Home |
Help |
Advanced search
2024-04-24 20:28:14, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_007111 2651 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens transcription factor Dp-1 (TFDP1), transcript variant
1, mRNA.
ACCESSION NM_007111
VERSION NM_007111.4 GI:219842208
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2651)
AUTHORS Pelka,P., Miller,M.S., Cecchini,M., Yousef,A.F., Bowdish,D.M.,
Dick,F., Whyte,P. and Mymryk,J.S.
TITLE Adenovirus E1A directly targets the E2F/DP-1 complex
JOURNAL J. Virol. 85 (17), 8841-8851 (2011)
PUBMED 21715488
REMARK GeneRIF: The authors demonstrate that adenovirus E1A binds to
E2F/DP-1 complexes through a direct interaction with DP-1 and may
selectively activate a subset of E2F-regulated cellular genes
during infection.
REFERENCE 2 (bases 1 to 2651)
AUTHORS Arakawa,T., Masuhiro,Y., Kamiya,Y., Kojima,H. and Hanazawa,S.
TITLE Identification of significant regions of transcription factor DP-1
(TFDP-1) involved in stability/instability of the protein
JOURNAL Biochem. Biophys. Res. Commun. 397 (2), 345-349 (2010)
PUBMED 20513349
REMARK GeneRIF: the DP-1 'Stabilon' domain was a C-terminal acidic motif
and was quite important for DP-1 stability.
REFERENCE 3 (bases 1 to 2651)
AUTHORS Cunningham,J.M., Vierkant,R.A., Sellers,T.A., Phelan,C.,
Rider,D.N., Liebow,M., Schildkraut,J., Berchuck,A., Couch,F.J.,
Wang,X., Fridley,B.L., Gentry-Maharaj,A., Menon,U., Hogdall,E.,
Kjaer,S., Whittemore,A., DiCioccio,R., Song,H., Gayther,S.A.,
Ramus,S.J., Pharaoh,P.D. and Goode,E.L.
CONSRTM Ovarian Cancer Association Consortium
TITLE Cell cycle genes and ovarian cancer susceptibility: a tagSNP
analysis
JOURNAL Br. J. Cancer 101 (8), 1461-1468 (2009)
PUBMED 19738611
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
REFERENCE 4 (bases 1 to 2651)
AUTHORS Melchor,L., Saucedo-Cuevas,L.P., Munoz-Repeto,I.,
Rodriguez-Pinilla,S.M., Honrado,E., Campoverde,A., Palacios,J.,
Nathanson,K.L., Garcia,M.J. and Benitez,J.
TITLE Comprehensive characterization of the DNA amplification at 13q34 in
human breast cancer reveals TFDP1 and CUL4A as likely candidate
target genes
JOURNAL Breast Cancer Res. 11 (6), R86 (2009)
PUBMED 19995430
REMARK GeneRIF: 13q34 amplification may be of relevance in tumor
progression of breast cancers by inducing overexpression of CUL4A
and TFDP1, important in cell cycle regulation. These genes were
also overexpressed in non-basal-like tumor samples.
REFERENCE 5 (bases 1 to 2651)
AUTHORS Masuhiro,Y., Kayama,K., Fukushima,A., Baba,K., Soutsu,M.,
Kamiya,Y., Gotoh,M., Yamaguchi,N. and Hanazawa,S.
TITLE SOCS-3 inhibits E2F/DP-1 transcriptional activity and cell cycle
progression via interaction with DP-1
JOURNAL J. Biol. Chem. 283 (46), 31575-31583 (2008)
PUBMED 18687693
REMARK GeneRIF: SOCS-3 acts as a negative regulator of the cell cycle
progression under E2F/DP-1 control by interfering with heterodimer
formation between DP-1 and E2F
REFERENCE 6 (bases 1 to 2651)
AUTHORS Zhang,Y., Venkatraj,V.S., Fischer,S.G., Warburton,D. and
Chellappan,S.P.
TITLE Genomic cloning and chromosomal assignment of the E2F dimerization
partner TFDP gene family
JOURNAL Genomics 39 (1), 95-98 (1997)
PUBMED 9027491
REFERENCE 7 (bases 1 to 2651)
AUTHORS Hijmans,E.M., Voorhoeve,P.M., Beijersbergen,R.L., van 't Veer,L.J.
and Bernards,R.
