GGRNA Home | Help | Advanced search

2019-03-23 03:58:38, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_006343               3632 bp    mRNA    linear   PRI 07-JUL-2013
DEFINITION  Homo sapiens c-mer proto-oncogene tyrosine kinase (MERTK), mRNA.
ACCESSION   NM_006343
VERSION     NM_006343.2  GI:66932917
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3632)
  AUTHORS   Schlegel,J., Sambade,M.J., Sather,S., Moschos,S.J., Tan,A.C.,
            Winges,A., DeRyckere,D., Carson,C.C., Trembath,D.G., Tentler,J.J.,
            Eckhardt,S.G., Kuan,P.F., Hamilton,R.L., Duncan,L.M., Miller,C.R.,
            Nikolaishvili-Feinberg,N., Midkiff,B.R., Liu,J., Zhang,W., Yang,C.,
            Wang,X., Frye,S.V., Earp,H.S., Shields,J.M. and Graham,D.K.
  TITLE     MERTK receptor tyrosine kinase is a therapeutic target in melanoma
  JOURNAL   J. Clin. Invest. 123 (5), 2257-2267 (2013)
   PUBMED   23585477
  REMARK    GeneRIF: MERTK expression correlates with disease progression in
            metastatic melanomas, primary melanomas, and nevi
REFERENCE   2  (bases 1 to 3632)
  AUTHORS   Garbin,U., Baggio,E., Stranieri,C., Pasini,A., Manfro,S.,
            Mozzini,C., Vallerio,P., Lipari,G., Merigo,F., Guidi,G.,
            Cominacini,L. and Fratta Pasini,A.
  TITLE     Expansion of necrotic core and shedding of Mertk receptor in human
            carotid plaques: a role for oxidized polyunsaturated fatty acids?
  JOURNAL   Cardiovasc. Res. 97 (1), 125-133 (2013)
   PUBMED   22997156
  REMARK    GeneRIF: Oxidized of polyunsaturated fatty acids contained in the
            tissue close to necrotic core of human carotid plaques are strong
            inducers of Adam17, which in turn may cleave the extracellular
            domain of Mertk giving rise to sMer.
REFERENCE   3  (bases 1 to 3632)
  AUTHORS   Fraineau,S., Monvoisin,A., Clarhaut,J., Talbot,J., Simonneau,C.,
            Kanthou,C., Kanse,S.M., Philippe,M. and Benzakour,O.
  TITLE     The vitamin K-dependent anticoagulant factor, protein S, inhibits
            multiple VEGF-A-induced angiogenesis events in a Mer- and
            SHP2-dependent manner
  JOURNAL   Blood 120 (25), 5073-5083 (2012)
   PUBMED   23065156
  REMARK    GeneRIF: The tyrosine kinase receptor MER is activated by PROS and
            mediates its inhibitory effect on VEGF-A-induced EC proliferation.
REFERENCE   4  (bases 1 to 3632)
  AUTHORS   Patin E, Kutalik Z, Guergnon J, Bibert S, Nalpas B, Jouanguy E,
            Munteanu M, Bousquet L, Argiro L, Halfon P, Boland A, Mullhaupt B,
            Semela D, Dufour JF, Heim MH, Moradpour D, Cerny A, Malinverni R,
            Hirsch H, Martinetti G, Suppiah V, Stewart G, Booth DR, George J,
            Casanova JL, Brechot C, Rice CM, Talal AH, Jacobson IM, Bourliere
            M, Theodorou I, Poynard T, Negro F, Pol S, Bochud PY and Abel L.
  CONSRTM   Swiss Hepatitis C Cohort Study Group; International Hepatitis C
            Genetics Consortium; French ANRS HC EP 26 Genoscan Study Group
  TITLE     Genome-wide association study identifies variants associated with
            progression of liver fibrosis from HCV infection
  JOURNAL   Gastroenterology 143 (5), 1244-1252 (2012)
   PUBMED   22841784
  REMARK    GeneRIF: The single nucleotide polymorphisms rs4374383 and
            rs9380516 were linked to the functionally related genes MERTK and
            TULP1, which encode factors involved in phagocytosis of apoptotic
            cells by macrophages.
REFERENCE   5  (bases 1 to 3632)
  AUTHORS   Zizzo,G., Hilliard,B.A., Monestier,M. and Cohen,P.L.
