2024-04-19 17:58:16, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_006842 2902 bp mRNA linear PRI 08-JUN-2013 DEFINITION Homo sapiens splicing factor 3b, subunit 2, 145kDa (SF3B2), mRNA. ACCESSION NM_006842 XM_290506 VERSION NM_006842.2 GI:55749530 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 2902) AUTHORS Orr,S.J., Boutz,D.R., Wang,R., Chronis,C., Lea,N.C., Thayaparan,T., Hamilton,E., Milewicz,H., Blanc,E., Mufti,G.J., Marcotte,E.M. and Thomas,N.S. TITLE Proteomic and protein interaction network analysis of human T lymphocytes during cell-cycle entry JOURNAL Mol. Syst. Biol. 8, 573 (2012) PUBMED 22415777 REMARK GeneRIF: Inhibiting the induction of two proteins involved in two of the most significantly upregulated cellular processes, ribosome biogenesis (eIF6) and hnRNA splicing (SF3B2/SF3B4), showed that human T cells can enter the cell cycle without growing in size. Publication Status: Online-Only REFERENCE 2 (bases 1 to 2902) CONSRTM Psychiatric GWAS Consortium Bipolar Disorder Working Group TITLE Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4 JOURNAL Nat. Genet. 43 (10), 977-983 (2011) PUBMED 21926972 REMARK Erratum:[Nat Genet. 2012 Sep;44(9):1072. Fullerton, Janice M [added]; Hyoun, Phil L [corrected to Lee, Phil H]; Meng, Fan Guo [corrected to Meng, Fan]] Publication Status: Online-Only REFERENCE 3 (bases 1 to 2902) AUTHORS Terada,Y. and Yasuda,Y. TITLE Human immunodeficiency virus type 1 Vpr induces G2 checkpoint activation by interacting with the splicing factor SAP145 JOURNAL Mol. Cell. Biol. 26 (21), 8149-8158 (2006) PUBMED 16923959 REMARK GeneRIF: Data show that Vpr induces checkpoint activation and G(2) arrest by binding to the CUS1 domain of SAP145 and interfering with the functions of the SAP145 and SAP49 proteins, two subunits of the multimeric splicing factor 3b (SF3b). REFERENCE 4 (bases 1 to 2902) AUTHORS Andersen,J.S., Lam,Y.W., Leung,A.K., Ong,S.E., Lyon,C.E., Lamond,A.I. and Mann,M. TITLE Nucleolar proteome dynamics JOURNAL Nature 433 (7021), 77-83 (2005) PUBMED 15635413 REFERENCE 5 (bases 1 to 2902) AUTHORS Lin,K.T., Lu,R.M. and Tarn,W.Y. TITLE The WW domain-containing proteins interact with the early spliceosome and participate in pre-mRNA splicing in vivo JOURNAL Mol. Cell. Biol. 24 (20), 9176-9185 (2004) PUBMED 15456888 REFERENCE 6 (bases 1 to 2902) AUTHORS Das,B.K., Xia,L., Palandjian,L., Gozani,O., Chyung,Y. and Reed,R. TITLE Characterization of a protein complex containing spliceosomal proteins SAPs 49, 130, 145, and 155 JOURNAL Mol. Cell. Biol. 19 (10), 6796-6802 (1999) PUBMED 10490618 REFERENCE 7 (bases 1 to 2902) AUTHORS Neubauer,G., King,A., Rappsilber,J., Calvio,C., Watson,M., Ajuh,P., Sleeman,J., Lamond,A. and Mann,M. TITLE Mass spectrometry and EST-database searching allows characterization of the multi-protein spliceosome complex JOURNAL Nat. Genet. 20 (1), 46-50 (1998) PUBMED 9731529 REFERENCE 8 (bases 1 to 2902) AUTHORS Agell,N., Aligue,R., Alemany,V., Castro,A., Jaime,M., Pujol,M.J., Rius,E., Serratosa,J., Taules,M. and Bachs,O. TITLE New nuclear functions for calmodulin JOURNAL Cell Calcium 23 (2-3), 115-121 (1998) PUBMED 9601606 REMARK Review article REFERENCE 9 (bases 1 to 2902) AUTHORS Gozani,O., Feld,R. and Reed,R. TITLE Evidence that sequence-independent binding of highly conserved U2 snRNP proteins upstream of the branch site is required for assembly of spliceosomal complex A JOURNAL Genes Dev. 10 (2), 233-243 (1996) PUBMED 8566756 REFERENCE 10 (bases 1 to 2902) AUTHORS Champion-Arnaud,P. and Reed,R. TITLE The prespliceosome components SAP 49 and SAP 145 interact in a complex implicated in tethering U2 snRNP to the branch site JOURNAL Genes Dev. 8 (16), 1974-1983 (1994) PUBMED 7958871 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BF311442.1, BC053577.1, BC014125.2 and BE677116.1. On or before Nov 22, 2004 this sequence version replaced gi:51468749, gi:5803154. Summary: This gene encodes subunit 2 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence-independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. Subunit 2 associates with pre-mRNA upstream of the branch site at the anchoring site. Subunit 2 also interacts directly with subunit 4 of the splicing factor 3b complex. Subunit 2 is a highly hydrophilic protein with a proline-rich N-terminus and a glutamate-rich stretch in the C-terminus. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC000401.2, U41371.