TITLE E2F-5, a new E2F family member that interacts with p130 in vivo
JOURNAL Mol. Cell. Biol. 15 (6), 3082-3089 (1995)
PUBMED 7760804
REFERENCE 8 (bases 1 to 2651)
AUTHORS Wu,C.L., Zukerberg,L.R., Ngwu,C., Harlow,E. and Lees,J.A.
TITLE In vivo association of E2F and DP family proteins
JOURNAL Mol. Cell. Biol. 15 (5), 2536-2546 (1995)
PUBMED 7739537
REFERENCE 9 (bases 1 to 2651)
AUTHORS Beijersbergen,R.L., Kerkhoven,R.M., Zhu,L., Carlee,L.,
Voorhoeve,P.M. and Bernards,R.
TITLE E2F-4, a new member of the E2F gene family, has oncogenic activity
and associates with p107 in vivo
JOURNAL Genes Dev. 8 (22), 2680-2690 (1994)
PUBMED 7958925
REFERENCE 10 (bases 1 to 2651)
AUTHORS Ginsberg,D., Vairo,G., Chittenden,T., Xiao,Z.X., Xu,G.,
Wydner,K.L., DeCaprio,J.A., Lawrence,J.B. and Livingston,D.M.
TITLE E2F-4, a new member of the E2F transcription factor family,
interacts with p107
JOURNAL Genes Dev. 8 (22), 2665-2679 (1994)
PUBMED 7958924
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from BC011685.2 and AL442125.13.
This sequence is a reference standard in the RefSeqGene project.
On Jan 9, 2009 this sequence version replaced gi:34147667.
Summary: This gene encodes a member of a family of transcription
factors that heterodimerize with E2F proteins to enhance their
DNA-binding activity and promote transcription from E2F target
genes. The encoded protein functions as part of this complex to
control the transcriptional activity of numerous genes involved in
cell cycle progression from G1 to S phase. Alternative splicing
results in multiple transcript variants. Pseudogenes of this gene
are found on chromosomes 1, 15, and X.[provided by RefSeq, Jan
2009].
Transcript Variant: This variant (1) represents the longer
transcript.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BC011685.2 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025083, ERS025084 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-1670 BC011685.2 1-1670
1671-2651 AL442125.13 176205-177185
FEATURES Location/Qualifiers
source 1..2651
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="13"
/map="13q34"
gene 1..2651
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/note="transcription factor Dp-1"
/db_xref="GeneID:7027"
/db_xref="HGNC:11749"
/db_xref="HPRD:01792"
/db_xref="MIM:189902"
exon 1..148
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/inference="alignment:Splign:1.39.8"
exon 149..224
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/inference="alignment:Splign:1.39.8"
variation 179
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="c"
/db_xref="dbSNP:377460213"
misc_feature 192..194
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/note="upstream in-frame stop codon"
variation 205
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:139759728"
CDS 213..1445
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/note="E2F dimerization partner 1; DRTF1-polypeptide 1;
E2F-related transcription factor"
/codon_start=1
/product="transcription factor Dp-1"
/protein_id="NP_009042.1"
/db_xref="GI:6005900"
/db_xref="CCDS:CCDS9538.1"
/db_xref="GeneID:7027"
/db_xref="HGNC:11749"
/db_xref="HPRD:01792"
/db_xref="MIM:189902"
/translation="
MAKDAGLIEANGELKVFIDQNLSPGKGVVSLVAVHPSTVNPLGKQLLPKTFGQSNVNIAQQVVIGTPQRPAASNTLVVGSPHTPSTHFASQNQPSDSSPWSAGKRNRKGEKNGKGLRHFSMKVCEKVQRKGTTSYNEVADELVAEFSAADNHILPNESAYDQKNIRRRVYDALNVLMAMNIISKEKKEIKWIGLPTNSAQECQNLEVERQRRLERIKQKQSQLQELILQQIAFKNLVQRNRHAEQQASRPPPPNSVIHLPFIIVNTSKKTVIDCSISNDKFEYLFNFDNTFEIHDDIEVLKRMGMACGLESGSCSAEDLKMARSLVPKALEPYVTEMAQGTVGGVFITTAGSTSNGTRFSASDLTNGADGMLATSSNGSQYSGSRVETPVSYVGEDDEEDDDFNENDEDD
"
misc_feature 216..218
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/experiment="experimental evidence, no additional details
recorded"
/note="N-acetylalanine; propagated from
UniProtKB/Swiss-Prot (Q14186.1); acetylation site"
misc_feature 219..221
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/experiment="experimental evidence, no additional details
recorded"
/note="N6-acetyllysine; propagated from
UniProtKB/Swiss-Prot (Q14186.1); acetylation site"
misc_feature 279..281
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q14186.1); phosphorylation site"
misc_feature 279..281
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 558..>752
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/note="E2F/DP family winged-helix DNA-binding domain;
Region: E2F_TDP; pfam02319"
/db_xref="CDD:202203"
misc_feature 693..797
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14186.1);
Region: DEF box"
misc_feature 810..1241
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/note="Transcription factor DP; Region: DP; pfam08781"
/db_xref="CDD:192151"
misc_feature 822..1043
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14186.1);
Region: Dimerization (Potential)"
misc_feature 843..1193
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14186.1);
Region: Enhances binding of RB protein to E2F"
misc_feature 852..950
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14186.1);
Region: DCB1"
misc_feature 987..1157
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14186.1);
