2024-04-25 17:30:41, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_006503 1914 bp mRNA linear PRI 20-APR-2013 DEFINITION Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 4 (PSMC4), transcript variant 1, mRNA. ACCESSION NM_006503 VERSION NM_006503.3 GI:394953925 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1914) AUTHORS Amoroso,M.R., Matassa,D.S., Laudiero,G., Egorova,A.V., Polishchuk,R.S., Maddalena,F., Piscazzi,A., Paladino,S., Sarnataro,D., Garbi,C., Landriscina,M. and Esposito,F. TITLE TRAP1 and the proteasome regulatory particle TBP7/Rpt3 interact in the endoplasmic reticulum and control cellular ubiquitination of specific mitochondrial proteins JOURNAL Cell Death Differ. 19 (4), 592-604 (2012) PUBMED 21979464 REMARK GeneRIF: The proposed TRAP1 network has an impact in vivo, as it is conserved in human colorectal cancers, is controlled by ER-localized TRAP1 interacting with TBP7 and provides a novel model of the ER-mitochondria crosstalk. REFERENCE 2 (bases 1 to 1914) AUTHORS Mojic,M., Mijatovic,S., Maksimovic-Ivanic,D., Dinic,S., Grdovic,N., Miljkovic,D., Stosic-Grujicic,S., Tumino,S., Fagone,P., Mangano,K., Zocca,M.B., Al-Abed,Y., McCubrey,J.A. and Nicoletti,F. TITLE Saquinavir-NO-targeted S6 protein mediates sensitivity of androgen-dependent prostate cancer cells to TRAIL JOURNAL Cell Cycle 11 (6), 1174-1182 (2012) PUBMED 22370480 REMARK GeneRIF: Saquinavir-NO inhibits activation of S6 protein in androgen-dependent prostate cancer cells. REFERENCE 3 (bases 1 to 1914) AUTHORS Molochnikov,L., Rabey,J.M., Dobronevsky,E., Bonucelli,U., Ceravolo,R., Frosini,D., Grunblatt,E., Riederer,P., Jacob,C., Aharon-Peretz,J., Bashenko,Y., Youdim,M.B. and Mandel,S.A. TITLE A molecular signature in blood identifies early Parkinson's disease JOURNAL Mol Neurodegener 7, 26 (2012) PUBMED 22651796 REMARK Publication Status: Online-Only REFERENCE 4 (bases 1 to 1914) AUTHORS Marx,F.P., Soehn,A.S., Berg,D., Melle,C., Schiesling,C., Lang,M., Kautzmann,S., Strauss,K.M., Franck,T., Engelender,S., Pahnke,J., Dawson,S., von Eggeling,F., Schulz,J.B., Riess,O. and Kruger,R. TITLE The proteasomal subunit S6 ATPase is a novel synphilin-1 interacting protein--implications for Parkinson's disease JOURNAL FASEB J. 21 (8), 1759-1767 (2007) PUBMED 17327361 REMARK GeneRIF: a novel specific interaction of synphilin-1 with the regulatory proteasomal protein S6 ATPase (tbp7) in aggresome-like intracytoplasmic inclusions REFERENCE 5 (bases 1 to 1914) AUTHORS Tanahashi,N., Suzuki,M., Fujiwara,T., Takahashi,E., Shimbara,N., Chung,C.H. and Tanaka,K. TITLE Chromosomal localization and immunological analysis of a family of human 26S proteasomal ATPases JOURNAL Biochem. Biophys. Res. Commun. 243 (1), 229-232 (1998) PUBMED 9473509 REFERENCE 6 (bases 1 to 1914) AUTHORS Matoba,R., Okubo,K., Hori,N., Fukushima,A. and Matsubara,K. TITLE The addition of 5'-coding information to a 3'-directed cDNA library improves analysis of gene expression JOURNAL Gene 146 (2), 199-207 (1994) PUBMED 8076819 REFERENCE 7 (bases 1 to 1914) AUTHORS Dubiel,W., Ferrell,K. and Rechsteiner,M. TITLE Tat-binding protein 7 is a subunit of the 26S protease JOURNAL Biol. Chem. Hoppe-Seyler 375 (4), 237-240 (1994) PUBMED 8060531 REFERENCE 8 (bases 1 to 1914) AUTHORS Shaw,D.R. and Ennis,H.L. TITLE Molecular cloning and developmental regulation of Dictyostelium discoideum homologues of the human and yeast HIV1 Tat-binding protein JOURNAL Biochem. Biophys. Res. Commun. 193 (3), 1291-1296 (1993) PUBMED 8323548 REFERENCE 9 (bases 1 to 1914) AUTHORS Ohana,B., Moore,P.A., Ruben,S.M., Southgate,C.D., Green,M.R. and Rosen,C.A. TITLE The type 1 human immunodeficiency virus Tat binding protein is a transcriptional activator belonging to an additional family of evolutionarily conserved genes JOURNAL Proc. Natl. Acad. Sci. U.S.A. 90 (1), 138-142 (1993) PUBMED 8419915 REFERENCE 10 (bases 1 to 1914) AUTHORS Nelbock,P., Dillon,P.J., Perkins,A. and Rosen,C.A. TITLE A cDNA for a protein that interacts with the human immunodeficiency virus Tat transactivator JOURNAL Science 248 (4963), 1650-1653 (1990) PUBMED 2194290 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BI828251.1, AK313183.1 and AC007842.1. On Jul 11, 2012 this sequence version replaced gi:24430156. Summary: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. This gene encodes a member of the triple-A family of ATPases that is a component of the 19S regulatory subunit and plays a role in 26S proteasome assembly. The encoded protein interacts with gankyrin, a liver oncoprotein, and may also play a role in Parkinson's disease through interactions with synphilin-1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]. Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF020736.1, BC014488.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025081, ERS025082 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-158 BI828251.1 1-158 159-1455 AK313183.1 1-1297 1456-1914 AC007842.1 99548-100006 FEATURES Location/Qualifiers source 1..1914 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="19" /map="19q13.11-q13.13" gene 1..1914 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /note="proteasome (prosome, macropain) 26S subunit, ATPase, 4" /db_xref="GeneID:5704" /db_xref="HGNC:9551" /db_xref="HPRD:04085" /db_xref="MIM:602707" exon 1..234 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /inference="alignment:Splign:1.39.8" variation 51 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="a" /replace="g" /db_xref="dbSNP:74704415" variation 79 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="a" /replace="g" /db_xref="dbSNP:113047034" variation 146 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="a" /replace="g" /db_xref="dbSNP:369037676" misc_feature 157..159 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /note="upstream in-frame stop codon" variation 192 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="g" /db_xref="dbSNP:377120872" CDS 199..1455 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /note="isoform 1 is encoded by transcript variant 1; protease 26S subunit 6; Tat-binding protein 7; 26S protease regulatory subunit 6B; MB67-interacting protein; 26S proteasome AAA-ATPase subunit RPT3" /codon_start=1 /product="26S protease regulatory subunit 6B isoform 1" /protein_id="NP_006494.1" /db_xref="GI:5729991" /db_xref="CCDS:CCDS12547.1" /db_xref="GeneID:5704" /db_xref="HGNC:9551" /db_xref="HPRD:04085" /db_xref="MIM:602707" /translation="
MEEIGILVEKAQDEIPALSVSRPQTGLSFLGPEPEDLEDLYSRYKKLQQELEFLEVQEEYIKDEQKNLKKEFLHAQEEVKRIQSIPLVIGQFLEAVDQNTAIVGSTTGSNYYVRILSTIDRELLKPNASVALHKHSNALVDVLPPEADSSIMMLTSDQKPDVMYADIGGMDIQKQEVREAVELPLTHFELYKQIGIDPPRGVLMYGPPGCGKTMLAKAVAHHTTAAFIRVVGSEFVQKYLGEGPRMVRDVFRLAKENAPAIIFIDEIDAIATKRFDAQTGADREVQRILLELLNQMDGFDQNVNVKVIMATNRADTLDPALLRPGRLDRKIEFPLPDRRQKRLIFSTITSKMNLSEEVDLEDYVARPDKISGADINSICQESGMLAVRENRYIVLAKDFEKAYKTVIKKDEQEHEFYK
" misc_feature 199..201 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /experiment="experimental evidence, no additional details recorded" /note="N-acetylmethionine; propagated from UniProtKB/Swiss-Prot (P43686.2); acetylation site" misc_feature 259..261 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (P43686.2); phosphorylation site" misc_feature 280..282 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (P43686.2); phosphorylation site" misc_feature 298..1452 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /note="26S protease regulatory subunit 6B-like protein; Provisional; Region: PTZ00454" /db_xref="CDD:240423" misc_feature 700..1203 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /note="The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009" /db_xref="CDD:99707" misc_feature 814..837 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /note="Walker A motif; other site" /db_xref="CDD:99707" misc_feature order(817..840,1000..1002,1132..1134) /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:99707" misc_feature order(988..1002,1024..1026) /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /note="Walker B motif; other site" /db_xref="CDD:99707" misc_feature 1174..1176 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /note="arginine finger; other site" /db_xref="CDD:99707" misc_feature 1387..1389 