GGRNA Home | Help | Advanced search

2020-10-26 19:28:58, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_005876              10650 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens SPEG complex locus (SPEG), transcript variant 1, mRNA.
ACCESSION   NM_005876 XM_051005
VERSION     NM_005876.4  GI:157785644
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 10650)
  AUTHORS   Bailey,S.D., Xie,C., Do,R., Montpetit,A., Diaz,R., Mohan,V.,
            Keavney,B., Yusuf,S., Gerstein,H.C., Engert,J.C. and Anand,S.
  CONSRTM   DREAM investigators
  TITLE     Variation at the NFATC2 locus increases the risk of
            thiazolidinedione-induced edema in the Diabetes REduction
            Assessment with ramipril and rosiglitazone Medication (DREAM) study
  JOURNAL   Diabetes Care 33 (10), 2250-2253 (2010)
   PUBMED   20628086
  REMARK    GeneRIF: Observational study of gene-disease association,
            gene-environment interaction, and pharmacogenomic / toxicogenomic.
            (HuGE Navigator)
REFERENCE   2  (bases 1 to 10650)
  AUTHORS   Talmud,P.J., Drenos,F., Shah,S., Shah,T., Palmen,J., Verzilli,C.,
            Gaunt,T.R., Pallas,J., Lovering,R., Li,K., Casas,J.P., Sofat,R.,
            Kumari,M., Rodriguez,S., Johnson,T., Newhouse,S.J., Dominiczak,A.,
            Samani,N.J., Caulfield,M., Sever,P., Stanton,A., Shields,D.C.,
            Padmanabhan,S., Melander,O., Hastie,C., Delles,C., Ebrahim,S.,
            Marmot,M.G., Smith,G.D., Lawlor,D.A., Munroe,P.B., Day,I.N.,
            Kivimaki,M., Whittaker,J., Humphries,S.E. and Hingorani,A.D.
  CONSRTM   ASCOT investigators; NORDIL investigators; BRIGHT Consortium
  TITLE     Gene-centric association signals for lipids and apolipoproteins
            identified via the HumanCVD BeadChip
  JOURNAL   Am. J. Hum. Genet. 85 (5), 628-642 (2009)
   PUBMED   19913121
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   3  (bases 1 to 10650)
  AUTHORS   Tam,J.L., Triantaphyllopoulos,K., Todd,H., Raguz,S., de Wit,T.,
            Morgan,J.E., Partridge,T.A., Makrinou,E., Grosveld,F. and
            Antoniou,M.
  TITLE     The human desmin locus: gene organization and LCR-mediated
            transcriptional control
  JOURNAL   Genomics 87 (6), 733-746 (2006)
   PUBMED   16545539
REFERENCE   4  (bases 1 to 10650)
  AUTHORS   Hillier,L.W., Graves,T.A., Fulton,R.S., Fulton,L.A., Pepin,K.H.,
            Minx,P., Wagner-McPherson,C., Layman,D., Wylie,K., Sekhon,M.,
            Becker,M.C., Fewell,G.A., Delehaunty,K.D., Miner,T.L., Nash,W.E.,
            Kremitzki,C., Oddy,L., Du,H., Sun,H., Bradshaw-Cordum,H., Ali,J.,
            Carter,J., Cordes,M., Harris,A., Isak,A., van Brunt,A., Nguyen,C.,
            Du,F., Courtney,L., Kalicki,J., Ozersky,P., Abbott,S.,
            Armstrong,J., Belter,E.A., Caruso,L., Cedroni,M., Cotton,M.,
            Davidson,T., Desai,A., Elliott,G., Erb,T., Fronick,C., Gaige,T.,
            Haakenson,W., Haglund,K., Holmes,A., Harkins,R., Kim,K.,
            Kruchowski,S.S., Strong,C.M., Grewal,N., Goyea,E., Hou,S., Levy,A.,
            Martinka,S., Mead,K., McLellan,M.D., Meyer,R., Randall-Maher,J.,
            Tomlinson,C., Dauphin-Kohlberg,S., Kozlowicz-Reilly,A., Shah,N.,
            Swearengen-Shahid,S., Snider,J., Strong,J.T., Thompson,J.,
            Yoakum,M., Leonard,S., Pearman,C., Trani,L., Radionenko,M.,
            Waligorski,J.E., Wang,C., Rock,S.M., Tin-Wollam,A.M., Maupin,R.,
            Latreille,P., Wendl,M.C., Yang,S.P., Pohl,C., Wallis,J.W.,
            Spieth,J., Bieri,T.A., Berkowicz,N., Nelson,J.O., Osborne,J.,
            Ding,L., Meyer,R., Sabo,A., Shotland,Y., Sinha,P., Wohldmann,P.E.,
            Cook,L.L., Hickenbotham,M.T., Eldred,J., Williams,D., Jones,T.A.,
            She,X., Ciccarelli,F.D., Izaurralde,E., Taylor,J., Schmutz,J.,
            Myers,R.M., Cox,D.R., Huang,X., McPherson,J.D., Mardis,E.R.,
            Clifton,S.W., Warren,W.C., Chinwalla,A.T., Eddy,S.R., Marra,M.A.,
            Ovcharenko,I., Furey,T.S., Miller,W., Eichler,E.E., Bork,P.,
            Suyama,M., Torrents,D., Waterston,R.H. and Wilson,R.K.
  TITLE     Generation and annotation of the DNA sequences of human chromosomes
            2 and 4
  JOURNAL   Nature 434 (7034), 724-731 (2005)
   PUBMED   15815621
REFERENCE   5  (bases 1 to 10650)
  AUTHORS   Arvanitis,D.A., Flouris,G.A. and Spandidos,D.A.
  TITLE     Genomic rearrangements on VCAM1, SELE, APEG1and AIF1 loci in
            atherosclerosis
  JOURNAL   J. Cell. Mol. Med. 9 (1), 153-159 (2005)
   PUBMED   15784173
  REMARK    GeneRIF: Genomic rearrangement on APEG1 in arteriosclerosis was
            studied.
REFERENCE   6  (bases 1 to 10650)
  AUTHORS   Manjasetty,B.A., Niesen,F.H., Scheich,C., Roske,Y., Goetz,F.,
            Behlke,J., Sievert,V., Heinemann,U. and Bussow,K.
  TITLE     X-ray structure of engineered human Aortic Preferentially Expressed
            Protein-1 (APEG-1)
  JOURNAL   BMC Struct. Biol. 5, 21 (2005)
   PUBMED   16354304
  REMARK    GeneRIF: the RGD motif might play a role not only in the adhesion
            of Aortic Preferentially Expressed Protein-1 and extracellular
            proteins but also in intracellular protein-protein interactions
            Publication Status: Online-Only
REFERENCE   7  (bases 1 to 10650)
  AUTHORS   Sutter,S.B., Raeker,M.O., Borisov,A.B. and Russell,M.W.
  TITLE     Orthologous relationship of obscurin and Unc-89: phylogeny of a
            novel family of tandem myosin light chain kinases
  JOURNAL   Dev. Genes Evol. 214 (7), 352-359 (2004)
   PUBMED   15185077
REFERENCE   8  (bases 1 to 10650)
  AUTHORS   Hsieh,C.M., Yet,S.F., Layne,M.D., Watanabe,M., Hong,A.M.,
            Perrella,M.A. and Lee,M.E.