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025081, ERS025082 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-33 BF311442.1 2-34 34-2656 BC053577.1 1-2623 2657-2875 BC014125.2 1045-1263 2876-2902 BE677116.1 1-27 c FEATURES Location/Qualifiers source 1..2902 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="11" /map="11q13.1" gene 1..2902 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /note="splicing factor 3b, subunit 2, 145kDa" /db_xref="GeneID:10992" /db_xref="HGNC:10769" /db_xref="HPRD:10410" /db_xref="MIM:605591" exon 1..173 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /inference="alignment:Splign:1.39.8" variation 10 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:376292962" variation 12 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="g" /db_xref="dbSNP:369950115" variation 15 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="g" /replace="t" /db_xref="dbSNP:191044165" variation 27 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="t" /db_xref="dbSNP:370381998" CDS 41..2728 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /note="spliceosome associated protein 145; pre-mRNA splicing factor SF3b 145 kDa subunit; SAP 145; spliceosome-associated protein 145; pre-mRNA-splicing factor SF3b 145 kDa subunit" /codon_start=1 /product="splicing factor 3B subunit 2" /protein_id="NP_006833.2" /db_xref="GI:55749531" /db_xref="CCDS:CCDS31612.1" /db_xref="GeneID:10992" /db_xref="HGNC:10769" /db_xref="HPRD:10410" /db_xref="MIM:605591" /translation="
MATEHPEPPKAELQLPPPPPPGHYGAWAAQELQAKLAEIGAPIQGNREELVERLQSYTRQTGIVLNRPVLRGEDGDKAAPPPMSAQLPGIPMPPPPLGLPPLQPPPPPPPPPPGLGLGFPMAHPPNLGPPPPLRVGEPVALSEEERLKLAQQQAALLMQQEERAKQQGDHSLKEHELLEQQKRAAVLLEQERQQEIAKMGTPVPRPPQDMGQIGVRTPLGPRVAAPVGPVGPTPTVLPMGAPVPRPRGPPPPPGDENREMDDPSVGPKIPQALEKILQLKESRQEEMNSQQEEEEMETDARSSLGQSASETEEDTVSVSKKEKNRKRRNRKKKKKPQRVRGVSSESSGDREKDSTRSRGSDSPAADVEIEYVTEEPEIYEPNFIFFKRIFEAFKLTDDVKKEKEKEPEKLDKLENSAAPKKKGFEEEHKDSDDDSSDDEQEKKPEAPKLSKKKLRRMNRFTVAELKQLVARPDVVEMHDVTAQDPKLLVHLKATRNSVPVPRHWCFKRKYLQGKRGIEKPPFELPDFIKRTGIQEMREALQEKEEQKTMKSKMREKVRPKMGKIDIDYQKLHDAFFKWQTKPKLTIHGDLYYEGKEFETRLKEKKPGDLSDELRISLGMPVGPNAHKVPPPWLIAMQRYGPPPSYPNLKIPGLNSPIPESCSFGYHAGGWGKPPVDETGKPLYGDVFGTNAAEFQTKTEEEEIDRTPWGELEPSDEESSEEEEEEESDEDKPDETGFITPADSGLITPGGFSSVPAGMETPELIELRKKKIEEAMDGSETPQLFTVLPEKRTATVGGAMMGSTHIYDMSTVMSRKGPAPELQGVEVALAPEELELDPMAMTQKYEEHVREQQAQVEKEDFSDMVAEHAAKQKQKKRKAQPQDSRGGSKKYKEFKF
" misc_feature 110..211 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /note="SAP domain; Region: SAP; pfam02037" /db_xref="CDD:202100" misc_feature 863..865 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /experiment="experimental evidence, no additional details recorded" /note="N6-acetyllysine; propagated from UniProtKB/Swiss-Prot (Q13435.2); acetylation site" misc_feature 905..907 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q13435.2); phosphorylation site" misc_feature 905..907 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 944..946 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 947..949 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 959..961 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q13435.2); phosphorylation site" misc_feature 959..961 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 965..967 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q13435.2); phosphorylation site" misc_feature 965..967 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 971..973 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /experiment="experimental evidence, no additional details recorded" /note="Phosphothreonine; propagated from UniProtKB/Swiss-Prot (Q13435.2); phosphorylation site" misc_feature 971..973 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 1118..1120 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q13435.2); phosphorylation site" misc_feature 1124..1126 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q13435.2); phosphorylation site" misc_feature 1124..1126 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 1157..1159 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 1286..1288 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 1331..1333 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q13435.2); phosphorylation site" misc_feature 1331..1333 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 1343..1345 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q13435.2); phosphorylation site" misc_feature 1343..1345 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 1346..1348 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q13435.2); phosphorylation site" misc_feature 1346..1348 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 1445..1831 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /note="Domain of unknown function (DUF382); Region: DUF382; pfam04037" /db_xref="CDD:112836" misc_feature 1841..2017 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /note="proline-rich domain in spliceosome associated proteins; Region: PSP; smart00581" /db_xref="CDD:128850" misc_feature 2372..2374 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 2378..2380 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /experiment="experimental evidence, no additional details recorded" /note="Phosphothreonine; propagated from UniProtKB/Swiss-Prot (Q13435.2); phosphorylation site" misc_feature 2378..2380 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" variation 45 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="c" /db_xref="dbSNP:373935988" variation 46 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:201612918" variation 71 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:367930350" variation 84..85 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="" /replace="gcc" /db_xref="dbSNP:146381373" variation 85..86 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="" /replace="gcc" /db_xref="dbSNP:375458676" variation 