  TITLE     Efficient clearance of early apoptotic cells by human macrophages
            requires M2c polarization and MerTK induction
  JOURNAL   J. Immunol. 189 (7), 3508-3520 (2012)
   PUBMED   22942426
  REMARK    GeneRIF: MerTK expression levels adapt to changing immunologic
            environment, being suppressed in M1 and M2a macrophages and in
            dendritic cells.
REFERENCE   6  (bases 1 to 3632)
  AUTHORS   Weier,H.U., Fung,J. and Lersch,R.A.
  TITLE     Assignment of protooncogene MERTK (a.k.a. c-mer) to human
            chromosome 2q14.1 by in situ hybridization
  JOURNAL   Cytogenet. Cell Genet. 84 (1-2), 91-92 (1999)
   PUBMED   10343112
REFERENCE   7  (bases 1 to 3632)
  AUTHORS   Ling,L., Templeton,D. and Kung,H.J.
  TITLE     Identification of the major autophosphorylation sites of Nyk/Mer,
            an NCAM-related receptor tyrosine kinase
  JOURNAL   J. Biol. Chem. 271 (31), 18355-18362 (1996)
   PUBMED   8702477
REFERENCE   8  (bases 1 to 3632)
  AUTHORS   Mark,M.R., Chen,J., Hammonds,R.G., Sadick,M. and Godowsk,P.J.
  TITLE     Characterization of Gas6, a member of the superfamily of G
            domain-containing proteins, as a ligand for Rse and Axl
  JOURNAL   J. Biol. Chem. 271 (16), 9785-9789 (1996)
   PUBMED   8621659
REFERENCE   9  (bases 1 to 3632)
  AUTHORS   Graham,D.K., Dawson,T.L., Mullaney,D.L., Snodgrass,H.R. and
            Earp,H.S.
  TITLE     Cloning and mRNA expression analysis of a novel human
            protooncogene, c-mer
  JOURNAL   Cell Growth Differ. 5 (6), 647-657 (1994)
   PUBMED   8086340
  REMARK    Erratum:[Cell Growth Differ 1994 Sep;5(9):1022]
REFERENCE   10 (bases 1 to 3632)
  AUTHORS   Iwase,T., Tanaka,M., Suzuki,M., Naito,Y., Sugimura,H. and Kino,I.
  TITLE     Identification of protein-tyrosine kinase genes preferentially
            expressed in embryo stomach and gastric cancer
  JOURNAL   Biochem. Biophys. Res. Commun. 194 (2), 698-705 (1993)
   PUBMED   7688222
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BX474860.1, U08023.1,
            CN371299.1, AL705756.1, CA454601.1, CN371300.1, AC093675.4,
            BM719997.1 and AW627665.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Jun 3, 2005 this sequence version replaced gi:5453737.
            
            Summary: This gene is a member of the MER/AXL/TYRO3 receptor kinase
            family and encodes a transmembrane protein with two fibronectin
            type-III domains, two Ig-like C2-type (immunoglobulin-like)
            domains, and one tyrosine kinase domain. Mutations in this gene
            have been associated with disruption of the retinal pigment
            epithelium (RPE) phagocytosis pathway and onset of autosomal
            recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul
            2008].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: U08023.1, AK316584.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025083, ERS025084 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-34                BX474860.1         2-35
            35-474              U08023.1           50-489
            475-550             CN371299.1         110-185
            551-860             U08023.1           566-875
            861-862             CN371299.1         496-497
            863-941             U08023.1           878-956
            942-943             CN371299.1         577-578
            944-1103            U08023.1           959-1118
            1104-1105           AL705756.1         564-565
            1106-1249           U08023.1           1121-1264
            1250-1251           CA454601.1         640-641
            1252-2004           U08023.1           1267-2019
            2005-2006           CN371300.1         271-272
            2007-2501           U08023.1           2022-2516
            2502-2503           AC093675.4         34928-34929
            2504-2783           U08023.1           2519-2798
            2784-2785           BM719997.1         304-305
            2786-3263           U08023.1           2801-3278
            3264-3632           AW627665.1         1-369               c
FEATURES             Location/Qualifiers
     source          1..3632
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
                     /map="2q14.1"
     gene            1..3632
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /note="c-mer proto-oncogene tyrosine kinase"
                     /db_xref="GeneID:10461"
                     /db_xref="HGNC:7027"
                     /db_xref="MIM:604705"
     exon            1..183
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /inference="alignment:Splign:1.39.8"
     variation       59..60
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:34973298"
     variation       89
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141412373"
     variation       109..110
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:34841018"
     CDS             123..3122
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /EC_number="2.7.10.1"
                     /note="STK kinase; tyrosine-protein kinase Mer; MER
                     receptor tyrosine kinase; proto-oncogene c-Mer; receptor
                     tyrosine kinase MerTK"
                     /codon_start=1
                     /product="tyrosine-protein kinase Mer precursor"
                     /protein_id="NP_006334.2"
                     /db_xref="GI:66932918"
                     /db_xref="CCDS:CCDS2094.1"
                     /db_xref="GeneID:10461"
                     /db_xref="HGNC:7027"
                     /db_xref="MIM:604705"
                     /translation="