  TITLE     Genomic cloning and promoter analysis of aortic preferentially
            expressed gene-1. Identification of a vascular smooth
            muscle-specific promoter mediated by an E box motif
  JOURNAL   J. Biol. Chem. 274 (20), 14344-14351 (1999)
   PUBMED   10318857
REFERENCE   9  (bases 1 to 10650)
  AUTHORS   Hsieh,C.M., Yoshizumi,M., Endege,W.O., Kho,C.J., Jain,M.K.,
            Kashiki,S., de los Santos,R., Lee,W.S., Perrella,M.A. and Lee,M.E.
  TITLE     APEG-1, a novel gene preferentially expressed in aortic smooth
            muscle cells, is down-regulated by vascular injury
  JOURNAL   J. Biol. Chem. 271 (29), 17354-17359 (1996)
   PUBMED   8663449
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC053503.7.
            On Oct 1, 2007 this sequence version replaced gi:37577150.
            
            Summary: This gene encodes a protein with similarity to members of
            the myosin light chain kinase family. This protein family is
            required for myocyte cytoskeletal development. Studies in mouse
            have determined that a lack of this protein affected myocardial
            development. Multiple alternatively spliced transcript variants
            have been reported for this gene, but the full-length nature of
            only two variants that encode different protein isoforms has been
            defined. [provided by RefSeq, Mar 2010].
            
            Transcript Variant: This variant (1) represents the longer
            transcript and it encodes the longer protein (isoform 1). This
            variant corresponds to the mouse SPEGbeta variant described in
            PubMed ID: 10973969.
            
            ##Evidence-Data-START##
            RNAseq introns :: single sample supports all introns ERS025083,
                              ERS025088 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-388               AC053503.7         92782-93169
            389-478             AC053503.7         102457-102546
            479-815             AC053503.7         102629-102965
            816-2113            AC053503.7         105778-107075
            2114-2257           AC053503.7         108940-109083
            2258-2440           AC053503.7         109429-109611
            2441-2616           AC053503.7         119686-119861
            2617-2705           AC053503.7         120102-120190
            2706-2881           AC053503.7         122237-122412
            2882-3142           AC053503.7         124978-125238
            3143-3301           AC053503.7         126382-126540
            3302-3491           AC053503.7         126663-126852
            3492-3715           AC053503.7         126960-127183
            3716-3835           AC053503.7         129672-129791
            3836-3940           AC053503.7         130031-130135
            3941-4147           AC053503.7         130694-130900
            4148-4271           AC053503.7         131308-131431
            4272-4447           AC053503.7         131532-131707
            4448-4560           AC053503.7         134674-134786
            4561-4729           AC053503.7         135081-135249
            4730-4826           AC053503.7         135493-135589
            4827-5027           AC053503.7         135709-135909
            5028-5085           AC053503.7         136948-137005
            5086-5163           AC053503.7         137587-137664
            5164-5342           AC053503.7         137766-137944
            5343-5369           AC053503.7         138475-138501
            5370-5522           AC053503.7         139108-139260
            5523-5565           AC053503.7         139442-139484
            5566-5634           AC053503.7         140588-140656
            5635-7609           AC053503.7         140902-142876
            7610-7741           AC053503.7         143150-143281
            7742-7858           AC053503.7         145998-146114
            7859-8026           AC053503.7         146302-146469
            8027-8149           AC053503.7         146582-146704
            8150-8317           AC053503.7         146858-147025
            8318-8921           AC053503.7         147140-147743
            8922-9161           AC053503.7         148213-148452
            9162-9385           AC053503.7         148537-148760
            9386-9461           AC053503.7         149598-149673
            9462-9611           AC053503.7         149915-150064
            9612-10650          AC053503.7         150398-151436
FEATURES             Location/Qualifiers
     source          1..10650
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
                     /map="2q35"
     gene            1..10650
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="SPEG complex locus"
                     /db_xref="GeneID:10290"
                     /db_xref="HGNC:16901"
     CDS             1..9804
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /EC_number="2.7.11.1"
                     /note="isoform 1 is encoded by transcript variant 1;
                     aortic preferentially expressed gene 1; aortic
                     preferentially expressed protein 1; nuclear protein,
                     marker for differentiated aortic smooth muscle and
                     down-regulated with vascular injury; striated muscle
                     preferentially expressed protein kinase"
                     /codon_start=1
                     /product="striated muscle preferentially expressed protein
                     kinase isoform 1"
                     /protein_id="NP_005867.3"
                     /db_xref="GI:157785645"
                     /db_xref="CCDS:CCDS42824.1"
                     /db_xref="GeneID:10290"
                     /db_xref="HGNC:16901"
                     /translation="
MQKARGTRGEDAGTRAPPSPGVPPKRAKVGAGGGAPVAVAGAPVFLRPLKNAAVCAGSDVRLRVVVSGTPQPSLRWFRDGQLLPAPAPEPSCLWLRRCGAQDAGVYSCMAQNERGRASCEAVLTVLEVGDSETAEDDISDVQGTQRLELRDDGAFSTPTGGSDTLVGTSLDTPPTSVTGTSEEQVSWWGSGQTVLEQEAGSGGGTRRLPGSPRQAQATGAGPRHLGVEPLVRASRANLVGASWGSEDSLSVASDLYGSAFSLYRGRALSIHVSVPQSGLRREEPDLQPQLASEAPRRPAQPPPSKSALLPPPSPRVGKRSPPGPPAQPAATPTSPHRRTQEPVLPEDTTTEEKRGKKSKSSGPSLAGTAESRPQTPLSEASGRLSALGRSPRLVRAGSRILDKLQFFEERRRSLERSDSPPAPLRPWVPLRKARSLEQPKSERGAPWGTPGASQEELRAPGSVAERRRLFQQKAASLDERTRQRSPASDLELRFAQELGRIRRSTSREELVRSHESLRATLQRAPSPREPGEPPLFSRPSTPKTSRAVSPAAAQPPSPSSAEKPGDEPGRPRSRGPAGRTEPGEGPQQEVRRRDQFPLTRSRAIQECRSPVPPPAADPPEARTKAPPGRKREPPAQAVRFLPWATPGLEGAAVPQTLEKNRAGPEAEKRLRRGPEEDGPWGPWDRRGARSQGKGRRARPTSPELESSDDSYVSAGEEPLEAPVFEIPLQNVVVAPGADVLLKCIITANPPPQVSWHKDGSALRSEGRLLLRAEGERHTLLLREARAADAGSYMATATNELGQATCAASLTVRPGGSTSPFSSPITSDEEYLSPPEEFPEPGETWPRTPTMKPSPSQNRRSSDTGSKAPPTFKVSLMDQSVREGQDVIMSIRVQGEPKPVVSWLRNRQPVRPDQRRFAEEAEGGLCRLRILAAERGDAGFYTCKAVNEYGARQCEARLEVRAHPESRSLAVLAPLQDVDVGAGEMALFECLVAGPTDVEVDWLCRGRLLQPALLKCKMHFDGRKCKLLLTSVHEDDSGVYTCKLSTAKDELTCSARLTVRPSLAPLFTRLLEDVEVLEGRAARFDCKISGTPPPVVTWTHFGCPMEESENLRLRQDGGLHSLHIAHVGSEDEGLYAVSAVNTHGQAHCSAQLYVEEPRTAASGPSSKLEKMPSIPEEPEQGELERLSIPDFLRPLQDLEVGLAKEAMLECQVTGLPYPTISWFHNGHRIQSSDDRRMTQYRDVHRLVFPAVGPQHAGVYKSVIANKLGKAACYAHLYVTDVVPGPPDGAPQVVAVTGRMVTLTWNPPRSLDMAIDPDSLTYTVQHQVLGSDQWTALVTGLREPGWAATGLRKGVQHIFRVLSTTVKSSSKPSPPSEPVQLLEHGPTLEEAPAMLDKPDIVYVVEGQPASVTVTFNHVEAQVVWRSCRGALLEARAGVYELSQPDDDQYCLRICRVSRRDMGALTCTARNRHGTQTCSVTLELAEAPRFESIMEDVEVGAGETARFAVVVEGKPLPDIMWYKDEVLLTESSHVSFVYEENECSLVVLSTGAQDGGVYTCTAQNLAGEVSCKAELAVHSAQTAMEVEGVGEDEDHRGRRLSDFYDIHQEIGRGAFSYLRRIVERSSGLEFAAKFIPSQAKPKASARREARLLARLQHDCVLYFHEAFERRRGLVIVTELCTEELLERIARKPTVCESEIRAYMRQVLEGIHYLHQSHVLHLDVKPENLLVWDGAAGEQQVRICDFGNAQELTPGEPQYCQYGTPEFVAPEIVNQSPVSGVTDIWPVGVVAFLCLTGISPFVGENDRTTLMNIRNYNVAFEETTFLSLSREARGFLIKVLVQDRLRPTAEETLEHPWFKTQAKGAEVSTDHLKLFLSRRRWQRSQISYKCHLVLRPIPELLRAPPERVWVTMPRRPPPSGGLSSSSDSEEEELEELPSVPRPLQPEFSGSRVSLTDIPTEDEALGTPETGAATPMDWQEQGRAPSQDQEAPSPEALPSPGQEPAAGASPRRGELRRGSSAESALPRAGPRELGRGLHKAASVELPQRRSPSPGATRLARGGLGEGEYAQRLQALRQRLLRGGPEDGKVSGLRGPLLESLGGRARDPRMARAASSEAAPHHQPPLENRGLQKSSSFSQGEAEPRGRHRRAGAPLEIPVARLGARRLQESPSLSALSEAQPSSPARPSAPKPSTPKSAEPSATTPSDAPQPPAPQPAQDKAPEPRPEPVRASKPAPPPQALQTLALPLTPYAQIIQSLQLSGHAQGPSQGPAAPPSEPKPHAAVFARVASPPPGAPEKRVPSAGGPPVLAEKARVPTVPPRPGSSLSSSIENLESEAVFEAKFKRSRESPLSLGLRLLSRSRSEERGPFRGAEEEDGIYRPSPAGTPLELVRRPERSRSVQDLRAVGEPGLVRRLSLSLSQRLRRTPPAQRHPAWEARGGDGESSEGGSSARGSPVLAMRRRLSFTLERLSSRLQRSGSSEDSGGASGRSTPLFGRLRRATSEGESLRRLGLPHNQLAAQAGATTPSAESLGSEASATSGSSAPGESRSRLRWGFSRPRKDKGLSPPNLSASVQEELGHQYVRSESDFPPVFHIKLKDQVLLEGEAATLLCLPAACPAPHISWMKDKKSLRSEPSVIIVSCKDGRQLLSIPRAGKRHAGLYECSATNVLGSITSSCTVAVARVPGKLAPPEVPQTYQDTALVLWKPGDSRAPCTYTLERRVDGESVWHPVSSGIPDCYYNVTHLPVGVTVRFRVACANRAGQGPFSNSSEKVFVRGTQDSSAVPSAAHQEAPVTSRPARARPPDSPTSLAPPLAPAAPTPPSVTVSPSSPPTPPSQALSSLKAVGPPPQTPPRRHRGLQAARPAEPTLPSTHVTPSEPKPFVLDTGTPIPASTPQGVKPVSSSTPVYVVTSFVSAPPAPEPPAPEPPPEPTKVTVQSLSPAKEVVSSPGSSPRSSPRPEGTTLRQGPPQKPYTFLEEKARGRFGVVRACRENATGRTFVAKIVPYAAEGKRRVLQEYEVLRTLHHERIMSLHEAYITPRYLVLIAESCGNRELLCGLSDRFRYSEDDVATYMVQLLQGLDYLHGHHVLHLDIKPDNLLLAPDNALKIVDFGSAQPYNPQALRPLGHRTGTLEFMAPEMVKGEPIGSATDIWGAGVLTYIMLSGRSPFYEPDPQETEARIVGGRFDAFQLYPNTSQSATLFLRKVLSVHPWSRPSLQDCLAHPWLQDAYLMKLRRQTLTFTTNRLKEFLGEQRRRRAEAATRHKVLLRSYPGGP
"
     misc_feature    133..375
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    166..375
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    2164..2433
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    2185..2433
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    2605..2877
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    2656..2868
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    2917..3174
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    2953..3165
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    3190..3459
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    3211..3459
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    3562..3831
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    3613..3831
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    3844..>4077
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(3844..3846,4051..4053)
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    4168..4440
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    4195..4440
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    4453..4722
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    4504..4713
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    4801..5562