Region: DCB2"
exon 225..291
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/inference="alignment:Splign:1.39.8"
variation 227
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:4150730"
variation 245
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:4150731"
variation 256
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:200455628"
variation 284
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:144432965"
exon 292..398
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/inference="alignment:Splign:1.39.8"
variation 293
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:139600212"
variation 297
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="g"
/replace="t"
/db_xref="dbSNP:145127789"
variation 305
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:376309894"
variation 311
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:147153953"
variation 312
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:201938481"
variation 327
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:372043898"
variation 334
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:140523394"
variation 335
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:201563015"
variation 338
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:4150756"
STS 343..1733
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/db_xref="UniSTS:486219"
variation 355
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:374939623"
variation 371
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="g"
/db_xref="dbSNP:151229785"
variation 374..375
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace=""
/replace="c"
/db_xref="dbSNP:34781189"
variation 376
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:140385325"
exon 399..520
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/inference="alignment:Splign:1.39.8"
variation 428
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:149994612"
variation 478
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:146546392"
variation 518
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:188801002"
exon 521..686
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/inference="alignment:Splign:1.39.8"
variation 584
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:141171684"
variation 623
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:145060973"
variation 658
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:199968505"
variation 659
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="g"
/db_xref="dbSNP:138846629"
variation 660
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:371385894"
exon 687..830
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/inference="alignment:Splign:1.39.8"
variation 690
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:367915991"
variation 692
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:200482856"
variation 716
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:374253994"
variation 740
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:200930289"
variation 776
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:4150788"
variation 806
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:200042404"
exon 831..899
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/inference="alignment:Splign:1.39.8"
variation 836
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:201627059"
variation 839
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="c"
/db_xref="dbSNP:61729944"
variation 846
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:373197629"
variation 875
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:143750751"
exon 900..1051
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/inference="alignment:Splign:1.39.8"
variation 917
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:369104225"
variation 921
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="g"
/db_xref="dbSNP:368780494"
variation 940
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:148175670"
variation 941
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:4150806"
variation 959
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="g"
/db_xref="dbSNP:372891699"
variation 965
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:201874910"
variation 984
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:199966137"
variation 1001
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:200050514"
variation 1004
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:202144389"
variation 1028
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:150730789"
variation 1032
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="t"
/db_xref="dbSNP:201312901"
exon 1052..1218
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/inference="alignment:Splign:1.39.8"
variation 1109
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:137909568"
variation 1134
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:143376685"
variation 1145
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:147172256"
variation 1160
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:140379028"