MGPAPLPLLLGLFLPALWRRAITEAREEAKPYPLFPGPFPGSLQTDHTPLLSLPHASGYQPALMFSPTQPGRPHTGNVAIPQVTSVESKPLPPLAFKHTVGHIILSEHKGVKFNCSISVPNIYQDTTISWWKDGKELLGAHHAITQFYPDDEVTAIIASFSITSVQRSDNGSYICKMKINNEEIVSDPIYIEVQGLPHFTKQPESMNVTRNTAFNLTCQAVGPPEPVNIFWVQNSSRVNEQPEKSPSVLTVPGLTEMAVFSCEAHNDKGLTVSKGVQINIKAIPSPPTEVSIRNSTAHSILISWVPGFDGYSPFRNCSIQVKEADPLSNGSVMIFNTSALPHLYQIKQLQALANYSIGVSCMNEIGWSAVSPWILASTTEGAPSVAPLNVTVFLNESSDNVDIRWMKPPTKQQDGELVGYRISHVWQSAGISKELLEEVGQNGSRARISVQVHNATCTVRIAAVTRGGVGPFSDPVKIFIPAHGWVDYAPSSTPAPGNADPVLIIFGCFCGFILIGLILYISLAIRKRVQETKFGNAFTEEDSELVVNYIAKKSFCRRAIELTLHSLGVSEELQNKLEDVVIDRNLLILGKILGEGEFGSVMEGNLKQEDGTSLKVAVKTMKLDNSSQREIEEFLSEAACMKDFSHPNVIRLLGVCIEMSSQGIPKPMVILPFMKYGDLHTYLLYSRLETGPKHIPLQTLLKFMVDIALGMEYLSNRNFLHRDLAARNCMLRDDMTVCVADFGLSKKIYSGDYYRQGRIAKMPVKWIAIESLADRVYTSKSDVWAFGVTMWEIATRGMTPYPGVQNHEMYDYLLHGHRLKQPEDCLDELYEIMYSCWRTDPLDRPTFSVLRLQLEKLLESLPDVRNQADVIYVNTQLLESSEGLAQGSTLAPLDLNIDPDSIIASCTPRAAISVVTAEVHDSKPHEGRYILNGGSEEWEDLTSAPSAAVTAEKNSVLPGERLVRNGVSWSHSSMLPLGSSLPDELLFADDSSEGSEVLM
"
     sig_peptide     123..182
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
     mat_peptide     183..3119
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /product="tyrosine-protein kinase Mer"
     misc_feature    453..650
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    711..962
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    717..959
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /note="Second immunoglobulin (Ig)-like domain of Axl/Tyro3
                     receptor tyrosine kinases (RTKs); Region: Ig2_Tyro3_like;
                     cd05749"
                     /db_xref="CDD:143226"
     misc_feature    915..932
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /note="dimerization loop; other site"
                     /db_xref="CDD:143226"
     misc_feature    order(924..932,936..938)
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /note="ligand binding site [chemical binding]; other site"
                     /db_xref="CDD:143226"
     misc_feature    972..1256
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(972..974,1173..1175,1218..1220)
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(1221..1226,1230..1235)
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    1278..1556
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(1479..1481,1524..1526)
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(1527..1532,1536..1541)
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    1638..1700
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q12866.2);
                     transmembrane region"
     misc_feature    1749..1751
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q12866.2); phosphorylation site"
     misc_feature    1920..2669
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /note="Catalytic Domain of Axl-like Protein Tyrosine
                     Kinases; Region: PTKc_Axl_like; cd05035"
                     /db_xref="CDD:133167"
     misc_feature    1923..2666
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /note="Protein tyrosine kinase; Region: Pkinase_Tyr;
                     pfam07714"
                     /db_xref="CDD:203736"
     misc_feature    order(1923..1925,1971..1973,1977..1979,2070..2072,
                     2136..2144,2154..2156,2289..2291,2301..2306,2310..2312,
                     2343..2345,2397..2411,2436..2438,2538..2540)
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /note="active site"
                     /db_xref="CDD:133167"
     misc_feature    order(1923..1925,1971..1973,2070..2072,2136..2144,
                     2154..2156,2289..2291,2301..2306,2310..2312,2343..2345)
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:133167"
     misc_feature    order(2289..2291,2301..2303,2397..2411,2436..2438,
                     2538..2540)
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /note="substrate binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:133167"
     misc_feature    2340..2417
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:133167"
     misc_feature    2367..2369
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphotyrosine, by autocatalysis; propagated from
                     UniProtKB/Swiss-Prot (Q12866.2); phosphorylation site"
     misc_feature    2367..2369
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /citation=[7]
                     /db_xref="HPRD:05269"
     misc_feature    2379..2381
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphotyrosine, by autocatalysis; propagated from
                     UniProtKB/Swiss-Prot (Q12866.2); phosphorylation site"
     misc_feature    2379..2381
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /citation=[7]
                     /db_xref="HPRD:05269"
     misc_feature    2382..2384
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphotyrosine, by autocatalysis; propagated from
                     UniProtKB/Swiss-Prot (Q12866.2); phosphorylation site"
     misc_feature    2382..2384
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /citation=[7]
                     /db_xref="HPRD:05269"
     misc_feature    2925..2927
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q12866.2); phosphorylation site"
     variation       128
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369484994"
     variation       182
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:35898499"
     exon            184..604
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /inference="alignment:Splign:1.39.8"
     variation       220
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144751432"
     variation       224
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143215350"
     variation       229
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150870104"
     variation       230
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367707279"
     variation       245
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144162028"
     variation       300
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:376885459"
     variation       310
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140848545"
     variation       324
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138557708"