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="Serine/Threonine protein kinases, catalytic domain;
                     Region: S_TKc; smart00220"
                     /db_xref="CDD:197582"
     misc_feature    4819..5556
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="Catalytic domain of Protein Kinases; Region: PKc;
                     cd00180"
                     /db_xref="CDD:173623"
     misc_feature    order(4819..4833,4843..4845,4882..4884,4888..4890,
                     4972..4974,5020..5031,5038..5040,5044..5046,5155..5157,
                     5161..5163,5167..5172,5176..5178,5221..5223,5230..5232,
                     5275..5286)
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="active site"
                     /db_xref="CDD:173623"
     misc_feature    order(4819..4833,4843..4845,4882..4884,4888..4890,
                     4972..4974,5020..5031,5038..5040,5155..5157,5161..5163,
                     5167..5172,5176..5178,5221..5223)
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:173623"
     misc_feature    order(4831..4833,5038..5040,5044..5046,5155..5157,
                     5161..5163,5167..5169,5230..5232,5275..5286)
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="substrate binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:173623"
     misc_feature    order(5218..5238,5275..5286)
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:173623"
     misc_feature    7750..8022
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    7840..8013
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    8032..8292
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(8032..8034,8218..8220,8263..8265)
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(8266..8271,8275..8280)
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    8896..9654
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="Serine/Threonine protein kinases, catalytic domain;
                     Region: S_TKc; smart00220"
                     /db_xref="CDD:197582"
     misc_feature    8920..9651
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="Protein Kinases, catalytic domain; Region:
                     PKc_like; cl09925"
                     /db_xref="CDD:213116"
     misc_feature    order(8920..8928,8938..8940,8977..8979,9067..9069,
                     9115..9126,9136..9138,9142..9144,9253..9255,9259..9261,
                     9265..9270,9274..9276,9307..9309,9316..9318,9367..9378)
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="active site"
                     /db_xref="CDD:173623"
     misc_feature    order(8920..8928,8938..8940,8977..8979,9067..9069,
                     9115..9126,9136..9138,9253..9255,9259..9261,9265..9270,
                     9274..9276,9307..9309)
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:173623"
     misc_feature    order(8926..8928,9136..9138,9142..9144,9253..9255,
                     9259..9261,9265..9267,9316..9318,9367..9378)
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="substrate binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:173623"
     misc_feature    order(9304..9324,9367..9378)
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:173623"
     exon            1..388
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    <1..>388
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="CpG_island (%GC=74.2, o/e=0.70, #CpGs=77)"
     variation       28
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112443658"
     variation       153
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368226647"
     variation       213
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1631112"
     variation       218
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1685312"
     variation       384..385
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:138977525"
     exon            389..478
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       411
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372972124"
     variation       418
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202151661"
     variation       427
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370248588"
     variation       449
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373672756"
     variation       456
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201002745"
     exon            479..815
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       528
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376916155"
     misc_feature    570..>815
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="CpG_island (%GC=68.0, o/e=0.65, #CpGs=20)"
     variation       592
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371146997"
     variation       596
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200153486"
     variation       617
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:55821435"
     variation       620
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202020343"
     variation       654..655
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:35215202"
     variation       655
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375417298"
     variation       687
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367946927"
     variation       692
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371955992"
     variation       695
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376613097"
     variation       714
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369001739"
     variation       749
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372300281"
     variation       769
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376718418"
     exon            816..2113
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    819..>2113
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="CpG_island (%GC=74.2, o/e=0.78, #CpGs=153)"
     STS             850..1074
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /standard_name="REN52879"
                     /db_xref="UniSTS:377679"
     variation       850
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:202119047"
     variation       868
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374764126"
     variation       938
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:34325548"
     variation       984
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187565836"
     variation       1046
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371077558"
     STS             1061..1321
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /standard_name="REN52880"
                     /db_xref="UniSTS:377680"
     variation       1072
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375734230"
     variation       1107
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368196077"
     variation       1135
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376123227"
     variation       1152
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202113113"
     variation       1231
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201189275"
     variation       1314
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369373336"
     variation       1338
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:192560937"
     variation       1490
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:146216760"
     STS             1603..1828
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /standard_name="REN52881"
                     /db_xref="UniSTS:377681"
     variation       1753
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200066956"
     STS             1768..2018
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /standard_name="REN52882"
                     /db_xref="UniSTS:377682"
     variation       1800
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:60593157"
     variation       1887
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367886901"
     variation       1916
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373031408"
     variation       2001
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376225112"
     variation       2019
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139165503"
     exon            2114..2257
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       2133
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371768029"
     variation       2134
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375953839"
     variation       2161
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368756743"
     variation       2217
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372147992"
     variation       2226
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10932806"
     variation       2249
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369405843"
     variation       2250
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:56237719"
     variation       2251
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376130056"
     variation       2252
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369116326"
     exon            2258..2440
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       2316
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:372369079"
     variation       2340
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369562969"
     variation       2381
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201205287"
     variation       2385
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370288115"
     variation       2408
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374412707"
     variation       2429
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367597799"
     variation       2439
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372257767"
     exon            2441..2616
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       2460
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1128571"
     variation       2530
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200230701"
     variation       2533
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369395171"
     variation       2553
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372763169"
     variation       2554
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373524622"
     variation       2567..2570
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace=""