variation 1183
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:368176674"
variation 1194
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:149728583"
variation 1211
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:144543834"
variation 1212
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:148494753"
exon 1219..1297
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/inference="alignment:Splign:1.39.8"
variation 1234
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="c"
/db_xref="dbSNP:199990090"
variation 1244
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:142697119"
variation 1247
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:200035867"
variation 1255
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:372826918"
variation 1259
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:146505939"
variation 1288
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="g"
/replace="t"
/db_xref="dbSNP:200975730"
STS 1296..1476
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/standard_name="RH17637"
/db_xref="UniSTS:16341"
exon 1298..2651
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/inference="alignment:Splign:1.39.8"
variation 1307
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="g"
/db_xref="dbSNP:201411969"
variation 1329
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:372494238"
variation 1342
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:200282402"
variation 1346
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:199691334"
variation 1358
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:375741872"
variation 1360
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="g"
/replace="t"
/db_xref="dbSNP:370888253"
variation 1379
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:377544697"
variation 1387
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:141230527"
variation 1391
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:143555000"
variation 1399
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:146824402"
variation 1403
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:140489086"
variation 1413
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:4150823"
variation 1433
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:374558698"
variation 1447
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:150466630"
STS 1451..1605
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/standard_name="D13S1446"
/db_xref="UniSTS:66510"
variation 1455
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:376532717"
variation 1467
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:113220010"
variation 1480
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:374365132"
variation 1487
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:200563498"
variation 1488
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:370718516"
variation 1511
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="g"
/replace="t"
/db_xref="dbSNP:28624173"
variation 1513
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:182792488"
variation 1536
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:4150824"
variation 1541..1542
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace=""
/replace="c"
/db_xref="dbSNP:34533673"
variation 1561
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:4150825"
variation 1603
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:190739978"
variation 1605
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:4150826"
variation 1618
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:146046782"
variation 1653
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:4150827"
variation 1659
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="t"
/db_xref="dbSNP:371317153"
variation 1671
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="g"
/db_xref="dbSNP:4150828"
variation 1706..1707
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace=""
/replace="t"
/db_xref="dbSNP:375173308"
variation 1709
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="g"
/replace="t"
/db_xref="dbSNP:140024363"
STS 1722..1847
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/standard_name="RH78077"
/db_xref="UniSTS:83967"
variation 1749
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="g"
/replace="t"
/db_xref="dbSNP:11545598"
variation 1773
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace=""
/replace="c"
/db_xref="dbSNP:377596187"
variation 1823
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace=""
/replace="t"
/db_xref="dbSNP:4150829"
variation 1846
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:78345683"
variation 1847
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:75700214"
variation 1848
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="t"
/db_xref="dbSNP:77556813"
variation 1949
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="g"
/replace="t"
/db_xref="dbSNP:371395847"
variation 1972
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace=""
/replace="t"
/db_xref="dbSNP:34438141"
variation 2056
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="g"