     variation       329
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200120223"
     variation       353
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137909193"
     variation       385
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372527246"
     variation       391
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199912096"
     variation       397
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200985967"
     variation       451
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143388544"
     variation       475
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:13027171"
     variation       477
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139327260"
     variation       539
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370201392"
     variation       585
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373445297"
     variation       603
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374645167"
     exon            605..705
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /inference="alignment:Splign:1.39.8"
     variation       637
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143570667"
     variation       674
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:148690514"
     variation       675
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:56205303"
     variation       687
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201529080"
     variation       704
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370446612"
     exon            706..879
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /inference="alignment:Splign:1.39.8"
     variation       735
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200198573"
     variation       748
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140249054"
     variation       781
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146962542"
     variation       783
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376228438"
     variation       805
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377346429"
     variation       832
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199707021"
     variation       848
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:56256703"
     variation       878
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3761702"
     exon            880..966
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /inference="alignment:Splign:1.39.8"
     variation       887
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368133234"
     variation       895
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:35252762"
     variation       904
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142284609"
     variation       913
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199779970"
     variation       936
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140065278"
     variation       966
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7588635"
     exon            967..1082
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /inference="alignment:Splign:1.39.8"
     variation       978
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145602430"
     variation       999
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369655379"
     variation       1000
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34072093"
     exon            1083..1266
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /inference="alignment:Splign:1.39.8"
     variation       1100
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112257146"
     variation       1108
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34943572"
     variation       1126
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200167805"
     STS             1130..1656
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /standard_name="GDB:372731"
                     /db_xref="UniSTS:156891"
     variation       1176
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199942623"
     variation       1180
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142060697"
     variation       1194
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113052219"
     variation       1206
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:151145412"
     variation       1249
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369339515"
     variation       1256
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150487517"
     exon            1267..1418
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /inference="alignment:Splign:1.39.8"
     variation       1286..1287
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:66613908"
     variation       1329
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:143584038"
     variation       1338
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377752022"
     variation       1345
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147166671"
     variation       1351
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3761698"
     variation       1363
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:370278504"
     variation       1383
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142985827"
     variation       1384
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138908058"
     variation       1397
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144708969"
     variation       1408
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374989199"
     variation       1409
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115203717"
     exon            1419..1572
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /inference="alignment:Splign:1.39.8"
     variation       1456
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202242962"
     variation       1461
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370577205"