                     /replace="agaa"
                     /db_xref="dbSNP:148739543"
     variation       2572
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199582765"
     variation       2602
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374647445"
     exon            2617..2705
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       2667
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373573212"
     exon            2706..2881
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       2716
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368595613"
     variation       2717
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372084593"
     variation       2724
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375268036"
     variation       2741
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200848544"
     variation       2751
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368240598"
     variation       2767
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372109211"
     variation       2777
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376823807"
     variation       2800
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34398769"
     variation       2809
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368967456"
     variation       2859
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35665419"
     exon            2882..3142
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       2897
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34861443"
     variation       2908
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377353278"
     variation       2931
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369454020"
     variation       2943
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372494202"
     variation       3004
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114572727"
     variation       3005..3006
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:146732993"
     variation       3010
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200618676"
     variation       3030
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375946892"
     variation       3042
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61741762"
     variation       3060
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61747228"
     variation       3068
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200136733"
     variation       3074
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201454314"
     variation       3111
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375637468"
     variation       3120
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371524591"
     variation       3129
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:55808595"
     variation       3134
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:62191886"
     exon            3143..3301
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       3164
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35181232"
     variation       3183
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201812370"
     variation       3187
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202124859"
     variation       3192
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373709091"
     variation       3193
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367920348"
     variation       3195
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181367060"
     variation       3202
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200437079"
     variation       3241
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376615999"
     variation       3267
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201254553"
     variation       3271
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375847369"
     variation       3273
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369913466"
     variation       3276
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:111484382"
     STS             3279..3420
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /standard_name="REN52968"
                     /db_xref="UniSTS:377768"
     variation       3285
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373106016"
     variation       3287
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376059193"
     variation       3296
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369304035"
     exon            3302..3491
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       3308
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:56334571"
     variation       3319
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368200977"
     variation       3331
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370678092"
     variation       3345
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185911101"
     variation       3363
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148131894"
     variation       3371
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11691264"
     variation       3390
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371373509"
     variation       3391
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199908320"
     STS             3396..3520
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /standard_name="REN52969"
                     /db_xref="UniSTS:377769"
     variation       3404
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:55670811"
     variation       3422
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368600044"
     variation       3456
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189442728"
     variation       3477
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372151356"
     exon            3492..3715
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       3504
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373200427"
     variation       3522
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376913006"
     variation       3528
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:55759642"
     variation       3554..3555
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:377152797"
     variation       3564
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:10167209"
     variation       3606
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201544999"
     variation       3613
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200111445"
     variation       3645
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374311978"
     variation       3693
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200872790"
     variation       3694
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370971164"
     variation       3700
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:55916864"
     variation       3714
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368014313"
     exon            3716..3835
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       3747
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372261652"
     variation       3753
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375403571"
     variation       3762
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368441604"
     variation       3782
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371872221"
     variation       3810
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376217306"
     variation       3827
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187558456"
     exon            3836..3940
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       3862
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368670007"
     variation       3895
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374660413"
     variation       3915
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201570330"
     variation       3928
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116911250"
     variation       3931
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369698029"
     exon            3941..4147
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       3947
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:377373189"
     variation       3952
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141166555"
     variation       3956
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376189723"
     variation       3957
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187561391"
     variation       3963
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370107926"
     variation       3969
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:55876679"
     variation       3993
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368564757"
     variation       3998
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76811720"
     variation       3999
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:55684906"
     variation       4015
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368202336"
     variation       4019
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34994343"
     variation       4029
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370418050"
     variation       4048
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201464052"
     variation       4049
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376367804"
     variation       4063
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368975904"
     variation       4117
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200713879"
     exon            4148..4271
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       4167
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370013462"
     variation       4186
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373818812"
     STS             4227..4358
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /standard_name="REN52989"
                     /db_xref="UniSTS:377789"
     variation       4231
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115558647"
     variation       4258
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376768702"
     exon            4272..4447
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       4298
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200847303"
     variation       4303
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370227187"
