GGRNA | NM_006261.4

LOCUS       NM_006261               1464 bp    mRNA    linear   PRI 01-JUL-2013
DEFINITION  Homo sapiens PROP paired-like homeobox 1 (PROP1), mRNA.
ACCESSION   NM_006261
VERSION     NM_006261.4  GI:262359908
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1464)
  AUTHORS   Godi,M., Mellone,S., Tiradani,L., Marabese,R., Bardelli,C.,
            Salerno,M., Prodam,F., Bellone,S., Petri,A.,
            Momigliano-Richiardi,P., Bona,G. and Giordano,M.
  TITLE     Functional SNPs within the intron 1 of the PROP1 gene contribute to
            combined growth hormone deficiency (CPHD)
  JOURNAL   J. Clin. Endocrinol. Metab. 97 (9), E1791-E1797 (2012)
   PUBMED   22745233
  REMARK    GeneRIF: Variations with a functional significance conferring
            susceptibility to combined growth hormone deficiency have been
            identified in the PROP1 gene
REFERENCE   2  (bases 1 to 1464)
  AUTHORS   Doknic,M., Pekic,S., Civcic,M. and Popovic,V.
  TITLE     Clinical Case Seminar. Peculiar prolactinomas in patients with
            pituitary developmental gene mutations: from an adult
            endocrinologist perspective
  JOURNAL   Hormones (Athens) 11 (2), 189-198 (2012)
   PUBMED   22801565
  REMARK    GeneRIF: Peculiar prolactinomas in patients with pituitary
            developmental PROP1 gene mutations
REFERENCE   3  (bases 1 to 1464)
  AUTHORS   Cani,C.M., Matushita,H., Carvalho,L.R., Soares,I.C., Brito,L.P.,
            Almeida,M.Q. and Mendonca,B.B.
  TITLE     PROP1 and CTNNB1 expression in adamantinomatous craniopharyngiomas
            with or without beta-catenin mutations
  JOURNAL   Clinics (Sao Paulo) 66 (11), 1849-1854 (2011)
   PUBMED   22086512
  REMARK    GeneRIF: PROP1 dysregulation was not likely involved in the
            pathogenesis of adamantinomatous craniopharyngiomas in this cohort
            of patients.
REFERENCE   4  (bases 1 to 1464)
  AUTHORS   Obermannova,B., Pfaeffle,R., Zygmunt-Gorska,A., Starzyk,J.,
            Verkauskiene,R., Smetanina,N., Bezlepkina,O., Peterkova,V.,
            Frisch,H., Cinek,O., Child,C.J., Blum,W.F. and Lebl,J.
  TITLE     Mutations and pituitary morphology in a series of 82 patients with
            PROP1 gene defects
  JOURNAL   Horm Res Paediatr 76 (5), 348-354 (2011)
   PUBMED   22024773
  REMARK    GeneRIF: Although pituitary size was increased in a number of
            PROP1-deficient patients, none of them suffered permanent damage
            from pituitary mass; therefore, any proposed surgery should be
            postponed as long as possible.
REFERENCE   5  (bases 1 to 1464)
  AUTHORS   Campanini,M.L., Colli,L.M., Paixao,B.M., Cabral,T.P., Amaral,F.C.,
            Machado,H.R., Neder,L.S., Saggioro,F., Moreira,A.C., Antonini,S.R.
            and de Castro,M.
  TITLE     CTNNB1 gene mutations, pituitary transcription factors, and
            MicroRNA expression involvement in the pathogenesis of
            adamantinomatous craniopharyngiomas
  JOURNAL   Horm Cancer 1 (4), 187-196 (2010)
   PUBMED   21761366
  REMARK    GeneRIF: Data show no mutations in HESX1, PROP1, and POU1F1 genes,
            seven different mutations in CTNNB1 in 8/16 patients, and
            hyperexpression of miR-150.
REFERENCE   6  (bases 1 to 1464)
  AUTHORS   Fluck,C., Deladoey,J., Rutishauser,K., Eble,A., Marti,U., Wu,W. and
            Mullis,P.E.
  TITLE     Phenotypic variability in familial combined pituitary hormone
            deficiency caused by a PROP1 gene mutation resulting in the
            substitution of Arg-->Cys at codon 120 (R120C)
  JOURNAL   J. Clin. Endocrinol. Metab. 83 (10), 3727-3734 (1998)
   PUBMED   9768691
REFERENCE   7  (bases 1 to 1464)
  AUTHORS   Cogan,J.D., Wu,W., Phillips,J.A. III, Arnhold,I.J., Agapito,A.,
            Fofanova,O.V., Osorio,M.G., Bircan,I., Moreno,A. and Mendonca,B.B.
  TITLE     The PROP1 2-base pair deletion is a common cause of combined
            pituitary hormone deficiency
  JOURNAL   J. Clin. Endocrinol. Metab. 83 (9), 3346-3349 (1998)
   PUBMED   9745452
REFERENCE   8  (bases 1 to 1464)
  AUTHORS   Amendt,B.A., Sutherland,L.B., Semina,E.V. and Russo,A.F.
  TITLE     The molecular basis of Rieger syndrome. Analysis of Pitx2
            homeodomain protein activities
  JOURNAL   J. Biol. Chem. 273 (32), 20066-20072 (1998)
   PUBMED   9685346
REFERENCE   9  (bases 1 to 1464)
  AUTHORS   Fofanova,O., Takamura,N., Kinoshita,E., Parks,J.S., Brown,M.R.,
            Peterkova,V.A., Evgrafov,O.V., Goncharov,N.P., Bulatov,A.A.,
            Dedov,I.I. and Yamashita,S.
  TITLE     Compound heterozygous deletion of the PROP-1 gene in children with
            combined pituitary hormone deficiency
  JOURNAL   J. Clin. Endocrinol. Metab. 83 (7), 2601-2604 (1998)
   PUBMED   9661653
REFERENCE   10 (bases 1 to 1464)
  AUTHORS   Wu,W., Cogan,J.D., Pfaffle,R.W., Dasen,J.S., Frisch,H.,
            O'Connell,S.M., Flynn,S.E., Brown,M.R., Mullis,P.E., Parks,J.S.,
            Phillips,J.A. III and Rosenfeld,M.G.
  TITLE     Mutations in PROP1 cause familial combined pituitary hormone
            deficiency
  JOURNAL   Nat. Genet. 18 (2), 147-149 (1998)
   PUBMED   9462743
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AF076215.1 and AC136940.2.
            This sequence is a reference standard in the RefSeqGene project.
            On Nov 4, 2009 this sequence version replaced gi:169881276.
            