     variation       1475
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35981104"
     variation       1476
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:34010621"
     variation       1490
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374043440"
     variation       1496
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:140463186"
     variation       1512
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148833587"
     variation       1519
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7604639"
     variation       1522
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368219980"
     variation       1527
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:79943145"
     variation       1558
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:145142422"
     variation       1566
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374488598"
     exon            1573..1726
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /inference="alignment:Splign:1.39.8"
     variation       1587
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140650643"
     variation       1607
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191874938"
     variation       1615
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35858762"
     variation       1616
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3811634"
     variation       1617
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147206385"
     variation       1674
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2230515"
     variation       1681
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374649522"
     exon            1727..1812
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /inference="alignment:Splign:1.39.8"
     variation       1740
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113485015"
     variation       1778..1779
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:67199299"
     variation       1792
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374078768"
     exon            1813..1908
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /inference="alignment:Splign:1.39.8"
     variation       1813
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200794038"
     variation       1827
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201392053"
     variation       1830
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373307689"
     variation       1836
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143925029"
     variation       1859
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140681547"
     variation       1872
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199937492"
     exon            1909..1989
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /inference="alignment:Splign:1.39.8"
     variation       1973
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148125428"
     variation       1985
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368347736"
     exon            1990..2082
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /inference="alignment:Splign:1.39.8"
     variation       2003
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1131244"
     variation       2006
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1131245"
     variation       2016
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376129675"
     variation       2073
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:119489105"
     variation       2080
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201578313"
     exon            2083..2201
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /inference="alignment:Splign:1.39.8"
     variation       2104
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375952233"
     variation       2106
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:56209758"
     variation       2111
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149310088"
     variation       2150
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:56225811"
     variation       2162
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377006926"
     variation       2173
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370309420"
     variation       2184
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372910380"
     variation       2191
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139822416"
     exon            2202..2311
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /inference="alignment:Splign:1.39.8"
     variation       2215
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373570386"
     variation       2264
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200363872"
     variation       2287
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147779020"
     STS             2312..2551
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /standard_name="MERTK"
                     /db_xref="UniSTS:505021"
     exon            2312..2471
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /inference="alignment:Splign:1.39.8"
     variation       2315
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146886088"
     variation       2317
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201621067"
     variation       2319
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201840939"
     variation       2326
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150046180"
     variation       2331
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142721656"
     variation       2375
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149178674"
     variation       2380
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372801864"
     variation       2394
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200576584"
     variation       2395
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370526555"
     variation       2427