     variation       4382
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376063479"
     variation       4386
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200679355"
     variation       4395
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373787958"
     variation       4400
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181222936"
     variation       4415
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371049113"
     variation       4419
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:185047969"
     exon            4448..4560
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       4488
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371966193"
     variation       4499
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77091582"
     variation       4514
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376625081"
     variation       4551
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367579778"
     exon            4561..4729
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       4566
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:45519033"
     variation       4578
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202153500"
     variation       4590
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200342872"
     variation       4605
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202010201"
     variation       4613
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:56310829"
     variation       4683
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182099307"
     variation       4688
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150628707"
     variation       4724
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:202127635"
     exon            4730..4826
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       4741
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368210777"
     variation       4759
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200114716"
     variation       4766
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200647535"
     variation       4778
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375071179"
     variation       4821
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367845533"
     exon            4827..5027
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       4849
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201670112"
     variation       4850
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200758666"
     variation       4861
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:55646900"
     variation       4869
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369092148"
     variation       4883
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199971371"
     variation       4884
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373012879"
     variation       4928
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:79987208"
     variation       4930
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371553667"
     variation       4974
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374325938"
     variation       4976
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188341907"
     variation       4999
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149716323"
     variation       5000
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375420359"
     variation       5022
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367927261"
     exon            5028..5085
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       5033
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:56318035"
     variation       5055
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151167400"
     exon            5086..5163
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       5112
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374527862"
     variation       5142
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368444908"
     variation       5143
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371881372"
     exon            5164..5342
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       5195
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202224806"
     variation       5196
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61743627"
     variation       5200
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375882609"
     variation       5211
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368865091"
     variation       5242
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201323507"
     variation       5289
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377721845"
     variation       5292
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:56357558"
     variation       5298
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369667103"
     variation       5307
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374198394"
     variation       5319
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376664998"
     exon            5343..5369
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       5353
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201196109"
     exon            5370..5522
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       5388
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368256206"
     variation       5414
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372120697"
     variation       5416
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76541595"
     variation       5448
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200268589"
     variation       5449
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369290013"
     variation       5468
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200591033"
     variation       5485
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376444717"
     variation       5518
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369971008"
     exon            5523..5565
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       5541
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190001816"
     variation       5548
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377029891"
     variation       5562
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373463101"
     exon            5566..5634
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       5569
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373797506"
     variation       5582
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375623889"
     exon            5635..7609
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       5635
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113853448"
     STS             5651..5875
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /standard_name="REN53030"
                     /db_xref="UniSTS:377830"
     variation       5682
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376671564"
     variation       5685
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370779127"
     variation       5710
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370032839"
     variation       5722
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200747365"
     variation       5724
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199758082"
     variation       5743
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199549168"
     variation       5751
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:56166111"
     variation       5809
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371924301"
     variation       5823
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200932789"
     variation       5828
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:376594714"
     variation       5829
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:13027253"
     variation       5866
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367549564"
     variation       5876
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200949797"
     variation       5891
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:55760738"
     variation       5894
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372403225"
     variation       5931
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372924696"
     variation       5940
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374137151"
     misc_feature    6019..7599
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /note="CpG_island (%GC=73.3, o/e=0.63, #CpGs=145)"
     variation       6075
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375182266"
     STS             6171..6405
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /standard_name="REN53031"
                     /db_xref="UniSTS:377831"
     variation       6243
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375825344"
     variation       6293
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200010011"
     variation       6358
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201901718"
     STS             6385..6575
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /standard_name="stSG633028"
                     /db_xref="UniSTS:460387"
     variation       6393
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373080805"
     variation       6408
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376371756"
     variation       6414
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183234878"
     variation       6417
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188878582"
     STS             6486..6745
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /standard_name="REN53032"
                     /db_xref="UniSTS:377832"
     variation       6538
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369282283"
     STS             6550..7244
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /standard_name="ECD06960"
                     /db_xref="UniSTS:288018"
     variation       6566
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:10755037"
     variation       6591
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201000374"
     variation       6607
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375706128"
     variation       6631
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:193110283"