            Summary: This gene encodes a paired-like homeodomain transcription
            factor in the developing pituitary gland. Expression occurs prior
            to and is required for expression of pou domain transcription
            factor 1, which is responsible for pituitary development and
            hormone expression. Mutations in this gene have been associated
            with combined pituitary hormone deficiency-2 as well as
            deficiencies in luteinizing hormone, follicle-stimulating hormone,
            growth hormone, prolactin, and thyroid-stimulating hormone.
            [provided by RefSeq, Sep 2011].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF076215.1, BC069076.1 [ECO:0000332]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1108              AF076215.1         1-1108
            1109-1109           AC136940.2         36954-36954
            1110-1453           AF076215.1         1110-1453
            1454-1454           AC136940.2         37299-37299
            1455-1464           AF076215.1         1454-1463
FEATURES             Location/Qualifiers
     source          1..1464
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="5"
                     /map="5q35.3"
     gene            1..1464
                     /gene="PROP1"
                     /gene_synonym="CPHD2; PROP-1"
                     /note="PROP paired-like homeobox 1"
                     /db_xref="GeneID:5626"
                     /db_xref="HGNC:9455"
                     /db_xref="MIM:601538"
     exon            1..418
                     /gene="PROP1"
                     /gene_synonym="CPHD2; PROP-1"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    121..123
                     /gene="PROP1"
                     /gene_synonym="CPHD2; PROP-1"
                     /note="upstream in-frame stop codon"
     STS             240..1043
                     /gene="PROP1"
                     /gene_synonym="CPHD2; PROP-1"
                     /db_xref="UniSTS:483331"
     CDS             310..990
                     /gene="PROP1"
                     /gene_synonym="CPHD2; PROP-1"
                     /note="prophet of Pit1, paired-like homeodomain
                     transcription factor; pituitary-specific homeodomain
                     factor"
                     /codon_start=1
                     /product="homeobox protein prophet of Pit-1"
                     /protein_id="NP_006252.3"
                     /db_xref="GI:262359909"
                     /db_xref="CCDS:CCDS4430.1"
                     /db_xref="GeneID:5626"
                     /db_xref="HGNC:9455"
                     /db_xref="MIM:601538"
                     /translation="