/db_xref="dbSNP:4150830"
variation 2138
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:9577597"
STS 2147..2325
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/standard_name="HSC0VG072"
/db_xref="UniSTS:20511"
polyA_signal 2342..2347
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
polyA_site 2367
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
variation 2381
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="t"
/db_xref="dbSNP:183205277"
variation 2510..2511
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace=""
/replace="a"
/db_xref="dbSNP:199853572"
variation 2514..2515
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace=""
/replace="a"
/db_xref="dbSNP:4150831"
polyA_signal 2623..2628
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
polyA_site 2651
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
ORIGIN
cgtcccggcgccactcggcccagggcagggaccccgccacggccgggaccgcccggcccggccccagcccgcgcctctccgcgccgccccgcgctccgcaccgcgccctctccgcgtccccgcccgcgcggccggaccgggcagccagaaaaatcatttttcttctctgggaaggtgaacatttgtagcattgatttcccggatctggtaacatggcaaaagatgccggtctaattgaagccaacggagaactcaaggtcttcatagaccagaaccttagtcccgggaaaggcgtggtgtccctcgtggccgttcacccctccaccgtcaacccgctcgggaagcagctcttgccaaaaacctttggacagtccaatgtcaacattgcccagcaagtggtaattggtacgcctcagagaccggcagcgtcaaacaccctggtggtaggaagcccacacacccccagcactcactttgcctctcagaaccagccttccgactcctcaccttggtctgccgggaagcgcaacaggaaaggagagaagaatggcaagggcctacggcatttctccatgaaggtctgcgagaaggtgcagaggaaagggaccacttcctacaacgaagtggcagacgagctggttgcggagttcagtgctgccgacaaccacatcttaccaaacgagtcagcttatgaccagaaaaacataagacggcgcgtctacgatgccttaaacgtgctaatggccatgaacatcatctccaaggagaagaaggagatcaagtggattggtctgcccaccaactcggctcaggaatgtcagaacttagaggtggaaagacagaggagacttgaaagaataaaacagaaacagtctcaacttcaagaacttattctacagcaaattgccttcaagaacctggtgcagagaaaccggcatgcggagcagcaggccagccggccaccgccacccaactcagtcatccacctgcccttcatcatcgtcaacaccagcaagaagacggtcatcgactgcagcatctccaatgacaaatttgagtatctgtttaattttgacaacacatttgaaatccacgatgacatagaagtgctgaagcggatgggcatggcttgcgggctggagtcggggagctgctctgccgaagaccttaaaatggccagaagtctggtccccaaggctctggagccatacgtgacagaaatggctcagggaactgttggaggcgtgttcatcacgacggcaggttccacgtctaacggcacaaggttctctgccagtgacctgaccaacggtgcagatgggatgctggccacaagctccaatgggtctcagtacagcggctccagggtggagactccggtgtcctacgtcggggaggacgacgaggaggacgatgacttcaacgagaatgacgaggacgactgacgtcctccccacttcagattcggcttcaggaaaacgtttagcgaaaagaaactttttttttaatgtgggttttctgtttccttttggcctactcccaagaagatattggtaagctattgaatttagatatgcacctctgataagcaaggattgtttcccgtaggattaggacgtgctgtggatgtgtgttttgataccagtgtgctgatgcagagcgtttatttacttgttaggattttgtgttttcatttgctatttttctttaagtgcagagttcatttttgcccctgaaaagtttttgctgagtttgctgaagaaattgtatttcaaccacatccatgaaaataaaacacctcctgttgtggatggtgagcccctgatgccgcttatttgccgtgagtttggacggcacccctgctggcggatagcaagactctgtggagtttgttcagtggtacggtgtccaagcaaacagcagaatgcaactttctaaacagccccaagcaaacagcagaattcaactttttaaacaataaacaccatcaaccttattgactttattgtcccttaaattatattgactgttgtgattccatcaagtttgtacactcttttctctccctgttttgcagcaacaaattgcgaagtgcttttgtttgtttgttttcgtttggttaaagcttattgccatgctggtgcggctatggagactgtctggaaggcttggaatggtttattgcttatggtaaaatttgcctgatttcttacaggcagcgtttggaaaccttttattatatagttgtttacatacttataagtctatcatttaaagacatgtactgaaacaaatgtatttgtttcataagcatcttcctgtaatctattataaaattgaaattaaatatagagaatgttttaacaattttttaactcaaaatttgtcaatcatttttaatagttctttttttataaaaagaaaaaggaatttaaggacaggcagtagtctcttttaaaatttattcacaaaacccattaactgcacagttgctattagctgcctgttctaaaacgatagtctttttattgaaacacaaataaacttttctgtaatattttatggtatataaagagactttaattgtttgacttgtttaacttggcactgttagtttttattaataaaacgcgcatgggcattttaaacaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:7027 -> Molecular function: GO:0003677 [DNA binding] evidence: IEA
GeneID:7027 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA
GeneID:7027 -> Molecular function: GO:0003713 [transcription coactivator activity] evidence: TAS
GeneID:7027 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:7027 -> Molecular function: GO:0008134 [transcription factor binding] evidence: IPI
GeneID:7027 -> Molecular function: GO:0019904 [protein domain specific binding] evidence: IPI
GeneID:7027 -> Biological process: GO:0000082 [G1/S transition of mitotic cell cycle] evidence: TAS
GeneID:7027 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: TAS
GeneID:7027 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: TAS
GeneID:7027 -> Biological process: GO:0006357 [regulation of transcription from RNA polymerase II promoter] evidence: TAS
GeneID:7027 -> Biological process: GO:0006367 [transcription initiation from RNA polymerase II promoter] evidence: TAS
GeneID:7027 -> Biological process: GO:0007179 [transforming growth factor beta receptor signaling pathway] evidence: TAS
GeneID:7027 -> Biological process: GO:0008283 [cell proliferation] evidence: TAS
GeneID:7027 -> Biological process: GO:0010467 [gene expression] evidence: TAS
GeneID:7027 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: TAS
GeneID:7027 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
GeneID:7027 -> Cellular component: GO:0005667 [transcription factor complex] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.