     variation       6659
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370142276"
     variation       6674
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200434656"
     variation       6682
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374066223"
     variation       6692
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:183551699"
     variation       6694
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371302780"
     variation       6695
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201950092"
     STS             6727..6980
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /standard_name="REN53033"
                     /db_xref="UniSTS:377833"
     variation       6732
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201187025"
     variation       6734
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200650051"
     variation       6739
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368710118"
     variation       6740
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371425074"
     variation       6769
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188481500"
     variation       6782
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:79250336"
     variation       6823
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:367818033"
     variation       6854
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199997533"
     variation       6895
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:191716389"
     variation       6904
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:78698533"
     STS             6957..7205
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /standard_name="REN53034"
                     /db_xref="UniSTS:377834"
     variation       6971
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201170917"
     variation       6987
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368733695"
     variation       7022
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184307101"
     variation       7055
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201587577"
     variation       7059
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372666559"
     variation       7170
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:73087217"
     STS             7182..7429
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /standard_name="REN53035"
                     /db_xref="UniSTS:377835"
     variation       7200
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:62191887"
     variation       7262
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376076241"
     variation       7299
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:113350065"
     variation       7415
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188275300"
     variation       7457
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372980452"
     variation       7504
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:191238352"
     variation       7583
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:184383723"
     exon            7610..7741
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       7632
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372553349"
     variation       7636
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376889333"
     variation       7639
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371117209"
     variation       7655
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373771648"
     variation       7671
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377683225"
     variation       7672
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:370944996"
     variation       7676
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375369894"
     variation       7685
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201527296"
     variation       7710
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377520775"
     variation       7711
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:56006044"
     variation       7719
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148856428"
     variation       7722
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370649349"
     variation       7724
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:111767305"
     variation       7726
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200753798"
     exon            7742..7858
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       7745..7746
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35286120"
     variation       7810
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:77314619"
     variation       7819
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199536569"
     variation       7824
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372312652"
     variation       7839
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:875098"
     variation       7843
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192191689"
     exon            7859..8026
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       7876
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200008141"
     variation       7912
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369363336"
     variation       7936
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371959562"
     variation       7937
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201143360"
     variation       7953
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374942645"
     variation       7954
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184030245"
     variation       7956
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369139684"
     variation       7983
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200645290"
     variation       7984
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374618068"
     variation       7985
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377713868"
     STS             7993..8136
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /standard_name="REN53052"
                     /db_xref="UniSTS:377852"
     variation       7999
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369672055"
     variation       8007
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374205616"
     variation       8026
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377619914"
     exon            8027..8149
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       8037
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368250543"
     variation       8059
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:13026308"
     variation       8061
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370374797"
     variation       8078
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200879669"
     variation       8079
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200286305"
     variation       8083
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374611044"
     variation       8100
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199527401"
     variation       8110
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370009561"
     variation       8111
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372151241"
     variation       8124
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374304716"
     variation       8137
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368177870"
     exon            8150..8317
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       8188
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200598748"
     variation       8195
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371546953"
     variation       8231
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200113067"
     variation       8232
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:56376167"
     variation       8258
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200964950"
     variation       8265
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376454387"
     variation       8314
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147228436"
     exon            8318..8921
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       8321
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:78622154"
     variation       8368
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:55760516"
     variation       8384
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372559706"
     variation       8394
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375627068"
     variation       8403
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371062853"
     variation       8410
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201228075"
     variation       8436
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188612736"
     variation       8442
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371097046"
     variation       8444
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201240253"
     STS             8448..8686
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /standard_name="REN53056"
                     /db_xref="UniSTS:377856"
     variation       8463
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:190985"
     variation       8475
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374088448"
     variation       8501
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368059831"
     variation       8502
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148685205"
     variation       8503
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200718513"
     variation       8508
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199850470"
     variation       8535
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201822382"
     variation       8567
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200978079"
     variation       8580
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372912295"
     variation       8595
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199986192"
     variation       8598
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200305444"
     variation       8599
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202240234"
     variation       8619
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192326487"