111 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:200874226" variation 116 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="g" /replace="t" /db_xref="dbSNP:11554199" variation 162 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="g" /db_xref="dbSNP:143081854" exon 174..220 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /inference="alignment:Splign:1.39.8" variation 199 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="g" /replace="t" /db_xref="dbSNP:147409647" variation 210 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:139140435" exon 221..298 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /inference="alignment:Splign:1.39.8" exon 299..538 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /inference="alignment:Splign:1.39.8" variation 325 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:149964750" variation 371 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:371131684" variation 372 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:35383513" variation 397 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:375671219" variation 413 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="g" /db_xref="dbSNP:376759690" variation 418 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:200336994" variation 429 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:193004542" variation 441 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:145088115" variation 477 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:148622642" variation 481 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="g" /db_xref="dbSNP:368653791" variation 489 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:202101921" variation 502 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:371058741" variation 527 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:143179110" variation 528 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:146650893" exon 539..589 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /inference="alignment:Splign:1.39.8" variation 553 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:201233817" variation 554 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:367819128" variation 574 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:140299928" exon 590..707 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /inference="alignment:Splign:1.39.8" variation 610 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:369236523" variation 643 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:200673814" variation 681 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="g" /replace="t" /db_xref="dbSNP:145310787" exon 708..817 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /inference="alignment:Splign:1.39.8" variation 708 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:372204235" variation 736 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:200330809" variation 743 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:187615832" variation 755 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:374892362" variation 756 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:369029996" variation 770 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="g" /db_xref="dbSNP:201649157" variation 792 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:77713633" exon 818..914 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /inference="alignment:Splign:1.39.8" variation 818 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="c" /db_xref="dbSNP:140538228" variation 887 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:372551951" variation 897 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="c" /db_xref="dbSNP:377557880" exon 915..1006 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /inference="alignment:Splign:1.39.8" variation 934 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:373586694" variation 937 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:150494844" variation 946 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:199702362" variation 964 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:138321636" exon 1007..1222 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /inference="alignment:Splign:1.39.8" variation 1013 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:202042073" variation 1035 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:149628830" variation 1088 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:372078828" variation 1089 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:375183688" variation 1112 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:200930603" variation 1150 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="g" /db_xref="dbSNP:146416948" variation 1154 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:371992470" variation 1177 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:61736588" exon 1223..1360 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /inference="alignment:Splign:1.39.8" variation 1248 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:373114844" variation 1249 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:200450983" variation 