Home |
Help |
Advanced search
2024-04-26 08:32:18, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_006281 2828 bp mRNA linear PRI 02-JUN-2013
DEFINITION Homo sapiens serine/threonine kinase 3 (STK3), transcript variant
1, mRNA.
ACCESSION NM_006281
VERSION NM_006281.3 GI:372622368
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2828)
AUTHORS Romano,D., Maccario,H., Doherty,C., Quinn,N.P., Kolch,W. and
Matallanas,D.
TITLE The differential effects of wild-type and mutated K-Ras on MST2
signaling are determined by K-Ras activation kinetics
JOURNAL Mol. Cell. Biol. 33 (9), 1859-1868 (2013)
PUBMED 23459937
REMARK GeneRIF: The ability of K-Ras to activate MST2 and MST2-dependent
apoptosis is determined by the differential activation kinetics of
mutant K-Ras and wild type K-Ras.
REFERENCE 2 (bases 1 to 2828)
AUTHORS Liu,W., Wu,J., Xiao,L., Bai,Y., Qu,A., Zheng,Z. and Yuan,Z.
TITLE Regulation of neuronal cell death by c-Abl-Hippo/MST2 signaling
pathway
JOURNAL PLoS ONE 7 (5), E36562 (2012)
PUBMED 22590567
REMARK GeneRIF: The identification of the c-Abl tyrosine kinase as a novel
upstream activator of MST2 suggests that the conserved c-Abl-MST
signaling cascade plays an important role in oxidative
stress-induced neuronal cell death.
REFERENCE 3 (bases 1 to 2828)
AUTHORS Matallanas,D., Romano,D., Al-Mulla,F., O'Neill,E., Al-Ali,W.,
Crespo,P., Doyle,B., Nixon,C., Sansom,O., Drosten,M., Barbacid,M.
and Kolch,W.
TITLE Mutant K-Ras activation of the proapoptotic MST2 pathway is
antagonized by wild-type K-Ras
JOURNAL Mol. Cell 44 (6), 893-906 (2011)
PUBMED 22195963
REMARK GeneRIF: The small number of tumors with co-expression of mutant
K-Ras and MST2 has elevated apoptosis rates.
REFERENCE 4 (bases 1 to 2828)
AUTHORS Song,J., Hong,H., Choi,S., Lee,Y.H., Yamashita,E., Bae,S.C.,
Park,I.Y. and Lee,S.J.
TITLE Crystallization and preliminary X-ray crystallographic study of the
human MST2 SARAH domain
JOURNAL Acta Crystallogr. Sect. F Struct. Biol. Cryst. Commun. 67 (PT 11),
1403-1405 (2011)
PUBMED 22102242
REMARK GeneRIF: crystals of MST2 belonged to space group P2, with
unit-cell parameters a = 62.0, b = 119.2, c = 62.0 A, alpha = 90.0,
beta = 90.5, gamma = 90.0 degrees , or to space group P6(1)22, with
unit-cell parameters a = 54.5, b = 54.5, c = 303.1 A
REFERENCE 5 (bases 1 to 2828)
AUTHORS Park,B.H. and Lee,Y.H.
TITLE Phosphorylation of SAV1 by mammalian ste20-like kinase promotes
cell death
JOURNAL BMB Rep 44 (9), 584-589 (2011)
PUBMED 21944251
REMARK GeneRIF: The mammalian ste20-like kinase mediated phosphorylation
of four residues within SAV1 may be important in the induction of
cell death by the MST pathway.
REFERENCE 6 (bases 1 to 2828)
AUTHORS Bren,A., Welch,M., Blat,Y. and Eisenbach,M.
TITLE Signal termination in bacterial chemotaxis: CheZ mediates
dephosphorylation of free rather than switch-bound CheY
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 93 (19), 10090-10093 (1996)
PUBMED 8816756
REFERENCE 7 (bases 1 to 2828)
AUTHORS Creasy,C.L. and Chernoff,J.