     variation       8625
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:56132883"
     variation       8626
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201562087"
     variation       8651
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114233681"
     STS             8663..8910
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /standard_name="REN53057"
                     /db_xref="UniSTS:377857"
     variation       8669
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372724045"
     variation       8676
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1685311"
     variation       8688
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370524337"
     variation       8695
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:79502506"
     variation       8696
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1685310"
     variation       8723
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1707227"
     variation       8728
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:55891654"
     variation       8802
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:55969678"
     variation       8811
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373508427"
     variation       8860
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377476081"
     variation       8881
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:34738403"
     exon            8922..9161
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       8926
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200796349"
     variation       8945
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:77554911"
     variation       8946
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200429709"
     variation       8951
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368223827"
     variation       8952
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370680085"
     variation       8966
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375235228"
     variation       8972
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201608901"
     variation       8976
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201500512"
     variation       8977
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114190040"
     variation       9033
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371546535"
     variation       9057
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200656875"
     variation       9058
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368875454"
     variation       9063
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:191833179"
     variation       9070
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:372206095"
     variation       9079
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376483388"
     variation       9098
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199980291"
     STS             9099..9270
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /standard_name="REN53061"
                     /db_xref="UniSTS:377861"
     variation       9099
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369513475"
     variation       9105
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372982110"
     variation       9121
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:199599500"
     variation       9134
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369047644"
     exon            9162..9385
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       9183
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371901843"
     variation       9189
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201202610"
     variation       9220
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373312375"
     variation       9232
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200692984"
     variation       9236
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12464085"
     variation       9240
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:56181765"
     variation       9241
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375345784"
     variation       9267
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377528669"
     variation       9330
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200044898"
     variation       9365
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200200624"
     variation       9378
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367543923"
     exon            9386..9461
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       9390
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:12473286"
     variation       9415
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201960521"
     variation       9430
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375096973"
     exon            9462..9611
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       9473
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377623209"
     variation       9495
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:56175079"
     variation       9506
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61740202"
     variation       9507
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377095450"
     variation       9512
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201945260"
     variation       9515
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200019114"
     variation       9530
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199580811"
     variation       9570
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201568141"
     exon            9612..10650
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /inference="alignment:Splign:1.39.8"
     variation       9625
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200943895"
     variation       9641
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368692737"
     variation       9679
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372148131"
     variation       9689
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201629381"
     variation       9705
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374298882"
     variation       9737
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200574374"
     variation       9743
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201626656"
     variation       9746
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372244283"
     variation       9760
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200248965"
     variation       9763
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375248712"
     variation       9764
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:55821615"
     variation       9784
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:55667263"
     variation       9795
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371349906"
     STS             9800..10062
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /standard_name="REN53071"
                     /db_xref="UniSTS:377871"
     variation       9811
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376423304"
     variation       9854
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371201825"
     variation       9890
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1078212"
     variation       9904
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372833417"
     STS             10049..10273
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /standard_name="REN53072"
                     /db_xref="UniSTS:377872"
     STS             10144..10626
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /standard_name="ECD14937"
                     /db_xref="UniSTS:295955"
     STS             10180..10429
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /standard_name="D2S1595E"
                     /db_xref="UniSTS:150679"
     STS             10247..10515
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /standard_name="REN53073"
                     /db_xref="UniSTS:377873"
     variation       10288
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377226202"
     variation       10325
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1050814"
     variation       10414
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116097057"
     variation       10434
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182372923"
     variation       10450
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186290441"
     variation       10494
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1050816"
     STS             10539..10638
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /standard_name="SGC30668"
                     /db_xref="UniSTS:31030"
     variation       10556
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369997656"
     variation       10561
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:16859975"
     variation       10588
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:143374964"
     variation       10609
                     /gene="SPEG"
                     /gene_synonym="APEG-1; APEG1; BPEG; SPEGalpha; SPEGbeta"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:151249813"
ORIGIN      