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /experiment="experimental evidence, no additional details recorded" /note="N6-acetyllysine; propagated from UniProtKB/Swiss-Prot (P43686.2); acetylation site" misc_feature 1399..1401 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /experiment="experimental evidence, no additional details recorded" /note="N6-acetyllysine; propagated from UniProtKB/Swiss-Prot (P43686.2); acetylation site" variation 220 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="a" /replace="g" /db_xref="dbSNP:202032108" exon 235..333 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /inference="alignment:Splign:1.39.8" variation 259 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="g" /replace="t" /db_xref="dbSNP:149889186" variation 274 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="a" /replace="g" /db_xref="dbSNP:368678447" variation 281 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="t" /db_xref="dbSNP:143871854" variation 283 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="t" /db_xref="dbSNP:11542842" variation 300 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="t" /db_xref="dbSNP:140248429" exon 334..520 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /inference="alignment:Splign:1.39.8" variation 339 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="a" /replace="g" /db_xref="dbSNP:144527056" variation 346 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="g" /replace="t" /db_xref="dbSNP:11542835" variation 378 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="t" /db_xref="dbSNP:11542839" variation 415 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="t" /db_xref="dbSNP:1042989" variation 417 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="g" /db_xref="dbSNP:147840892" variation 420 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="t" /db_xref="dbSNP:35555615" variation 435 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="g" /db_xref="dbSNP:11542841" variation 465 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="t" /db_xref="dbSNP:142604125" variation 504 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="t" /db_xref="dbSNP:11542838" variation 510 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="t" /db_xref="dbSNP:151282645" variation 515 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="t" /db_xref="dbSNP:140491901" exon 521..667 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /inference="alignment:Splign:1.39.8" variation 534 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="t" /db_xref="dbSNP:150414570" variation 555 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="t" /db_xref="dbSNP:138214626" variation 590 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="t" /db_xref="dbSNP:11542836" variation 613 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="t" /db_xref="dbSNP:1061961" variation 653 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="t" /db_xref="dbSNP:369260443" variation 663 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="a" /replace="c" /db_xref="dbSNP:192678537" exon 668..777 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /inference="alignment:Splign:1.39.8" variation 675 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="a" /replace="g" /db_xref="dbSNP:141185060" variation 693 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="a" /replace="g" /db_xref="dbSNP:34344223" variation 699 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="t" /db_xref="dbSNP:139005066" variation 712 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="a" /replace="g" /db_xref="dbSNP:373413671" variation 738 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:11542840" variation 762 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="t" /db_xref="dbSNP:201936053" exon 778..871 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /inference="alignment:Splign:1.39.8" variation 780 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="t" /db_xref="dbSNP:200412097" variation 786 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="t" /db_xref="dbSNP:368343641" variation 794 