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147899488"
     variation       2445
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:387907314"
     variation       2464
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374847434"
     exon            2472..2608
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /inference="alignment:Splign:1.39.8"
     variation       2488
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185118842"
     variation       2490
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138971326"
     variation       2537
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:80350193"
     variation       2557
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141361084"
     variation       2589
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:55924349"
     exon            2609..3626
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /inference="alignment:Splign:1.39.8"
     variation       2651
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370956458"
     variation       2655
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148926887"
     variation       2667
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375585784"
     variation       2706
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143190615"
     variation       2715
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2230516"
     variation       2729
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200167420"
     variation       2730
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2230517"
     variation       2734
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377341255"
     variation       2759
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139897984"
     variation       2761
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147916288"
     variation       2784
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1131246"
     variation       2800
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147051895"
     variation       2842
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202205484"
     variation       2848
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149131360"
     variation       2880
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:189194232"
     variation       2891
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148056914"
     variation       2899
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370413166"
     variation       2910
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375163842"
     variation       2918
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144771372"
     variation       2926
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372199408"
     variation       2931
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141647333"
     variation       2973
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148261231"
     variation       2981
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375528521"
     variation       2995
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201460398"
     variation       2996
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144406499"
     variation       3012
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368880991"
     variation       3038
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10205793"
     variation       3050
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151054792"
     variation       3058
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377207025"
     variation       3089
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140956730"
     variation       3090
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200644454"
     STS             3113..3255
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /standard_name="STS-U08023"
                     /db_xref="UniSTS:33373"
     variation       3133
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375195445"
     variation       3157
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200622481"
     variation       3204..3205
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:147500027"
     variation       3208..3209
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:67811207"
     variation       3233
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367613631"
     STS             3237..3428
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /standard_name="RH70546"
                     /db_xref="UniSTS:29192"
     variation       3245
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186330340"
     variation       3315
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:79712097"
     polyA_signal    3348..3353
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
     polyA_site      3373
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /experiment="experimental evidence, no additional details
                     recorded"
     STS             3405..3605
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /standard_name="D2S1987"
                     /db_xref="UniSTS:14468"
     variation       3543
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:79733690"
     variation       3561
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191525605"
     variation       3598
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111564226"
     polyA_signal    3606..3611
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
     polyA_site      3626
                     /gene="MERTK"
                     /gene_synonym="c-mer; MER; RP38"
ORIGIN      