TITLE Cloning and characterization of a member of the MST subfamily of
Ste20-like kinases
JOURNAL Gene 167 (1-2), 303-306 (1995)
PUBMED 8566796
REFERENCE 8 (bases 1 to 2828)
AUTHORS Adams,M.D., Kerlavage,A.R., Fleischmann,R.D., Fuldner,R.A.,
Bult,C.J., Lee,N.H., Kirkness,E.F., Weinstock,K.G., Gocayne,J.D.,
White,O. et al.
TITLE Initial assessment of human gene diversity and expression patterns
based upon 83 million nucleotides of cDNA sequence
JOURNAL Nature 377 (6547 SUPPL), 3-174 (1995)
PUBMED 7566098
REFERENCE 9 (bases 1 to 2828)
AUTHORS Creasy,C.L. and Chernoff,J.
TITLE Cloning and characterization of a human protein kinase with
homology to Ste20
JOURNAL J. Biol. Chem. 270 (37), 21695-21700 (1995)
PUBMED 7665586
REFERENCE 10 (bases 1 to 2828)
AUTHORS Schultz,S.J. and Nigg,E.A.
TITLE Identification of 21 novel human protein kinases, including 3
members of a family related to the cell cycle regulator nimA of
Aspergillus nidulans
JOURNAL Cell Growth Differ. 4 (10), 821-830 (1993)
PUBMED 8274451
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
U26424.1, BC010640.2 and AP003355.2.
On Jan 19, 2012 this sequence version replaced gi:103471998.
Summary: This gene encodes a serine/threonine protein kinase
activated by proapoptotic molecules indicating the encoded protein
functions as a growth suppressor. Cleavage of the protein product
by caspase removes the inhibitory C-terminal portion. The
N-terminal portion is transported to the nucleus where it
homodimerizes to form the active kinase which promotes the
condensation of chromatin during apoptosis. Multiple transcript
variants encoding different isoforms have been found for this gene.
[provided by RefSeq, Jan 2012].
Transcript Variant: This variant (1) encodes isoform 1.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: U26424.1, BC010640.2 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025084, ERS025088 [ECO:0000348]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-11 U26424.1 1-11
12-2826 BC010640.2 1-2815
2827-2828 AP003355.2 83886-83887 c
FEATURES Location/Qualifiers
source 1..2828
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="8"
/map="8q22.2"
gene 1..2828
/gene="STK3"
/gene_synonym="KRS1; MST2"
/note="serine/threonine kinase 3"
/db_xref="GeneID:6788"
/db_xref="HGNC:11406"
/db_xref="MIM:605030"
exon 1..167
/gene="STK3"
/gene_synonym="KRS1; MST2"
/inference="alignment:Splign:1.39.8"
CDS 142..1617
/gene="STK3"
/gene_synonym="KRS1; MST2"
/EC_number="2.7.11.1"
/note="isoform 1 is encoded by transcript variant 1;
serine/threonine kinase 3 (STE20 homolog, yeast);
serine/threonine kinase 3 (Ste20, yeast homolog);
serine/threonine-protein kinase 3; MST-2; STE20-like
kinase MST2; mammalian STE20-like protein kinase 2;
serine/threonine-protein kinase Krs-1"
/codon_start=1
/product="serine/threonine-protein kinase 3 isoform 1"
/protein_id="NP_006272.2"
/db_xref="GI:103471999"
/db_xref="CCDS:CCDS47900.1"
/db_xref="GeneID:6788"
/db_xref="HGNC:11406"
/db_xref="MIM:605030"
/translation="
MEQPPAPKSKLKKLSEDSLTKQPEEVFDVLEKLGEGSYGSVFKAIHKESGQVVAIKQVPVESDLQEIIKEISIMQQCDSPYVVKYYGSYFKNTDLWIVMEYCGAGSVSDIIRLRNKTLIEDEIATILKSTLKGLEYLHFMRKIHRDIKAGNILLNTEGHAKLADFGVAGQLTDTMAKRNTVIGTPFWMAPEVIQEIGYNCVADIWSLGITSIEMAEGKPPYADIHPMRAIFMIPTNPPPTFRKPELWSDDFTDFVKKCLVKNPEQRATATQLLQHPFIKNAKPVSILRDLITEAMEIKAKRHEEQQRELEEEEENSDEDELDSHTMVKTSVESVGTMRATSTMSEGAQTMIEHNSTMLESDLGTMVINSEDEEEEDGTMKRNATSPQVQRPSFMDYFDKQDFKNKSHENCNQNMHEPFPMSKNVFPDNWKVPQDGDFDFLKNLSLEELQMRLKALDPMMEREIEELRQRYTAKRQPILDAMDAKKRRQQNF