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="a" /replace="c" /db_xref="dbSNP:372675589" variation 852 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="a" /replace="g" /db_xref="dbSNP:188483172" exon 872..1039 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /inference="alignment:Splign:1.39.8" variation 897 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:11542837" variation 1008 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="t" /db_xref="dbSNP:369564944" variation 1038 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="a" /replace="g" /db_xref="dbSNP:371930483" exon 1040..1116 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /inference="alignment:Splign:1.39.8" variation 1041 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="t" /db_xref="dbSNP:201080278" variation 1056 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="a" /replace="g" /db_xref="dbSNP:376439285" variation 1059 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="a" /replace="g" /db_xref="dbSNP:368985128" variation 1095 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="t" /db_xref="dbSNP:200850108" exon 1117..1285 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /inference="alignment:Splign:1.39.8" variation 1150 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="g" /replace="t" /db_xref="dbSNP:28366821" variation 1154 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="t" /db_xref="dbSNP:370184381" variation 1155 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="a" /replace="g" /db_xref="dbSNP:372534701" variation 1225 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="t" /db_xref="dbSNP:143383599" variation 1261 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="t" /db_xref="dbSNP:376905637" exon 1286..1341 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /inference="alignment:Splign:1.39.8" variation 1323 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="t" /db_xref="dbSNP:1127090" exon 1342..1914 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /inference="alignment:Splign:1.39.8" STS 1355..1568 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /standard_name="STS-T26522" /db_xref="UniSTS:69583" variation 1368 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="t" /db_xref="dbSNP:147156023" variation 1375 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="a" /replace="c" /db_xref="dbSNP:374359098" variation 1377 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="t" /db_xref="dbSNP:140312524" STS 1412..1569 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /standard_name="RH98237" /db_xref="UniSTS:92540" variation 1428 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="t" /db_xref="dbSNP:142681478" variation 1483 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="c" /replace="t" /db_xref="dbSNP:368335326" polyA_signal 1568..1573 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" polyA_site 1591 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" variation 1794 /gene="PSMC4" /gene_synonym="MIP224; RPT3; S6; TBP-7; TBP7" /replace="a" /replace="g" /db_xref="dbSNP:111897642" ORIGIN
tgcgggtacggacagcgcatgagcttatgttgagggcggagcccagaccagcccttcgtcctatcctgcccttccagcacctctcagccgtaacttaaactacacttcccagaagcctcctcagccagggacttccgttgtcgtcagcggaagcggtgacagatcatcccaggccacacagaggccggcttggtcactatggaggagataggcatcttggtggagaaggctcaggatgagatcccagcactgtccgtgtcccggccccagaccggcctgtccttcctgggccctgagcctgaggacctggaggacctgtacagccgctacaagaagctgcagcaagagctggagttcctggaggtgcaggaggaatacatcaaagatgagcaaaagaacctgaaaaaggaatttctccatgcccaggaggaggtgaagcgaatccaaagcatcccgctggtcatcggacaatttctggaggctgtggatcagaatacagccatcgtgggctctaccacaggctccaactattatgtgcgcatcctgagcaccatcgatcgggagctgctcaagcccaacgcctcagtggccctccacaagcacagcaatgcactggtggacgtgctgccccccgaagccgacagcagcatcatgatgctcacctcagaccagaagccagatgtgatgtacgcggacatcggaggcatggacatccagaagcaggaggtgcgggaggccgtggagctcccgctcacgcatttcgagctctacaagcagatcggcatcgatcccccccgaggcgtcctcatgtatggcccacctggctgtgggaagaccatgttggcaaaggcggtggcacatcacacaacagctgcattcatccgggtcgtgggctcggagtttgtacagaagtatctgggtgagggcccccgcatggtccgggatgtgttccgcctggccaaggagaatgcacctgccatcatcttcatagacgagattgatgccatcgccaccaagagattcgatgctcagacaggggccgacagggaggttcagaggatcctgctggagctgctgaatcagatggatggatttgatcagaatgtcaatgtcaaggtaatcatggccacaaacagagcagacaccctggatccggccctgctacggccaggacggctggaccgtaaaattgaatttccacttcctgaccgccgccagaagagattgattttctccactatcactagcaagatgaacctctctgaggaggttgacttggaagactatgtggcccggccagataagatttcaggagctgatattaactccatctgtcaggagagtggaatgttggctgtccgtgaaaaccgctacattgtcctggccaaggacttcgagaaagcatacaagactgtcatcaagaaggacgagcaggagcatgagttttacaagtgacccttcccttccctccaccacaccactcaggggctggggcttctctcgcacccccagcacctctgtcccaaaacctcattcccttttttctttacccaggattggtttcttcaataaatagataagatcgaatccatttaatttcttcttagaagtttaactcctttggagaatgtgggccttgaataggatcctctgggtccctcttaatctgacagatgagcagacgaggtgcatggcctgggttgcagcttgagagaaccaaaatattcaaaccagatgacttccaaaatgtggggaaagggatggaaaatgaacctgagatggagtccttaatcacgggataaagccctgtgcatctccctcatttcctacaggtaaaagacagtaaagaaattcaggtcacaggccttgggagttcataggaaggagatgtccagtgctgtccagtagaacttt
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:5704 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:5704 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA GeneID:5704 -> Molecular function: GO:0016887 [ATPase activity] evidence: TAS GeneID:5704 -> Biological process: GO:0000082 [G1/S transition of mitotic cell cycle] evidence: TAS GeneID:5704 -> Biological process: GO:0000209 [protein polyubiquitination] evidence: TAS GeneID:5704 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: TAS GeneID:5704 -> Biological process: GO:0001824 [blastocyst development] evidence: IEA GeneID:5704 -> Biological process: GO:0002474 [antigen processing and presentation of peptide antigen via MHC class I] evidence: TAS GeneID:5704 -> Biological process: GO:0002479 [antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent] evidence: TAS GeneID:5704 -> Biological process: GO:0006200 [ATP catabolic process] evidence: TAS GeneID:5704 -> Biological process: GO:0006508 [proteolysis] evidence: TAS GeneID:5704 -> Biological process: GO:0006521 [regulation of cellular amino acid metabolic process] evidence: TAS GeneID:5704 -> Biological process: GO:0006915 [apoptotic process] evidence: TAS GeneID:5704 -> Biological process: GO:0006977 [DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest] evidence: TAS GeneID:5704 -> Biological process: GO:0010467 [gene expression] evidence: TAS GeneID:5704 -> Biological process: GO:0016032 [viral process] evidence: TAS GeneID:5704 -> Biological process: GO:0016070 [RNA metabolic process] evidence: TAS GeneID:5704 -> Biological process: GO:0016071 [mRNA metabolic process] evidence: TAS GeneID:5704 -> Biological process: GO:0031145 [anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process] evidence: TAS GeneID:5704 -> Biological process: GO:0034641 [cellular nitrogen compound metabolic process] evidence: TAS GeneID:5704 -> Biological process: GO:0042590 [antigen processing and presentation of exogenous peptide antigen via MHC class I] evidence: TAS GeneID:5704 -> Biological process: GO:0042981 [regulation of apoptotic process] evidence: TAS GeneID:5704 -> Biological process: GO:0043066 [negative regulation of apoptotic process] evidence: TAS GeneID:5704 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS GeneID:5704 -> Biological process: GO:0051436 [negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle] evidence: TAS GeneID:5704 -> Biological process: GO:0051437 [positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle] evidence: TAS GeneID:5704 -> Biological process: GO:0051439 [regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle] evidence: TAS GeneID:5704 -> Cellular component: GO:0000502 [proteasome complex] evidence: TAS GeneID:5704 -> Cellular component: GO:0005634 [nucleus] evidence: IDA GeneID:5704 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS GeneID:5704 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA GeneID:5704 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA GeneID:5704 -> Cellular component: GO:0005739 [mitochondrion] evidence: IDA GeneID:5704 -> Cellular component: GO:0005829 [cytosol] evidence: TAS GeneID:5704 -> Cellular component: GO:0022624 [proteasome accessory complex] evidence: ISS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.