actcactgcccgggccgcccggacagggagcttcgctggcgcgcttggccggcgacaggacaggttcgggacgtccatctgtccatccgtccggagagaaattacagatccgcagccccgggatggggccggccccgctgccgctgctgctgggcctcttcctccccgcgctctggcgtagagctatcactgaggcaagggaagaagccaagccttacccgctattcccgggaccttttccagggagcctgcaaactgaccacacaccgctgttatcccttcctcacgccagtgggtaccagcctgccttgatgttttcaccaacccagcctggaagaccacatacaggaaacgtagccattccccaggtgacctctgtcgaatcaaagcccctaccgcctcttgccttcaaacacacagttggacacataatactttctgaacataaaggtgtcaaatttaattgctcaatcagtgtacctaatatataccaggacaccacaatttcttggtggaaagatgggaaggaattgcttggggcacatcatgcaattacacagttttatccagatgatgaagttacagcaataatcgcttccttcagcataaccagtgtgcagcgttcagacaatgggtcgtatatctgtaagatgaaaataaacaatgaagagatcgtgtctgatcccatctacatcgaagtacaaggacttcctcactttactaagcagcctgagagcatgaatgtcaccagaaacacagccttcaacctcacctgtcaggctgtgggcccgcctgagcccgtcaacattttctgggttcaaaacagtagccgtgttaacgaacagcctgaaaaatccccctccgtgctaactgttccaggcctgacggagatggcggtcttcagttgtgaggcccacaatgacaaagggctgaccgtgtccaagggagtgcagatcaacatcaaagcaattccctccccaccaactgaagtcagcatccgtaacagcactgcacacagcattctgatctcctgggttcctggttttgatggatactccccgttcaggaattgcagcattcaggtcaaggaagctgatccgctgagtaatggctcagtcatgatttttaacacctctgccttaccacatctgtaccaaatcaagcagctgcaagccctggctaattacagcattggtgtttcctgcatgaatgaaataggctggtctgcagtgagcccttggattctagccagcacgactgaaggagccccatcagtagcacctttaaatgtcactgtgtttctgaatgaatctagtgataatgtggacatcagatggatgaagcctccgactaagcagcaggatggagaactggtgggctaccggatatcccacgtgtggcagagtgcagggatttccaaagagctcttggaggaagttggccagaatggcagccgagctcggatctctgttcaagtccacaatgctacgtgcacagtgaggattgcagccgtcaccagagggggagttgggcccttcagtgatccagtgaaaatatttatccctgcacacggttgggtagattatgccccctcttcaactccggcgcctggcaacgcagatcctgtgctcatcatctttggctgcttttgtggatttattttgattgggttgattttatacatctccttggccatcagaaaaagagtccaggagacaaagtttgggaatgcattcacagaggaggattctgaattagtggtgaattatatagcaaagaaatccttctgtcggcgagccattgaacttaccttacatagcttgggagtcagtgaggaactacaaaataaactagaagatgttgtgattgacaggaatcttctaattcttggaaaaattctgggtgaaggagagtttgggtctgtaatggaaggaaatcttaagcaggaagatgggacctctctgaaagtggcagtgaagaccatgaagttggacaactcttcacagcgggagatcgaggagtttctcagtgaggcagcgtgcatgaaagacttcagccacccaaatgtcattcgacttctaggtgtgtgtatagaaatgagctctcaaggcatcccaaagcccatggtaattttacccttcatgaaatacggggacctgcatacttacttactttattcccgattggagacaggaccaaagcatattcctctgcagacactattgaagttcatggtggatattgccctgggaatggagtatctgagcaacaggaattttcttcatcgagatttagctgctcgaaactgcatgttgcgagatgacatgactgtctgtgttgcggacttcggcctctctaagaagatttacagtggcgattattaccgccaaggccgcattgctaagatgcctgttaaatggatcgccatagaaagtcttgcagaccgagtctacacaagtaaaagtgatgtgtgggcatttggcgtgaccatgtgggaaatagctacgcggggaatgactccctatcctggggtccagaaccatgagatgtatgactatcttctccatggccacaggttgaagcagcccgaagactgcctggatgaactgtatgaaataatgtactcttgctggagaaccgatcccttagaccgccccaccttttcagtattgaggctgcagctagaaaaactcttagaaagtttgcctgacgttcggaaccaagcagacgttatttacgtcaatacacagttgctggagagctctgagggcctggcccagggctccacccttgctccactggacttgaacatcgaccctgactctataattgcctcctgcactccccgcgctgccatcagtgtggtcacagcagaagttcatgacagcaaacctcatgaaggacggtacatcctgaatgggggcagtgaggaatgggaagatctgacttctgccccctctgctgcagtcacagctgaaaagaacagtgttttaccgggggagagacttgttaggaatggggtctcctggtcccattcgagcatgctgcccttgggaagctcattgcccgatgaacttttgtttgctgacgactcctcagaaggctcagaagtcctgatgtgaggagaggtgcggggagacattccaaaaatcaagccaattcttctgctgtaggagaatccaattgtacctgatgtttttggtatttgtcttccttaccaagtgaactccatggccccaaagcaccagatgaatgttgttaagtaagctgtcattaaaaatacataatatatatttatttaaagagaaaaaatatgtgtatatcatggaaaaagacaaggatattttaataaaacattacttatttcatttcacttatcttgcatatcttaaaattaagcttcagctgctccttgatattaacatttgtacagagttgaagttgttttttcaagttcttttctttttcatgactattaaatgtaaaaatatttgtaaaatgaaatgccatatttgacttggcttctggtcttgatgtatttgataagaatgattcattcaatgtttaaagttgtataactgattaattttctgatatggcttcctaataaaatatgaataaggaagaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:10461 -> Molecular function: GO:0004714 [transmembrane receptor protein tyrosine kinase activity] evidence: IEA
            GeneID:10461 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:10461 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
            GeneID:10461 -> Biological process: GO:0001779 [natural killer cell differentiation] evidence: IEA
            GeneID:10461 -> Biological process: GO:0006468 [protein phosphorylation] evidence: TAS
            GeneID:10461 -> Biological process: GO:0006909 [phagocytosis] evidence: IMP
            GeneID:10461 -> Biological process: GO:0007166 [cell surface receptor signaling pathway] evidence: TAS
            GeneID:10461 -> Biological process: GO:0007267 [cell-cell signaling] evidence: TAS
            GeneID:10461 -> Biological process: GO:0007283 [spermatogenesis] evidence: IEA
            GeneID:10461 -> Biological process: GO:0007596 [blood coagulation] evidence: TAS
            GeneID:10461 -> Biological process: GO:0030168 [platelet activation] evidence: IEA
            GeneID:10461 -> Biological process: GO:0032940 [secretion by cell] evidence: IEA
            GeneID:10461 -> Biological process: GO:0034446 [substrate adhesion-dependent cell spreading] evidence: IEA
            GeneID:10461 -> Biological process: GO:0043277 [apoptotic cell clearance] evidence: IEA
            GeneID:10461 -> Biological process: GO:0043491 [protein kinase B signaling cascade] evidence: IEA
            GeneID:10461 -> Biological process: GO:0050766 [positive regulation of phagocytosis] evidence: IDA
            GeneID:10461 -> Biological process: GO:0050900 [leukocyte migration] evidence: TAS
            GeneID:10461 -> Biological process: GO:0051250 [negative regulation of lymphocyte activation] evidence: IEA
            GeneID:10461 -> Biological process: GO:0060041 [retina development in camera-type eye] evidence: IEA
            GeneID:10461 -> Biological process: GO:0060068 [vagina development] evidence: IEA
            GeneID:10461 -> Cellular component: GO:0001750 [photoreceptor outer segment] evidence: IEA
            GeneID:10461 -> Cellular component: GO:0005615 [extracellular space] evidence: IDA
            GeneID:10461 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:10461 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS
            GeneID:10461 -> Cellular component: GO:0005887 [integral to plasma membrane] evidence: TAS
            GeneID:10461 -> Cellular component: GO:0016028 [rhabdomere] evidence: IDA
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_006334 -> EC 2.7.10.1

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.