atgcagaaagcccggggcacgcgaggcgaggatgcgggcacgagggcaccccccagccccggagtgcccccgaaaagggccaaggtgggggccggcggcggggctcctgtggccgtggccggggcgccagtcttcctgcggcccctgaagaacgcggcggtgtgcgcgggcagcgacgtgcggctgcgggtggtggtgagcgggacgccccagcccagcctccgctggttccgggatgggcagctcctgcccgcgccggcccccgagcccagctgcctgtggctgcggcgctgcggggcgcaggacgccggcgtgtacagctgcatggcccagaacgagcggggccgggcctcctgcgaggcggtgctcacagtgctggaggtcggagactcagagacggctgaggatgacatcagcgatgtgcagggaacccagcgcctggagcttcgggatgacggggccttcagcacccccacggggggttctgacaccctggtgggcacctccctggacacacccccgacctccgtgacaggcacctcagaggagcaagtgagctggtggggcagcgggcagacggtcctggagcaggaagcgggcagtgggggtggcacccgccgcctcccgggcagcccaaggcaagcacaggcaaccggggccgggccacggcacctgggggtggagccgctggtgcgggcatctcgagctaatctggtgggcgcaagctgggggtcagaggatagcctttccgtggccagtgacctgtacggcagcgcattcagcctgtacagaggacgggcgctctctatccacgtcagcgtccctcagagcgggttgcgcagggaggagcccgaccttcagcctcaactggccagcgaagccccacgccgccctgcccagccgcctccttccaaatccgcgctgctccccccaccgtcccctcgggtcgggaagcggtccccgccgggacccccggcccagcccgcggccacccccacgtcgccccaccgtcgcactcaggagcctgtgctgcccgaggacaccaccaccgaagagaagcgagggaagaagtccaagtcgtccgggccctccctggcgggcaccgcggaatcccgaccccagacgccactgagcgaggcctcaggccgcctgtcggcgttgggccgatcgcctaggctggtgcgcgccggctcccgcatcctggacaagctgcagttcttcgaggagcgacggcgcagcctggagcgcagcgactcgccgccggcgcccctgcggccctgggtgcccctgcgcaaggcccgctctctggagcagcccaagtcggagcgcggcgcaccgtggggcacccccggggcctcgcaggaagaactgcgggcgccaggcagcgtggccgagcggcgccgcctgttccagcagaaagcggcctcgctggacgagcgcacgcgtcagcgcagcccggcctcagacctcgagctgcgcttcgcccaggagctgggccgcatccgccgctccacgtcgcgggaggagctggtgcgctcgcacgagtccctgcgcgccacgctgcagcgtgccccatcccctcgagagcccggcgagcccccgctcttctctcggccctccacccccaagacatcgcgggccgtgagccccgccgccgcccagccgccctctccgagcagcgcggagaagccgggggacgagcctgggaggcccaggagccgcgggccggcgggcaggacagagccgggggaaggcccgcagcaggaggttaggcgtcgggaccaattcccgctgacccggagcagagccatccaggagtgcaggagccctgtgccgccccccgccgccgatcccccagaggccaggacgaaagcaccccccggtcggaagcgggagcccccggcgcaggccgtgcgcttcctgccctgggccacgccgggcctggagggcgctgctgtaccccagaccttggagaagaacagggcggggcctgaggcagagaagaggcttcgcagagggccggaggaggacggtccctgggggccctgggaccgccgaggggcccgcagccagggcaaaggtcgccgggcccggcccacctcccctgagctcgagtcttcggatgactcctacgtgtccgctggagaagagcccctagaggcccctgtgtttgagatccccctgcagaatgtggtggtggcaccaggggcagatgtgctgctcaagtgtatcatcactgccaaccccccgccccaagtgtcctggcacaaggatgggtcagcgctgcgcagcgagggccgcctcctcctccgggctgagggtgagcggcacaccctgctgctcagggaggccagggcagcagatgccgggagctatatggccaccgccaccaacgagctgggccaggccacctgtgccgcctcactgaccgtgagacccggtgggtctacatcccctttcagcagccccatcacctccgacgaggaatacctgagccccccagaggagttcccagagcctggggagacctggccgcgaacccccaccatgaagcccagtcccagccagaaccgccgttcttctgacactggctccaaggcaccccccaccttcaaggtctcacttatggaccagtcagtaagagaaggccaagatgtcatcatgagcatccgcgtgcagggggagcccaagcctgtggtctcctggctgagaaaccgccagcccgtgcgcccagaccagcggcgctttgcggaggaggctgagggtgggctgtgccggctgcggatcctggctgcagagcgtggcgatgctggtttctacacttgcaaagcggtcaatgagtatggtgctcggcagtgcgaggcccgcttggaggtccgagcacaccctgaaagccggtccctggccgtgctggcccccctgcaggacgtggacgtgggggccggggagatggcgctgtttgagtgcctggtggcggggcccactgacgtggaggtggattggctgtgccgtggccgcctgctgcagcctgcactgctcaaatgcaagatgcatttcgatggccgcaaatgcaagctgctacttacatctgtacatgaggacgacagtggcgtctacacctgcaagctcagcacggccaaagatgagctgacctgcagtgcccggctgaccgtgcggccctcgttggcacccctgttcacacggctgctggaagatgtggaggtgttggagggccgagctgcccgtttcgactgcaagatcagtggcaccccgccccctgttgttacctggactcattttggctgccccatggaggagagtgagaacttgcggctgcggcaggacgggggtctgcactcactgcacattgcccatgtgggcagcgaggacgaggggctctatgcggtcagtgctgttaacacccatggccaggcccactgctcagcccagctgtatgtagaagagccccggacagccgcctcaggccccagctcgaagctggagaagatgccatccattcccgaggagccagagcagggtgagctggagcggctgtccattcctgacttcctgcggccactgcaggacctggaggtgggactggccaaggaggccatgctagagtgccaggtgaccggcctgccctaccccaccatcagctggttccacaatggccaccgcatccagagcagcgacgaccggcgcatgacacagtacagggatgtccatcgcttggtgttccctgccgtggggcctcagcacgccggtgtctacaagagcgtcattgccaacaagctgggcaaagctgcctgctatgcccacctgtatgtcacagatgtggtcccaggccctccagatggcgccccgcaggtggtggctgtgacggggaggatggtcacactcacatggaacccccccaggagtctggacatggccatcgacccggactccctgacgtacacagtgcagcaccaggtgctgggctcggaccagtggacggcactggtcacaggcctgcgggagccagggtgggcagccacagggctgcgtaagggggtccagcacatcttccgggtcctcagcaccactgtcaagagcagcagcaagccctcacccccttctgagcctgtgcagctgctggagcacggcccaaccctggaggaggcccctgccatgctggacaaaccagacatcgtgtatgtggtggagggacagcctgccagcgtcaccgtcacattcaaccatgtggaggcccaggtcgtctggaggagctgccgaggggccctcctagaggcacgggccggtgtgtacgagctgagccagccagatgatgaccagtactgtcttcggatctgccgggtgagccgccgggacatgggggccctcacctgcaccgcccgaaaccgtcacggcacacagacctgctcggtcacattggagctggcagaggcccctcggtttgagtccatcatggaggacgtggaggtgggggctggggaaactgctcgctttgcggtggtggtcgagggaaaaccactgccggacatcatgtggtacaaggacgaggtgctgctgaccgagagcagccatgtgagcttcgtgtacgaggagaatgagtgctccctggtggtgctcagcacgggggcccaggatggaggcgtctacacctgcaccgcccagaacctggcgggtgaggtctcctgcaaagcagagttggctgtgcattcagctcagacagctatggaggtcgagggggtcggggaggatgaggaccatcgaggaaggagactcagcgacttttatgacatccaccaggagatcggcaggggtgctttctcctacttgcggcgcatagtggagcgtagctccggcctggagtttgcggccaagttcatccccagccaggccaagccaaaggcatcagcgcgtcgggaggcccggctgctggccaggctccagcacgactgtgtcctctacttccatgaggccttcgagaggcgccggggactggtcattgtcaccgagctctgcacagaggagctgctggagcgaatcgccaggaaacccaccgtgtgtgagtctgagatccgggcctatatgcggcaggtgctagagggaatacactacctgcaccagagccacgtgctgcacctcgatgtcaagcctgagaacctgctggtgtgggatggtgctgcgggcgagcagcaggtgcggatctgtgactttgggaatgcccaggagctgactccaggagagccccagtactgccagtatggcacacctgagtttgtagcacccgagattgtcaatcagagccccgtgtctggagtcactgacatctggcctgtgggtgttgttgccttcctctgtctgacaggaatctccccgtttgttggggaaaatgaccggacaacattgatgaacatccgaaactacaacgtggccttcgaggagaccacattcctgagcctgagcagggaggcccggggcttcctcatcaaagtgttggtgcaggaccggctgagacctaccgcagaagagaccctagaacatccttggttcaaaactcaggcaaagggcgcagaggtgagcacggatcacctgaagctattcctctcccggcggaggtggcagcgctcccagatcagctacaaatgccacctggtgctgcgccccatccccgagctgctgcgggcccccccagagcgggtgtgggtgaccatgcccagaaggccaccccccagtggggggctctcatcctcctcggattctgaagaggaagagctggaagagctgccctcagtgccccgcccactgcagcccgagttctctggctcccgggtgtccctcacagacattcccactgaggatgaggccctggggaccccagagactggggctgccacccccatggactggcaggagcagggaagggctccctctcaggaccaggaggctcccagcccagaggccctcccctccccaggccaggagcccgcagctggggctagccccaggcggggagagctccgcaggggcagctcggctgagagcgccctgccccgggccgggccgcgggagctgggccggggcctgcacaaggcggcgtctgtggagctgccgcagcgccggagccccagcccgggagccacccgcctggcccggggaggcctgggtgagggcgagtatgcccagaggctgcaggccctgcgccagcggctgctgcggggaggccccgaggatggcaaggtcagcggcctcaggggtcccctgctggagagcctggggggccgtgctcgggacccccggatggcacgagctgcctccagcgaggcagcgccccaccaccagcccccactcgagaaccggggcctgcaaaagagcagcagcttctcccagggtgaggcggagccccggggccggcaccgccgagcgggggcgcccctcgagatccccgtggccaggcttggggcccgtaggctacaggagtctccttccctgtctgccctcagcgaggcccagccatccagccctgcacggcccagcgcccccaaacccagtacccctaagtctgcagaaccttctgccaccacacctagtgatgctccgcagccccccgcaccccagcctgcccaagacaaggctccagagcccaggccagaaccagtccgagcctccaagcctgcaccacccccccaggccctgcaaaccctagcgctgcccctcacaccctatgctcagatcattcagtccctccagctgtcaggccacgcccagggcccctcgcagggccctgccgcgccgccttcagagcccaagccccacgctgctgtctttgccagggtggcctccccacctccgggagcccccgagaagcgcgtgccctcagccgggggtcccccggtgctagccgagaaagcccgagttcccacggtgccccccaggccaggcagcagtctcagtagcagcatcgaaaacttggagtcggaggccgtgttcgaggccaagttcaagcgcagccgcgagtcgcccctgtcgctggggctgcggctgctgagccgttcgcgctcggaggagcgcggccccttccgtggggccgaggaggaggatggcatataccggcccagcccggcggggaccccgctggagctggtgcgacggcctgagcgctcacgctcggtgcaggacctcagggctgtcggagagcctggcctcgtccgccgcctctcgctgtcactgtcccagcggctgcggcggacccctcccgcgcagcgccacccggcctgggaggcccgcggcggggacggagagagctcggagggcgggagctcggcgcggggctccccggtgctggcgatgcgcaggcggctgagcttcaccctggagcggctgtccagccgattgcagcgcagtggcagcagcgaggactcggggggcgcgtcgggccgcagcacgccgctgttcggacggcttcgcagggccacgtccgagggcgagagtctgcggcgccttggccttccgcacaaccagttggccgcccaggccggcgccaccacgccttccgccgagtccctgggctccgaggccagcgccacgtcgggctcctcagccccaggggaaagccgaagccggctccgctggggcttctctcggccgcggaaggacaaggggttatcgccaccaaacctctctgccagcgtccaggaggagttgggtcaccagtacgtgcgcagtgagtcagacttccccccagtcttccacatcaaactcaaggaccaggtgctgctggagggggaggcagccaccctgctctgcctgccagcggcctgccctgcaccgcacatctcctggatgaaagacaagaagtccttgaggtcagagccctcagtgatcatcgtgtcctgcaaagatgggcggcagctgctcagcatcccccgggcgggcaagcggcacgccggtctctatgagtgctcggccaccaacgtactgggcagcatcaccagctcctgtaccgtggctgtggcccgagtcccaggaaagctagctcctccagaggtaccccagacctaccaggacacggcgctggtgctgtggaagccgggagacagccgggcaccttgcacgtatacgctggagcggcgagtggatggggagtctgtgtggcaccctgtgagctcaggcatccccgactgttactacaacgtgacccacctgccagttggcgtgactgtgaggttccgtgtggcctgtgccaaccgtgctgggcaggggcccttcagcaactcttctgagaaggtctttgtcaggggtactcaagattcttcagctgtgccatctgctgcccaccaagaggcccctgtcacctcaaggccagccagggcccggcctcctgactctcctacctcactggccccacccctagctcctgctgcccccacacccccgtcagtcactgtcagcccctcatctccccccacacctcctagccaggccttgtcctcgctcaaggctgtgggtccaccaccccaaacccctccacgaagacacaggggcctgcaggctgcccggccagcggagcccaccctacccagtacccacgtcaccccaagtgagcccaagcctttcgtccttgacactgggaccccgatcccagcctccactcctcaaggggttaaaccagtgtcttcctctactcctgtgtatgtggtgacttcctttgtgtctgcaccaccagcccctgagcccccagcccctgagccccctcctgagcctaccaaggtgactgtgcagagcctcagcccggccaaggaggtggtcagctcccctgggagcagtccccgaagctctcccaggcctgagggtaccactcttcgacagggtccccctcagaaaccctacaccttcctggaggagaaagccaggggccgctttggtgttgtgcgagcgtgccgggagaatgccacggggcgaacgttcgtggccaagatcgtgccctatgctgccgagggcaagcggcgggtcctgcaggagtacgaggtgctgcggaccctgcaccacgagcggatcatgtccctgcacgaggcctacatcacccctcggtacctcgtgctcattgctgagagctgtggcaaccgggaactcctctgtgggctcagtgacaggttccggtattctgaggatgacgtggccacttacatggtgcagctgctacaaggcctggactacctccacggccaccacgtgctccacctagacatcaagccagacaacctgctgctggcccctgacaatgccctcaagattgtggactttggcagtgcccagccctacaacccccaggcccttaggccccttggccaccgcacgggcacgctggagttcatggctccggagatggtgaagggagaacccatcggctctgccacggacatctggggagcgggtgtgctcacttacattatgctcagtggacgctccccgttctatgagccagacccccaggaaacggaggctcggattgtggggggccgctttgatgccttccagctgtaccccaatacatcccagagcgccaccctcttcttgcgaaaggttctctctgtacatccctggagccggccctccctgcaggactgcctggcccacccatggttgcaggacgcctacctgatgaagctgcgccgccagacgctcaccttcaccaccaaccggctcaaggagttcctgggcgagcagcggcggcgccgggctgaggctgccacccgccacaaggtgctgctgcgctcctaccctggcggcccctagaggcacggaccacagccaggcctcgggcttcaactggggttcccaccaatgccacgggacattccagggcccacgctgagccaggcgggcctggggcttcggttaccaccagcagcaacatctggctgggctcttacctcatagaccttcaaggacagagaccccagggcctggacctgatgccaccccaggccaaagccagagtgggagacccattggtcaggctcagcagggtgggaacaggcagagggacaagaggggaatggagaagtggagaggaaaaggaatcgagggacaggaagggggaggctctaggaaggttctgggttgggggtcagtgcatctcagggagaaccaaggaaggtgggcatggctggagaggaggaaaaggaaggagccccaggtgtcagggcagtaggctgggagtcagtgtggcaaagcgggggcaggacacagatacagtggcaggggcccagggctgggacatgagagaaggcagcgaggcggcagagggagaagagaggactcaggtggaggtggggtgggtcagctgtcagcatccctcagaggagaaatgtggagagctggaggccagcagtcactcacactcgctctgtcctcctgtccagtggatacagccctgggcgctctgctggcccaaggatgtccccactgcccctccatggcctctggccttcttcccattcatatttatttatttattgacttttatgaagtttccccttccatccgatccctactgcccatgttgtcctgaccatccctcccagccatccagctgtctgtctgtctgccacaaggaaataaaaatggcaagcagcataa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:10290 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: IEA
            GeneID:10290 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
            GeneID:10290 -> Biological process: GO:0001701 [in utero embryonic development] evidence: IEA
            GeneID:10290 -> Biological process: GO:0007517 [muscle organ development] evidence: TAS
            GeneID:10290 -> Biological process: GO:0008285 [negative regulation of cell proliferation] evidence: TAS
            GeneID:10290 -> Biological process: GO:0055013 [cardiac muscle cell development] evidence: IEA
            GeneID:10290 -> Biological process: GO:0060541 [respiratory system development] evidence: IEA
            GeneID:10290 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_005867 -> EC 2.7.11.1

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.