"
mat_peptide 142..1107
/gene="STK3"
/gene_synonym="KRS1; MST2"
/product="Serine/threonine-protein kinase 3 36kDa subunit"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q13188.2)"
misc_feature 142..144
/gene="STK3"
/gene_synonym="KRS1; MST2"
/experiment="experimental evidence, no additional details
recorded"
/note="N-acetylmethionine; propagated from
UniProtKB/Swiss-Prot (Q13188.2); acetylation site"
misc_feature 184..186
/gene="STK3"
/gene_synonym="KRS1; MST2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q13188.2); phosphorylation site"
misc_feature 208..975
/gene="STK3"
/gene_synonym="KRS1; MST2"
/note="Catalytic domain of the Protein Serine/Threonine
Kinases, Mammalian Ste20-like protein kinase 1 and 2;
Region: STKc_MST1_2; cd06612"
/db_xref="CDD:132943"
misc_feature 220..975
/gene="STK3"
/gene_synonym="KRS1; MST2"
/note="Serine/Threonine protein kinases, catalytic domain;
Region: S_TKc; smart00220"
/db_xref="CDD:197582"
misc_feature order(238..252,262..264,301..303,307..309,388..390,
436..447,454..459,466..468,577..579,583..594,598..600,
631..633,640..642,682..693,697..699,778..780,805..807)
/gene="STK3"
/gene_synonym="KRS1; MST2"
/note="active site"
/db_xref="CDD:132943"
misc_feature order(238..252,262..264,301..303,307..309,388..390,
436..447,454..459,466..468,589..594,598..600,631..633)
/gene="STK3"
/gene_synonym="KRS1; MST2"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:132943"
misc_feature order(247..252,577..579,583..591,640..642,682..693,
697..699,778..780,805..807)
/gene="STK3"
/gene_synonym="KRS1; MST2"
/note="substrate binding site [chemical binding]; other
site"
/db_xref="CDD:132943"
misc_feature 490..492
/gene="STK3"
/gene_synonym="KRS1; MST2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine, by PKB/AKT1; propagated from
UniProtKB/Swiss-Prot (Q13188.2); phosphorylation site"
misc_feature order(628..666,670..699)
/gene="STK3"
/gene_synonym="KRS1; MST2"
/note="activation loop (A-loop); other site"
/db_xref="CDD:132943"
misc_feature 679..681
/gene="STK3"
/gene_synonym="KRS1; MST2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:05433"
misc_feature 1087..1089
/gene="STK3"
/gene_synonym="KRS1; MST2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q13188.2); phosphorylation site"
misc_feature 1087..1089
/gene="STK3"
/gene_synonym="KRS1; MST2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1105..1110
/gene="STK3"
/gene_synonym="KRS1; MST2"
/experiment="experimental evidence, no additional details
recorded"
/note="Cleavage, by caspase-3; propagated from
UniProtKB/Swiss-Prot (Q13188.2); cleavage site"
misc_feature 1105..1107
/gene="STK3"
/gene_synonym="KRS1; MST2"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:02799"
mat_peptide 1108..1614
/gene="STK3"
/gene_synonym="KRS1; MST2"
/product="Serine/threonine-protein kinase 3 20kDa subunit"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q13188.2)"
misc_feature 1147..1149
/gene="STK3"
/gene_synonym="KRS1; MST2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine; propagated from
UniProtKB/Swiss-Prot (Q13188.2); phosphorylation site"
misc_feature 1291..1293
/gene="STK3"
/gene_synonym="KRS1; MST2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine, by PKB/AKT1; propagated from
UniProtKB/Swiss-Prot (Q13188.2); phosphorylation site"
misc_feature 1447..1593
/gene="STK3"
/gene_synonym="KRS1; MST2"
/note="C terminal SARAH domain of Mst1; Region:
Mst1_SARAH; pfam11629"
/db_xref="CDD:152065"
misc_feature 1471..1473
/gene="STK3"
/gene_synonym="KRS1; MST2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q13188.2); phosphorylation site"
exon 168..248
/gene="STK3"
/gene_synonym="KRS1; MST2"
/inference="alignment:Splign:1.39.8"
exon 249..377
/gene="STK3"
/gene_synonym="KRS1; MST2"
/inference="alignment:Splign:1.39.8"
exon 378..492
/gene="STK3"
/gene_synonym="KRS1; MST2"
/inference="alignment:Splign:1.39.8"
exon 493..657
/gene="STK3"
/gene_synonym="KRS1; MST2"
/inference="alignment:Splign:1.39.8"
exon 658..825
/gene="STK3"
/gene_synonym="KRS1; MST2"
/inference="alignment:Splign:1.39.8"
exon 826..963
/gene="STK3"
/gene_synonym="KRS1; MST2"
/inference="alignment:Splign:1.39.8"
exon 964..1089
/gene="STK3"
/gene_synonym="KRS1; MST2"
/inference="alignment:Splign:1.39.8"
variation 1050
/gene="STK3"
/gene_synonym="KRS1; MST2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1057795"
exon 1090..1282
/gene="STK3"
/gene_synonym="KRS1; MST2"
/inference="alignment:Splign:1.39.8"
exon 1283..1458
/gene="STK3"
/gene_synonym="KRS1; MST2"
/inference="alignment:Splign:1.39.8"
exon 1459..2828
/gene="STK3"
/gene_synonym="KRS1; MST2"
/inference="alignment:Splign:1.39.8"
STS 2347..2487
/gene="STK3"
/gene_synonym="KRS1; MST2"
/standard_name="RH64860"
/db_xref="UniSTS:89236"
STS 2556..2822
/gene="STK3"
/gene_synonym="KRS1; MST2"
/standard_name="WI-20184"
/db_xref="UniSTS:54716"
STS 2606..2751
/gene="STK3"
/gene_synonym="KRS1; MST2"
/standard_name="D8S1924"
/db_xref="UniSTS:74810"
ORIGIN
ccgcggagttacgggaaagttggtccgagttcccagagtttccctctgtggtgccctaggctcggccggccggtgccccggctcctttcctcctttcggccttcgccgtccaccaggtccctctctctgtccccggccgccatggagcagccgccggcgcctaagagtaaactaaaaaagctgagtgaagacagtttgactaagcagcctgaagaagtttttgatgtattagagaagcttggagaagggtcttatggaagtgtatttaaagcaatacacaaggaatccggtcaagttgtcgcaattaaacaagtacctgttgaatcagatcttcaggaaataatcaaagaaatttccataatgcagcaatgtgacagcccatatgttgtaaagtactatggcagttattttaagaatacagacctctggattgttatggagtactgtggcgctggctctgtctcagacataattagattacgaaacaagacattaatagaagatgaaattgcaaccattcttaaatctacattgaaaggactagaatatttgcactttatgagaaaaatacacagagatataaaagctggaaatattctcctcaatacagaaggacatgcaaaattggcagattttggagtggctggtcagttaacagatacaatggcaaaacgcaatactgtaataggaactccattttggatggctcctgaggtgattcaagaaataggctataactgtgtggccgacatctggtcccttggcattacttctatagaaatggctgaaggaaaacctccttatgctgatatacatccaatgagggctatttttatgattcccacaaatccaccaccaacattcagaaagccagaactttggtccgatgatttcaccgattttgttaaaaagtgtttggtgaagaatcctgagcagagagctactgcaacacaacttttacagcatccttttatcaagaatgccaaacctgtatcaatattaagagacctgatcacagaagctatggagatcaaagctaaaagacatgaggaacagcaacgagaattggaagaggaagaagaaaattcggatgaagatgagctggattcccacaccatggtgaagactagtgtggagagtgtgggcaccatgcgggccacaagcacgatgagtgaaggggcccagaccatgattgaacataatagcacgatgttggaatccgacttggggaccatggtgataaacagtgaggatgaggaagaagaagatggaactatgaaaagaaatgcaacctcaccacaagtacaaagaccatctttcatggactactttgataagcaagacttcaagaataagagtcacgaaaactgtaatcagaacatgcatgaacccttccctatgtccaaaaacgtttttcctgataactggaaagttcctcaagatggagactttgactttttgaaaaatctaagtttagaagaactacagatgcggttaaaagcactggaccccatgatggaacgggagatagaagaacttcgtcagagatacactgcgaaaagacagcccattctggatgcgatggatgcaaagaaaagaaggcagcaaaacttttgagtctaatttcctctctgtttttaactattctggagaccaagaaaccactaggaattgaaggaatatttggatatttttaatcctaagattttgccctacaattaggcagaggtcaaaaagtgacaatggtacatgcccaggtaaattcccaaaaggcagaattgacagttgtatctgctgtgcattcactctaagatgaggagaacaaaagaagtgtattctcttgttctgtcagctgcataccagtaataaaactgttatgaaatggattttcaaggtctctaaaccttgaaaatccaaagctattgttgcattgtacagcactgaagggctttatgttacaatattctttattcctatctagtatactaggctatttattgtatccccttaggtaaacttatttatttatgctattttgctttgtttcattttttaaggacaagatcaggatagctttggtgaaggtagggtcatattaatatgatgataatgtgcaaccaatttatactttctgcagggagctatggggtacattccttgatttccaggatagtttttcaaataggaaagcaataatggcagtagttctcaaatgggctaggccttttttatattgaagcaataattccatttttaccctttgaaattttgtttttttgatttttgatgtttggtacaaatagaactatatatatttaggtaaaatagatctatcgtgtttaaaaccaaagaaatcaatggaacccttgcacaaaaaagtgtgataaatatttttaaataaaaacttaatacaaatgtaatttgttaatattgtttcatgttttatgtgtagatctaatagctgaactgattcaaactgtaataagctcatcaatttcatttctatgaaaatgtgctctgttgtcacaggatgtttctgttgattttattcatttcctgggaattggtaaacatcatgttcctgatgataacccagtagcaaaaacatttgtactgagtggtacaagccttggggactgaaaaaaaaaagattaaaaccattaaaaagaaactcatttttacgctgaatgaacatttatatgattgcattgggaccagtcatttcctaagctacatatggccatcttgacagtgttttttcttttgtgtgtttaattattatgtgtaaatcataaagacaaataaatttcactgtgccacccagcata
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:6788 -> Molecular function: GO:0000287 [magnesium ion binding] evidence: IDA
GeneID:6788 -> Molecular function: GO:0004672 [protein kinase activity] evidence: TAS
GeneID:6788 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: EXP
GeneID:6788 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: IDA
GeneID:6788 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:6788 -> Molecular function: GO:0005524 [ATP binding] evidence: IDA
GeneID:6788 -> Molecular function: GO:0043539 [protein serine/threonine kinase activator activity] evidence: IDA
GeneID:6788 -> Molecular function: GO:0046983 [protein dimerization activity] evidence: ISS
GeneID:6788 -> Biological process: GO:0006468 [protein phosphorylation] evidence: IDA
GeneID:6788 -> Biological process: GO:0006915 [apoptotic process] evidence: TAS
GeneID:6788 -> Biological process: GO:0007165 [signal transduction] evidence: TAS
GeneID:6788 -> Biological process: GO:0007243 [intracellular protein kinase cascade] evidence: IDA
GeneID:6788 -> Biological process: GO:0035329 [hippo signaling cascade] evidence: IDA
GeneID:6788 -> Biological process: GO:0035329 [hippo signaling cascade] evidence: TAS
GeneID:6788 -> Biological process: GO:0043065 [positive regulation of apoptotic process] evidence: ISS
GeneID:6788 -> Biological process: GO:0071902 [positive regulation of protein serine/threonine kinase activity] evidence: IDA
GeneID:6788 -> Biological process: GO:0090090 [negative regulation of canonical Wnt receptor signaling pathway] evidence: IMP
GeneID:6788 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
GeneID:6788 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:6788 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_006272 -> EC 2.7.11.1
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.