MEAERRRQAEKPKKGRVGSSLLPERHPATGTPTTTVDSSAPPCRRLPGAGGGRSRFSPQGGQRGRPHSRRRHRTTFSPVQLEQLESAFGRNQYPDIWARESLARDTGLSEARIQVWFQNRRAKQRKQERSLLQPLAHLSPAAFSSFLPESTACPYSYAAPPPPVTCFPHPYSHALPSQPSTGGAFALSHQSEDWYPTLHPAPAGHLPCPPPPPMLPLSLEPSKSWN

"
     misc_feature    529..693
                     /gene="PROP1"
                     /gene_synonym="CPHD2; PROP-1"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(529..531,535..537,586..588,604..606,643..645,
                     649..654,661..666,670..678,682..687)
                     /gene="PROP1"
                     /gene_synonym="CPHD2; PROP-1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(532..534,652..654,661..666,673..675)
                     /gene="PROP1"
                     /gene_synonym="CPHD2; PROP-1"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     STS             310..990
                     /gene="PROP1"
                     /gene_synonym="CPHD2; PROP-1"
                     /db_xref="UniSTS:480434"
     variation       336
                     /gene="PROP1"
                     /gene_synonym="CPHD2; PROP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1135320"
     exon            419..651
                     /gene="PROP1"
                     /gene_synonym="CPHD2; PROP-1"
                     /inference="alignment:Splign:1.39.8"
     variation       461
                     /gene="PROP1"
                     /gene_synonym="CPHD2; PROP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2233783"
     variation       488
                     /gene="PROP1"
                     /gene_synonym="CPHD2; PROP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2233785"
     exon            652..1464
                     /gene="PROP1"
                     /gene_synonym="CPHD2; PROP-1"
                     /inference="alignment:Splign:1.39.8"
     variation       733
                     /gene="PROP1"
                     /gene_synonym="CPHD2; PROP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1800197"
     variation       809
                     /gene="PROP1"
                     /gene_synonym="CPHD2; PROP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199587578"
     variation       925
                     /gene="PROP1"
                     /gene_synonym="CPHD2; PROP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1135321"
     variation       1042
                     /gene="PROP1"
                     /gene_synonym="CPHD2; PROP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2233787"
     variation       1113
                     /gene="PROP1"
                     /gene_synonym="CPHD2; PROP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2233788"
ORIGIN

gcatcccggtggggagaagggccaggcagagaaaagtagtcagaaacagagcaacaggtgaggctgaggcaggagattgagctgacactcaagccaaggaagggggaattaggaaacaattagaaaaaaagtaaagacagtgaaaaagtcagagacagctgcctgcacctacacacacattcagagacagagtcccagagggtggcatacacagagggagaaggggagggaacaggtgtggagaggagctgcggaagcagagaaatctcaagtcagagattcagggacacttggtccccgtggcgagccatggaagcagaaaggaggcgccaggctgagaagccaaagaaggggcgagtcggcagcagcctgttgcctgagagacacccggccactgggaccccgaccaccacggtggactcgagtgctccaccctgcagaaggctccctggtgcaggaggggggagatcaaggttctccccgcaaggaggacagaggggccgcccgcactcccggcgccgccaccgcaccaccttcagcccagtgcagttggaacagctggagtcagcctttgggaggaaccagtaccccgacatctgggcccgagagagtcttgcccgggacactggcctcagtgaggcccgaatccaggtctggttccagaaccgcagagctaagcaacggaagcaagagcgctcactgcttcagcctctggcccatctgtctcctgccgccttttccagcttcttgccagagtccactgcttgcccctattcttacgcagcaccaccaccaccagtgacctgcttccctcacccctacagccatgccctcccttcccagccctccacaggaggcgcctttgctttgtcacaccagtctgaggactggtaccctaccttgcacccagcccctgccggccatctgccctgccccccaccccctcccatgctccccctcagccttgagccatccaagtcctggaactgaggtcaaacaagtaccaccaaggtgatccccagcctgcggccctcgtgaaaagacaagaaaatggggtggcttcctttccatctatgggtgaagcagatgcatggtgagggtcagctcagcgattagaaatttaaaaatgggagatcatggtgaattctcactggggtgattagtggaggaagtctggggaggtgagctactggaagagacagggcaagatgcctcggtggagctgcctgctgaagggtgatattgatgaagacagttgctggtgagtggagatgattgaagggctaggaggtgagggccttcattaattgagatcacgattgaagaagatcccagctctttctggctgatttcagtaaggcttctgacttaagagtctacctatacatcccttccccattgcccaccccgccatctcaatcagtcactgacttttgtttattctgtcctagaaatacctttttt

//

Annotations: