Home |
Help |
Advanced search
2024-04-26 07:44:12, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_005884 2838 bp mRNA linear PRI 02-JUN-2013
DEFINITION Homo sapiens p21 protein (Cdc42/Rac)-activated kinase 4 (PAK4),
transcript variant 1, mRNA.
ACCESSION NM_005884
VERSION NM_005884.3 GI:62422555
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2838)
AUTHORS Kim,S.H., Kim,S.R., Ihm,H.J., Oh,Y.S., Chae,H.D., Kim,C.H. and
Kang,B.M.
TITLE Regulation of P21-activated kinase-4 by progesterone and tumor
necrosis factor-alpha in human endometrium and its increased
expression in advanced-stage endometriosis
JOURNAL J. Clin. Endocrinol. Metab. 98 (2), E238-E248 (2013)
PUBMED 23293332
REMARK GeneRIF: increased expression of Pak4 might lead to the
establishment and progression of endometriosis by enhanced cellular
viability and invasiveness in endometrial cells.
REFERENCE 2 (bases 1 to 2838)
AUTHORS Wang,Z., Zhang,X., Yang,Z., Du,H., Wu,Z., Gong,J., Yan,J. and
Zheng,Q.
TITLE MiR-145 regulates PAK4 via the MAPK pathway and exhibits an
antitumor effect in human colon cells
JOURNAL Biochem. Biophys. Res. Commun. 427 (3), 444-449 (2012)
PUBMED 22766504
REMARK GeneRIF: these findings demonstrate that miR-145 downregulates
P-ERK expression by targeting PAK4 and leads to inhibition of tumor
growth.
REFERENCE 3 (bases 1 to 2838)
AUTHORS Ha,B.H., Davis,M.J., Chen,C., Lou,H.J., Gao,J., Zhang,R.,
Krauthammer,M., Halaban,R., Schlessinger,J., Turk,B.E. and
Boggon,T.J.
TITLE Type II p21-activated kinases (PAKs) are regulated by an
autoinhibitory pseudosubstrate
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 109 (40), 16107-16112 (2012)
PUBMED 22988085
REMARK GeneRIF: Full-length PAK4 is constitutively autoinibited, but
mutation of the pseudosubstrate releases this inhibition.
REFERENCE 4 (bases 1 to 2838)
AUTHORS Baskaran,Y., Ng,Y.W., Selamat,W., Ling,F.T. and Manser,E.
TITLE Group I and II mammalian PAKs have different modes of activation by
Cdc42
JOURNAL EMBO Rep. 13 (7), 653-659 (2012)
PUBMED 22653441
REMARK GeneRIF: PAK4 is strongly inhibited by an auto-inhibitory domain
formed by amino acids 20 to 68.
Publication Status: Online-Only
REFERENCE 5 (bases 1 to 2838)
AUTHORS Kesanakurti,D., Chetty,C., Rajasekhar Maddirela,D., Gujrati,M. and
Rao,J.S.
TITLE Functional cooperativity by direct interaction between PAK4 and
MMP-2 in the regulation of anoikis resistance, migration and
invasion in glioma
JOURNAL Cell Death Dis 3, E445 (2012)
PUBMED 23254288
REMARK GeneRIF: Interaction between PAK4 and MMP-2 regulated anoikis, cell
migration and invasion in glioma.
Publication Status: Online-Only
REFERENCE 6 (bases 1 to 2838)
AUTHORS Lu,Y., Pan,Z.Z., Devaux,Y. and Ray,P.
TITLE p21-activated protein kinase 4 (PAK4) interacts with the
keratinocyte growth factor receptor and participates in
keratinocyte growth factor-mediated inhibition of oxidant-induced
cell death
JOURNAL J. Biol. Chem. 278 (12), 10374-10380 (2003)
PUBMED 12529371
REMARK GeneRIF: PAK4 interacts with KGF receptor and mediate
anti-apoptosis effects of KGF on epithelial cells.
REFERENCE 7 (bases 1 to 2838)
AUTHORS Zhang,H., Li,Z., Viklund,E.K. and Stromblad,S.
TITLE P21-activated kinase 4 interacts with integrin alpha v beta 5 and
regulates alpha v beta 5-mediated cell migration
JOURNAL J. Cell Biol. 158 (7), 1287-1297 (2002)
PUBMED 12356872
REFERENCE 8 (bases 1 to 2838)
AUTHORS Dan,C., Kelly,A., Bernard,O. and Minden,A.
TITLE Cytoskeletal changes regulated by the PAK4 serine/threonine kinase
are mediated by LIM kinase 1 and cofilin
JOURNAL J. Biol. Chem. 276 (34), 32115-32121 (2001)
PUBMED 11413130
REFERENCE 9 (bases 1 to 2838)
AUTHORS Bagrodia,S. and Cerione,R.A.
TITLE Pak to the future
JOURNAL Trends Cell Biol. 9 (9), 350-355 (1999)
PUBMED 10461188
REMARK Review article
REFERENCE 10 (bases 1 to 2838)
AUTHORS Abo,A., Qu,J., Cammarano,M.S., Dan,C., Fritsch,A., Baud,V.,
Belisle,B. and Minden,A.
TITLE PAK4, a novel effector for Cdc42Hs, is implicated in the
reorganization of the actin cytoskeleton and in the formation of
filopodia
JOURNAL EMBO J. 17 (22), 6527-6540 (1998)
PUBMED 9822598
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from BG773480.1, AF005046.1 and
AB032968.1.
On Apr 8, 2005 this sequence version replaced gi:7382497.
Summary: PAK proteins, a family of serine/threonine p21-activating
kinases, include PAK1, PAK2, PAK3 and PAK4. PAK proteins are
critical effectors that link Rho GTPases to cytoskeleton
reorganization and nuclear signaling. They serve as targets for the
small GTP binding proteins Cdc42 and Rac and have been implicated
in a wide range of biological activities. PAK4 interacts
specifically with the GTP-bound form of Cdc42Hs and weakly
activates the JNK family of MAP kinases. PAK4 is a mediator of
filopodia formation and may play a role in the reorganization of
the actin cytoskeleton. Multiple alternatively spliced transcript
variants encoding distinct isoforms have been found for this gene.
[provided by RefSeq, Jul 2008].
Transcript Variant: This variant (1) encodes the longest isoform
(1).
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AF005046.1, AK291839.1 [ECO:0000332]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-42 BG773480.1 26-67
43-2404 AF005046.1 18-2379
2405-2838 AB032968.1 1892-2325
FEATURES Location/Qualifiers
source 1..2838
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="19"
/map="19q13.2"
gene 1..2838
/gene="PAK4"
/note="p21 protein (Cdc42/Rac)-activated kinase 4"
/db_xref="GeneID:10298"
/db_xref="HGNC:16059"
/db_xref="HPRD:05675"
/db_xref="MIM:605451"
exon 1..140
/gene="PAK4"
/inference="alignment:Splign:1.39.8"
variation 56
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:71356837"
variation 74
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:4803205"
variation 102
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:4803206"
variation 116
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:111999288"
exon 141..213
/gene="PAK4"
/inference="alignment:Splign:1.39.8"
misc_feature 146..148
/gene="PAK4"
/note="upstream in-frame stop codon"
variation 151
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:144636460"
variation 155
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:45495801"
variation 182
/gene="PAK4"
/replace="a"
/replace="c"
/db_xref="dbSNP:373493871"
variation 193
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:73933813"
exon 214..439
/gene="PAK4"
/inference="alignment:Splign:1.39.8"
variation 216
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:376621337"
variation 217
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:370008929"
variation 221
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:690929"
variation 222
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:201511246"
variation 224
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:149068416"
variation 229
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:373760840"
variation 230
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:376606539"
CDS 236..2011
/gene="PAK4"
/EC_number="2.7.11.1"
/note="isoform 1 is encoded by transcript variant 1;
protein kinase related to S. cerevisiae STE20, effector
for Cdc42Hs; p21(CDKN1A)-activated kinase 4;
serine/threonine-protein kinase PAK 4; PAK-4;
p21-activated kinase 4"
/codon_start=1
/product="serine/threonine-protein kinase PAK 4 isoform 1"
/protein_id="NP_005875.1"
/db_xref="GI:5031975"
/db_xref="CCDS:CCDS12528.1"
/db_xref="GeneID:10298"
/db_xref="HGNC:16059"
/db_xref="HPRD:05675"
/db_xref="MIM:605451"
/translation="
MFGKRKKRVEISAPSNFEHRVHTGFDQHEQKFTGLPRQWQSLIEESARRPKPLVDPACITSIQPGAPKTIVRGSKGAKDGALTLLLDEFENMSVTRSNSLRRDSPPPPARARQENGMPEEPATTARGGPGKAGSRGRFAGHSEAGGGSGDRRRAGPEKRPKSSREGSGGPQESSRDKRPLSGPDVGTPQPAGLASGAKLAAGRPFNTYPRADTDHPSRGAQGEPHDVAPNGPSAGGLAIPQSSSSSSRPPTRARGAPSPGVLGPHASEPQLAPPACTPAAPAVPGPPGPRSPQREPQRVSHEQFRAALQLVVDPGDPRSYLDNFIKIGEGSTGIVCIATVRSSGKLVAVKKMDLRKQQRRELLFNEVVIMRDYQHENVVEMYNSYLVGDELWVVMEFLEGGALTDIVTHTRMNEEQIAAVCLAVLQALSVLHAQGVIHRDIKSDSILLTHDGRVKLSDFGFCAQVSKEVPRRKSLVGTPYWMAPELISRLPYGPEVDIWSLGIMVIEMVDGEPPYFNEPPLKAMKMIRDNLPPRLKNLHKVSPSLKGFLDRLLVRDPAQRATAAELLKHPFLAKAGPPASIVPLMRQNRTR
"
misc_feature 263..379
/gene="PAK4"
/note="PAK (p21 activated kinase) Binding Domain (PBD),
binds Cdc42p- and/or Rho-like small GTPases; also known as
the Cdc42/Rac interactive binding (CRIB) motif; has been
shown to inhibit transcriptional activation and cell
transformation mediated by the...; Region: CRIB_PAK_like;
cd01093"
/db_xref="CDD:29038"
misc_feature order(266..268,275..277,284..286,290..292,299..301,
350..352,362..364)
/gene="PAK4"
/note="GTPase interaction site [polypeptide binding];
other site"
/db_xref="CDD:29038"
misc_feature 308..1195
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (O96013.1);
Region: Linker"
misc_feature 356..358
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(O96013.1); phosphorylation site"
misc_feature 530..532
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:05675"
misc_feature 545..547
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(O96013.1); phosphorylation site"
misc_feature 545..547
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:05675"
misc_feature 677..679
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(O96013.1); phosphorylation site"
misc_feature 677..679
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:05675"
misc_feature 734..736
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(O96013.1); phosphorylation site"
misc_feature 734..736
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:05675"
misc_feature 776..778
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(O96013.1); phosphorylation site"
misc_feature 776..778
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 776..778
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:05675"
misc_feature 794..796
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine; propagated from
UniProtKB/Swiss-Prot (O96013.1); phosphorylation site"
misc_feature 818..820
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(O96013.1); phosphorylation site"
misc_feature 854..856
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:05675"
misc_feature 1007..1009
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(O96013.1); phosphorylation site"
misc_feature 1007..1009
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:05675"
misc_feature 1034..1036
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(O96013.1); phosphorylation site"
misc_feature 1106..1108
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(O96013.1); phosphorylation site"
misc_feature 1106..1108
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:05675"
misc_feature 1127..1204
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (O96013.1);
Region: GEF-interaction domain (GID)"
misc_feature 1136..1990
/gene="PAK4"
/note="Catalytic domain of the Protein Serine/Threonine
Kinase, Group II p21-activated kinase; Region:
STKc_PAK_II; cd06648"
/db_xref="CDD:132979"
misc_feature 1211..1951
/gene="PAK4"
/note="Serine/Threonine protein kinases, catalytic domain;
Region: S_TKc; smart00220"
/db_xref="CDD:197582"
misc_feature order(1214..1228,1238..1240,1277..1279,1283..1285,
1310..1312,1370..1372,1418..1432,1436..1441,1448..1450,
1553..1555,1559..1570,1574..1576,1604..1609,1616..1618,
1655..1669,1673..1675,1754..1756,1781..1789)
/gene="PAK4"
/note="active site"
/db_xref="CDD:132979"
misc_feature order(1214..1228,1238..1240,1277..1279,1283..1285,
1370..1372,1418..1432,1436..1441,1448..1450,1565..1570,
1574..1576,1604..1609)
/gene="PAK4"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:132979"
misc_feature order(1223..1228,1310..1312,1553..1555,1559..1567,
1616..1618,1655..1669,1673..1675,1754..1756,1781..1789)
/gene="PAK4"
/note="substrate binding site [chemical binding]; other
site"
/db_xref="CDD:132979"
misc_feature 1604..1675
/gene="PAK4"
/note="activation loop (A-loop); other site"
/db_xref="CDD:132979"
misc_feature 1655..1657
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by autocatalysis; propagated from
UniProtKB/Swiss-Prot (O96013.1); phosphorylation site"
misc_feature 1655..1657
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1667..1669
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:05675"
variation 271
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:370966374"
variation 273
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:146498509"
variation 277
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:141017388"
variation 280
/gene="PAK4"
/replace="a"
/replace="c"
/db_xref="dbSNP:200199299"
variation 282
/gene="PAK4"
/replace=""
/replace="a"
/db_xref="dbSNP:66579155"
variation 283
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:199730416"
variation 295
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:114564484"
variation 296
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:146583353"
variation 304
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:199597836"
variation 310
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:113813881"
variation 319
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:75096376"
variation 364
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:373656030"
variation 365
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:200500244"
variation 394
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:377525201"
variation 395
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:148292608"
variation 399
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:112229040"
variation 409
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:200638581"
variation 427
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:141602417"
variation 430
/gene="PAK4"
/replace="g"
/replace="t"
/db_xref="dbSNP:371051871"
variation 431
/gene="PAK4"
/replace="g"
/replace="t"
/db_xref="dbSNP:373324891"
variation 432
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:376845802"
exon 440..898
/gene="PAK4"
/inference="alignment:Splign:1.39.8"
variation 448
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:368355444"
variation 450
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:372186735"
variation 484
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:202071466"
variation 544
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:144141109"
variation 550
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:376964135"
variation 553
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:375296515"
variation 558
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:114116556"
variation 559
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:55711468"
variation 560
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:200319983"
variation 568
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:376684961"
variation 597
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:374813703"
variation 598
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:185941563"
variation 607
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:115339655"
variation 639
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:56099436"
variation 644
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:200644444"
variation 650
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:35655056"
variation 652
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:369143802"
variation 667
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:1045562"
variation 674
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:199622580"
variation 697
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:369129733"
variation 768
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:373168150"
variation 779
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:376102097"
variation 796
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:371641844"
variation 826
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:377431095"
variation 842
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:370979504"
variation 862
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:375542750"
variation 890
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:200780929"
exon 899..1333
/gene="PAK4"
/inference="alignment:Splign:1.39.8"
variation 899
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:370852872"
variation 903
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:371684690"
variation 904
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:138516359"
variation 905
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:375872670"
variation 914
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:200391013"
variation 942
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:368557621"
variation 947
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:371973365"
variation 978
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:199929260"
variation 1003
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:375137743"
variation 1009
/gene="PAK4"
/replace=""
/replace="c"
/db_xref="dbSNP:35120836"
variation 1055
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:200534045"
variation 1070
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:369318453"
variation 1072
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:190702581"
variation 1103
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:375957288"
STS 1129..1425
/gene="PAK4"
/standard_name="MARC_20651-20652:1024691026:1"
/db_xref="UniSTS:268460"
variation 1174
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:369018322"
variation 1181
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:143998317"
variation 1183
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:201587224"
variation 1188
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:147291859"
variation 1216
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:374237195"
variation 1219
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:371904272"
variation 1249
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:370908993"
variation 1253
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:140420249"
variation 1263
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:149267288"
variation 1264
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:144457438"
variation 1279
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:148400225"
exon 1334..1467
/gene="PAK4"
/inference="alignment:Splign:1.39.8"
variation 1361
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:375220515"
variation 1384
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:146831773"
variation 1389
/gene="PAK4"
/replace="a"
/replace="c"
/db_xref="dbSNP:142488595"
variation 1402
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:368459616"
variation 1444
/gene="PAK4"
/replace="a"
/replace="c"
/db_xref="dbSNP:56306494"
variation 1450
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:11559035"
variation 1452
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:146517848"
variation 1453
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:372653621"
exon 1468..1594
/gene="PAK4"
/inference="alignment:Splign:1.39.8"
variation 1474
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:376504839"
variation 1492
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:139956496"
variation 1493
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:370017586"
variation 1513
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:374443098"
variation 1521
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:377696830"
variation 1522
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:116665223"
variation 1531
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:371674508"
variation 1550
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:375117492"
variation 1558
/gene="PAK4"
/replace="a"
/replace="c"
/db_xref="dbSNP:146720735"
variation 1561
/gene="PAK4"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:11559036"
variation 1564
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:141004307"
exon 1595..1720
/gene="PAK4"
/inference="alignment:Splign:1.39.8"
variation 1601
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:11559033"
variation 1647
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:373414547"
variation 1657
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:56286946"
variation 1658
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:11559034"
variation 1663
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:201757969"
variation 1696
/gene="PAK4"
/replace="a"
/replace="c"
/db_xref="dbSNP:200775475"
variation 1701
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:147024501"
variation 1706
/gene="PAK4"
/replace=""
/replace="c"
/db_xref="dbSNP:34054211"
variation 1708
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:138564503"
variation 1711
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:144059751"
exon 1721..1855
/gene="PAK4"
/inference="alignment:Splign:1.39.8"
variation 1735
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:151137853"
variation 1739
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:193920877"
variation 1766
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:141267072"
variation 1776
/gene="PAK4"
/replace="a"
/replace="c"
/db_xref="dbSNP:368539931"
variation 1777
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:146955542"
variation 1786
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:375810830"
variation 1787
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:372098486"
variation 1807
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:111768373"
variation 1813
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:11559037"
variation 1837
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:201791285"
exon 1856..2838
/gene="PAK4"
/inference="alignment:Splign:1.39.8"
variation 1887
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:200026990"
variation 1897
/gene="PAK4"
/replace="g"
/replace="t"
/db_xref="dbSNP:34569811"
variation 1898
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:56084716"
variation 1921
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:55747949"
variation 1928
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:150747591"
variation 1952
/gene="PAK4"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:149210444"
variation 2019
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:371711789"
variation 2047
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:376520116"
variation 2107
/gene="PAK4"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:113335516"
variation 2120
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:186511166"
variation 2183
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:377438234"
variation 2184
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:143251867"
variation 2264
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:3752161"
variation 2292
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:79890280"
variation 2293
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:45573536"
variation 2307
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:374106536"
variation 2392..2393
/gene="PAK4"
/replace=""
/replace="tg"
/db_xref="dbSNP:3833875"
variation 2393..2394
/gene="PAK4"
/replace=""
/replace="tg"
/db_xref="dbSNP:373786885"
variation 2394..2395
/gene="PAK4"
/replace=""
/replace="gt"
/db_xref="dbSNP:142481159"
variation 2405..2406
/gene="PAK4"
/replace=""
/replace="tg"
/db_xref="dbSNP:67439622"
variation 2434
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:13228"
variation 2457
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:114113304"
variation 2485..2486
/gene="PAK4"
/replace=""
/replace="c"
/db_xref="dbSNP:34766623"
variation 2530
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:11559032"
variation 2548..2549
/gene="PAK4"
/replace=""
/replace="tt"
/db_xref="dbSNP:377017717"
variation 2580
/gene="PAK4"
/replace="a"
/replace="c"
/db_xref="dbSNP:114754037"
variation 2641
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:11559031"
STS 2683..2809
/gene="PAK4"
/standard_name="RH12716"
/db_xref="UniSTS:3224"
variation 2772
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:73933820"
variation 2779
/gene="PAK4"
/replace="c"
/replace="g"
/db_xref="dbSNP:11122"
variation 2783
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:45472902"
variation 2800
/gene="PAK4"
/replace="c"
/replace="t"
/db_xref="dbSNP:370782442"
polyA_signal 2815..2820
/gene="PAK4"
variation 2823
/gene="PAK4"
/replace="a"
/replace="g"
/db_xref="dbSNP:181552710"
polyA_site 2832
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
polyA_site 2834
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
polyA_site 2838
/gene="PAK4"
/experiment="experimental evidence, no additional details
recorded"
ORIGIN
agccccggatgttcgttggggattcaacatggcggcgggagtgtccgcggtggtggcggtgcaagagagctgagggaggcgcgagggcgcggagttccaggtcgagcagttaggccgcgagcgactgcggcgccgagccgatgagtaacccgaagcccctagaggagtggtcacctgcctgagggcacttctgtcccaccagcatcagaccaggccgcaccgagtccccggcaccatgtttgggaagaggaagaagcgggtggagatctccgcgccgtccaacttcgagcaccgcgtgcacacgggcttcgaccagcacgagcagaagttcacggggctgccccgccagtggcagagcctgatcgaggagtcggctcgccggcccaagcccctcgtcgaccccgcctgcatcacctccatccagcccggggcccccaagaccatcgtgcggggcagcaaaggtgccaaagatggggccctcacgctgctgctggacgagtttgagaacatgtcggtgacacgctccaactccctgcggagagacagcccgccgccgcccgcccgtgcccgccaggaaaatgggatgccagaggagccggccaccacggccagagggggcccagggaaggcaggcagccgaggccggttcgccggtcacagcgaggcgggtggcggcagtggtgacaggcgacgggcggggccagagaagaggcccaagtcttccagggagggctcagggggtccccaggagtcctcccgggacaaacgccccctctccgggcctgatgtcggcaccccccagcctgctggtctggccagtggggcgaaactggcagctggccggccctttaacacctacccgagggctgacacggaccacccatcccggggtgcccagggggagcctcatgacgtggcccctaacgggccatcagcggggggcctggccatcccccagtcctcctcctcctcctcccggcctcccacccgagcccgaggtgcccccagccctggagtgctgggaccccacgcctcagagccccagctggcccctccagcctgcacccccgccgcccctgctgttcctgggccccctggcccccgctcaccacagcgggagccacagcgagtatcccatgagcagttccgggctgccctgcagctggtggtggacccaggcgacccccgctcctacctggacaacttcatcaagattggcgagggctccacgggcatcgtgtgcatcgccaccgtgcgcagctcgggcaagctggtggccgtcaagaagatggacctgcgcaagcagcagaggcgcgagctgctcttcaacgaggtggtaatcatgagggactaccagcacgagaatgtggtggagatgtacaacagctacctggtgggggacgagctctgggtggtcatggagttcctggaaggaggcgccctcaccgacatcgtcacccacaccaggatgaacgaggagcagatcgcggccgtgtgccttgcagtgctgcaggccctgtcggtgctccacgcccagggcgtcatccaccgggacatcaagagcgactcgatcctgctgacccatgatggcagggtgaagctgtcagactttgggttctgcgcccaggtgagcaaggaagtgccccgaaggaagtcgctggtcggcacgccctactggatggccccagagctcatctcccgccttccctacgggccagaggtagacatctggtcgctggggataatggtgattgagatggtggacggagagcccccctacttcaacgagccacccctcaaagccatgaagatgattcgggacaacctgccaccccgactgaagaacctgcacaaggtgtcgccatccctgaagggcttcctggaccgcctgctggtgcgagaccctgcccagcgggccacggcagccgagctgctgaagcacccattcctggccaaggcagggccgcctgccagcatcgtgcccctcatgcgccagaaccgcaccagatgaggcccagcgcccttcccctcaaccaaagagccccccgggtcacccccgccccactgaggccagtagggggccaggcctcccactcctcccagcccgggagatgctccgcgtggcaccaccctccttgctgggggtagatgagaccctactactgaactccagttttgatctcgtgacttttagaaaaacacagggactcgtgggagcaagcgaggctcccaggacccccaccctctgggacaggccctcccccatgttcttctgtctccaggaagggcagcggccctcccatcactggaagtctgcagtgggggtcgctgggggtggagagaacactaagaggtgaacatgtatgagtgtgtgcacgcgtgtgagtgtgcatgtgtgtgtgtgcaaaggtccagccaccccgtcctccagcctgcaaggggtgtctggcgccttgcctgacacccagccccctctccccctgagccattgtgggggtcgatcatgaatgtccgaagagtggccttttcccgtagccctgcgccccctttctgtggctggatggggagacaggtcagggccccccaccctctccagcccctgcagcaaatgactactgcacctggacagcctcctcttttctagaagtctatttatattgtcattttataacactctagcccctgcccttattgggggacagatggtccctgtcctgcggggtggccctggcagaaccactgcctgaagaaccaggttcctgcccggtcagcgcagccccagcccgcccacccctgcctcgagttagttttacaattaaaacattgtcttgttttgtg
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:10298 -> Molecular function: GO:0004672 [protein kinase activity] evidence: NAS
GeneID:10298 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: IEA
GeneID:10298 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
GeneID:10298 -> Biological process: GO:0006915 [apoptotic process] evidence: TAS
GeneID:10298 -> Biological process: GO:0006928 [cellular component movement] evidence: TAS
GeneID:10298 -> Biological process: GO:0007010 [cytoskeleton organization] evidence: TAS
GeneID:10298 -> Biological process: GO:0007049 [cell cycle] evidence: IEA
GeneID:10298 -> Biological process: GO:0007165 [signal transduction] evidence: TAS
GeneID:10298 -> Biological process: GO:0008283 [cell proliferation] evidence: TAS
GeneID:10298 -> Biological process: GO:0016049 [cell growth] evidence: TAS
GeneID:10298 -> Biological process: GO:0016477 [cell migration] evidence: TAS
GeneID:10298 -> Cellular component: GO:0005794 [Golgi apparatus] evidence: TAS
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_005875 -> EC 2.7.11.1
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.