1255 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:1049872" variation 1276 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="" /replace="aa" /db_xref="dbSNP:71762974" variation 1298 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:202170202" variation 1306 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="g" /replace="t" /db_xref="dbSNP:11554200" variation 1354 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:143148362" exon 1361..1441 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /inference="alignment:Splign:1.39.8" exon 1442..1669 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /inference="alignment:Splign:1.39.8" variation 1486 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:377200128" variation 1505 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:147477806" variation 1510 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:188972879" variation 1523 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:370412310" STS 1547..1767 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /standard_name="MARC_24069-24070:1030027541:1" /db_xref="UniSTS:268840" variation 1602 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="c" /db_xref="dbSNP:148046619" variation 1606 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:141730568" variation 1622 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:200555928" variation 1628 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:199609387" exon 1670..1819 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /inference="alignment:Splign:1.39.8" variation 1770 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="t" /db_xref="dbSNP:374638942" variation 1804 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:377445541" exon 1820..1909 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /inference="alignment:Splign:1.39.8" variation 1837 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:373128677" variation 1865 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:201553683" variation 1875 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="c" /db_xref="dbSNP:200516150" variation 1889 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:79598943" variation 1901 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:199997051" exon 1910..2017 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /inference="alignment:Splign:1.39.8" variation 1966 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="g" /db_xref="dbSNP:200985249" variation 2005 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:72932689" exon 2018..2125 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /inference="alignment:Splign:1.39.8" variation 2080 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:113220857" variation 2095 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:200458765" exon 2126..2268 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /inference="alignment:Splign:1.39.8" variation 2127 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:373132159" variation 2158 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="g" /db_xref="dbSNP:377754149" variation 2159 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:199621782" variation 2188 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:202184570" variation 2209 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:201734524" variation 2223 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:11554201" exon 2269..2370 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /inference="alignment:Splign:1.39.8" variation 2361 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:373693836" variation 2368 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:139622723" exon 2371..2470 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /inference="alignment:Splign:1.39.8" variation 2409 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:143453448" variation 2443 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:199782165" variation 2469 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:372951764" variation 2470 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:201160612" exon 2471..2656 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /inference="alignment:Splign:1.39.8" variation 2488 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:146187153" variation 2494 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:368254869" variation 2520 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:367937981" variation 2521 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:371699615" variation 2527 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:112398687" variation 2530 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="t" /db_xref="dbSNP:200682390" variation 2584 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:144057362" variation 2599 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:144944219" variation 2611 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="g" /db_xref="dbSNP:11554198" exon 2657..2894 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /inference="alignment:Splign:1.39.8" variation 2691 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:148991018" variation 2704 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="g" /db_xref="dbSNP:1049973" variation 2710 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:369734632" variation 2746 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:200551157" variation 2782 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="g" /db_xref="dbSNP:374003008" variation 2800 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:117837147" variation 2835 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="t" /db_xref="dbSNP:3210005" polyA_signal 2853..2858 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" variation 2865 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="c" /replace="t" /db_xref="dbSNP:190567887" polyA_site 2875 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" polyA_site 2883 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" variation 2891 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" /replace="a" /replace="c" /db_xref="dbSNP:3180573" polyA_site 2894 /gene="SF3B2" /gene_synonym="Cus1; SAP145; SF3b1; SF3B145; SF3b150" ORIGIN
cccagcttccgggttggtcgcgcgccttcctgcggctaagatggcgacggagcatcccgagcctcccaaagcagaattgcagctgccgccgccgccacctccaggccactatggcgcctgggctgcccaggagcttcaggccaagttggcagagatcggagctccgatccagggtaatcgcgaggagctggtggagcggctgcagagctacacccgccagactggcatcgtgctgaatcggccggttttgagaggggaagatggggacaaagccgctccacctcccatgtcggcacagctccctggaattcccatgccaccaccacctttgggactcccccctctgcagcctcctccgccacccccaccacctccaccaggccttggccttggctttcctatggcccacccaccaaatttggggcccccgcctcctctccgtgtgggtgagccagtggcactgtcagaggaggagcggctgaagttggctcagcagcaggcggcattgctgatgcagcaggaggagcgtgccaagcagcagggagatcattcgctgaaggaacatgagctcttggagcagcagaagcgggcagctgtgttactggagcaggaacgacagcaggagattgccaagatgggcaccccagtccctcggcccccacaagacatgggccagattggtgtgcgcactcctctgggtcctcgagtagctgctccagtgggcccagtgggccccactcctacagttttgcccatgggagcccctgttccccggcctcgtggtcccccaccgccccctggagatgagaacagagagatggatgacccctctgtgggccccaagatcccccaggctttggagaagatcctgcagctgaaggagagccgccaggaagagatgaattctcagcaggaggaagaggaaatggaaacagatgctcgctcgtccctgggccagtcagcgtcagagactgaggaggacacagtgtccgtatctaaaaaggagaaaaaccggaagcgtaggaaccgaaagaagaagaaaaagccccagcgggtgcgaggggtgtcctctgagagctctggggaccgggagaaagactcaacccggtcccgtggctctgattccccagcagctgatgttgagattgagtatgtgactgaagaacctgaaatttacgagcccaactttatcttctttaagaggatctttgaggcttttaagctcactgatgatgtgaagaaggagaaagagaaggagccagagaaacttgacaaactggagaactctgcagcccccaagaagaagggatttgaagaggagcacaaggacagtgatgatgacagcagtgatgacgagcaggaaaagaagccagaagcccccaagctgtccaagaagaagttgcgccgaatgaaccgcttcactgtggctgaactcaagcagctggtggctcggcccgatgtcgtggagatgcacgatgtgacagcgcaggaccctaagctcttggttcacctcaaggccactcggaactctgtgcctgtgccacgccactggtgttttaagcgcaaatacctgcagggcaaacggggcattgagaagccccccttcgagctgccagacttcatcaaacgcacaggcatccaggagatgcgagaggccctgcaggagaaggaagaacagaagaccatgaagtcaaaaatgcgagagaaagttcggcctaagatgggcaaaattgacatcgactaccagaaactgcatgatgccttcttcaagtggcagaccaagccaaagctgaccatccatggggacctgtactatgaggggaaggagttcgagacacgactgaaggagaagaagccaggagatctgtctgatgagctaaggatttccttggggatgccagtaggaccaaatgcccacaaggtccctcccccatggctgattgccatgcagcgatatggaccacccccatcgtatcccaacctgaaaatccctgggctgaactcgcccatccctgagagctgttcctttgggtaccatgctggtggctggggcaaacctccagtggatgagactgggaaaccgctctatggggacgtgtttggaaccaatgctgctgaatttcagaccaagactgaggaagaagagattgatcggaccccttggggggaactggaaccatctgatgaagaatcctcagaagaagaggaagaggaagaaagtgatgaagacaaaccagatgagacaggctttattacccctgcagacagtggccttatcactcctggaggcttttcatcagtgcctgctggaatggagacccctgaactcattgagctgaggaagaagaagattgaggaggcgatggacggaagtgagacacctcagctcttcactgtgttgccagagaagagaacagccactgttggaggggccatgatgggatcaacccacatttatgacatgtccacggttatgagccggaagggcccggctcctgagctgcaaggtgtggaagtggcgctggcgcctgaagagttggagctggatcctatggccatgacccagaagtatgaggagcatgtgcgggagcagcaggctcaagtagagaaggaggacttcagtgacatggtggctgagcacgctgccaaacagaagcaaaaaaaacggaaagctcagccccaggacagccgtgggggcagcaagaaatataaggagttcaagttttaggtcccctcacactagccctttttttggccctacgtctggatgcctgggcttcacacaagaaccacctctcccgcagttcccaaggacttgtcatttcatgttcttattttagacctgttttgtaaataaagctgtttcccaaggaaagagatgaatatttaacactaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:10992 -> Molecular function: GO:0003676 [nucleic acid binding] evidence: IEA GeneID:10992 -> Biological process: GO:0000398 [mRNA splicing, via spliceosome] evidence: IC GeneID:10992 -> Biological process: GO:0000398 [mRNA splicing, via spliceosome] evidence: TAS GeneID:10992 -> Biological process: GO:0006397 [mRNA processing] evidence: TAS GeneID:10992 -> Biological process: GO:0008380 [RNA splicing] evidence: TAS GeneID:10992 -> Biological process: GO:0010467 [gene expression] evidence: TAS GeneID:10992 -> Biological process: GO:0019048 [modulation by virus of host morphology or physiology] evidence: IEA GeneID:10992 -> Cellular component: GO:0005634 [nucleus] evidence: IDA GeneID:10992 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS GeneID:10992 -> Cellular component: GO:0005681 [spliceosomal complex] evidence: IDA GeneID:10992 -> Cellular component: GO:0005689 [U12-type spliceosomal complex] evidence: IDA GeneID:10992 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA GeneID:10992 -> Cellular component: GO:0071013 [catalytic step 2 spliceosome] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.