagtcctgtttgctttcgtctttttttgtgcgtaataaagtcaactgaccaagtgaccatgaaaaggggctgtctggggctcctgttttttagctgctgttcttcagctccgaccatgttgctgtgtgattatctcaattggttttaattgaggcagaaactgaagctctaccaatgaactgtttagaaacaagacacacttttgtattaaaattgcttgcagtaacaaatattttgtatttcctgattttcttttcaactattaccttatctataaatgttaccctggggtataatcatgttgtaggtacttaaatgcattccgcaaatcaaaatatcttgatggataaattatagagcttaatagatcttgttttatttcaaaaaaaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:23499 -> Molecular function: GO:0003779 [actin binding] evidence: IDA
            GeneID:23499 -> Molecular function: GO:0005509 [calcium ion binding] evidence: NAS
            GeneID:23499 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:23499 -> Molecular function: GO:0008017 [microtubule binding] evidence: NAS
            GeneID:23499 -> Molecular function: GO:0016887 [ATPase activity] evidence: ISS
            GeneID:23499 -> Molecular function: GO:0051015 [actin filament binding] evidence: NAS
            GeneID:23499 -> Biological process: GO:0001707 [mesoderm formation] evidence: IEA
            GeneID:23499 -> Biological process: GO:0006200 [ATP catabolic process] evidence: ISS
            GeneID:23499 -> Biological process: GO:0006620 [posttranslational protein targeting to membrane] evidence: IEA
            GeneID:23499 -> Biological process: GO:0006928 [cellular component movement] evidence: IEA
            GeneID:23499 -> Biological process: GO:0007050 [cell cycle arrest] evidence: IEA
            GeneID:23499 -> Biological process: GO:0007163 [establishment or maintenance of cell polarity] evidence: IEA
            GeneID:23499 -> Biological process: GO:0008150 [biological_process] evidence: ND
            GeneID:23499 -> Biological process: GO:0010632 [regulation of epithelial cell migration] evidence: ISS
            GeneID:23499 -> Biological process: GO:0016055 [Wnt receptor signaling pathway] evidence: IEA
            GeneID:23499 -> Biological process: GO:0030177 [positive regulation of Wnt receptor signaling pathway] evidence: ISS
            GeneID:23499 -> Biological process: GO:0032886 [regulation of microtubule-based process] evidence: IMP
            GeneID:23499 -> Biological process: GO:0042060 [wound healing] evidence: ISS
            GeneID:23499 -> Biological process: GO:0043001 [Golgi to plasma membrane protein transport] evidence: IDA
            GeneID:23499 -> Biological process: GO:0051893 [regulation of focal adhesion assembly] evidence: ISS
            GeneID:23499 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:23499 -> Cellular component: GO:0005737 [cytoplasm] evidence: ISS
            GeneID:23499 -> Cellular component: GO:0005794 [Golgi apparatus] evidence: IDA
            GeneID:23499 -> Cellular component: GO:0005856 [cytoskeleton] evidence: NAS
            GeneID:23499 -> Cellular component: GO:0005874 [microtubule] evidence: IDA
            GeneID:23499 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
            GeneID:23499 -> Cellular component: GO:0015629 [actin cytoskeleton] evidence: IEA
            GeneID:23499 -> Cellular component: GO:0032587 [ruffle membrane] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.