Home |
Help |
Advanced search
2024-04-25 13:00:42, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_005814 2793 bp mRNA linear PRI 02-JUN-2013
DEFINITION Homo sapiens glycoprotein A33 (transmembrane) (GPA33), mRNA.
ACCESSION NM_005814
VERSION NM_005814.1 GI:5031560
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2793)
AUTHORS Infante,J.R., Bendell,J.C., Goff,L.W., Jones,S.F., Chan,E.,
Sudo,T., Burris,H.A. and Berlin,J.D.
TITLE Safety, pharmacokinetics and pharmacodynamics of the anti-A33
fully-human monoclonal antibody, KRN330, in patients with advanced
colorectal cancer
JOURNAL Eur. J. Cancer 49 (6), 1169-1175 (2013)
PUBMED 23294608
REMARK GeneRIF: Data indicate positive staining was observed for both A33
expression and KRN330 binding from patients biopsied on Day 8, 9 or
14 following initial dosing of 3 mg/kg.
REFERENCE 2 (bases 1 to 2793)
AUTHORS Chan,W.M. and Ward,B.M.
TITLE Increased interaction between vaccinia virus proteins A33 and B5 is
detrimental to infectious extracellular enveloped virion production
JOURNAL J. Virol. 86 (15), 8232-8244 (2012)
PUBMED 22623782
REMARK GeneRIF: Increased interaction between vaccinia virus proteins A33
and B5 is detrimental to infectious extracellular enveloped virion
production.
REFERENCE 3 (bases 1 to 2793)
AUTHORS Chan,W.M. and Ward,B.M.
TITLE The A33-dependent incorporation of B5 into extracellular enveloped
vaccinia virions is mediated through an interaction between their
lumenal domains
JOURNAL J. Virol. 86 (15), 8210-8220 (2012)
PUBMED 22623777
REMARK GeneRIF: The A33-dependent incorporation of B5 into extracellular
enveloped vaccinia virions is mediated through an interaction
between their lumenal domains.
REFERENCE 4 (bases 1 to 2793)
AUTHORS Ehret,G.B., O'Connor,A.A., Weder,A., Cooper,R.S. and Chakravarti,A.
TITLE Follow-up of a major linkage peak on chromosome 1 reveals
suggestive QTLs associated with essential hypertension: GenNet
study
JOURNAL Eur. J. Hum. Genet. 17 (12), 1650-1657 (2009)
PUBMED 19536175
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
REFERENCE 5 (bases 1 to 2793)
AUTHORS Cheung,C.L., Chan,B.Y., Chan,V., Ikegawa,S., Kou,I., Ngai,H.,
Smith,D., Luk,K.D., Huang,Q.Y., Mori,S., Sham,P.C. and Kung,A.W.
TITLE Pre-B-cell leukemia homeobox 1 (PBX1) shows functional and possible
genetic association with bone mineral density variation
JOURNAL Hum. Mol. Genet. 18 (4), 679-687 (2009)
PUBMED 19064610
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
REFERENCE 6 (bases 1 to 2793)
AUTHORS Mao,Z., Song,S., Zhu,Y., Yi,X., Zhang,H., Shang,Y. and Tong,T.
TITLE Transcriptional regulation of A33 antigen expression by
gut-enriched Kruppel-like factor
JOURNAL Oncogene 22 (28), 4434-4443 (2003)
PUBMED 12853980
REMARK GeneRIF: Regulation of A33 antigen expression by GKLF.
REFERENCE 7 (bases 1 to 2793)
AUTHORS Johnstone,C.N., White,S.J., Tebbutt,N.C., Clay,F.J., Ernst,M.,
Biggs,W.H., Viars,C.S., Czekay,S., Arden,K.C. and Heath,J.K.
TITLE Analysis of the regulation of the A33 antigen gene reveals
intestine-specific mechanisms of gene expression
JOURNAL J. Biol. Chem. 277 (37), 34531-34539 (2002)
PUBMED 12114523
REMARK GeneRIF: cloning, chromosomal localizations, exon-intron structures
and transcription start sites - target gene for the
intestine-specific homeobox transcription factor, CDX1.
REFERENCE 8 (bases 1 to 2793)
AUTHORS Moritz,R.L., Ritter,G., Catimel,B., Cohen,L.S., Welt,S., Old,L.J.,
Burgess,A.W., Nice,E.C. and Simpson,R.J.
TITLE Micro-sequencing strategies for the human A33 antigen, a novel
surface glycoprotein of human gastrointestinal epithelium
JOURNAL J Chromatogr A 798 (1-2), 91-101 (1998)
PUBMED 9542130
REFERENCE 9 (bases 1 to 2793)
AUTHORS Ritter,G., Cohen,L.S., Nice,E.C., Catimel,B., Burgess,A.W.,
Moritz,R.L., Ji,H., Heath,J.K., White,S.J., Welt,S., Old,L.J. and
Simpson,R.J.
TITLE Characterization of posttranslational modifications of human A33
antigen, a novel palmitoylated surface glycoprotein of human
gastrointestinal epithelium
JOURNAL Biochem. Biophys. Res. Commun. 236 (3), 682-686 (1997)
PUBMED 9245713
REFERENCE 10 (bases 1 to 2793)
AUTHORS Heath,J.K., White,S.J., Johnstone,C.N., Catimel,B., Simpson,R.J.,
Moritz,R.L., Tu,G.F., Ji,H., Whitehead,R.H., Groenen,L.C.,
Scott,A.M., Ritter,G., Cohen,L., Welt,S., Old,L.J., Nice,E.C. and
Burgess,A.W.
TITLE The human A33 antigen is a transmembrane glycoprotein and a novel
member of the immunoglobulin superfamily
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 94 (2), 469-474 (1997)
PUBMED 9012807
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from U79725.1.
Summary: The glycoprotein encoded by this gene is a cell surface
antigen that is expressed in greater than 95% of human colon
cancers. The open reading frame encodes a 319-amino acid
polypeptide having a putative secretory signal sequence and 3
potential glycosylation sites. The predicted mature protein has a
213-amino acid extracellular region, a single transmembrane domain,
and a 62-amino acid intracellular tail. The sequence of the
extracellular region contains 2 domains characteristic of the CD2
subgroup of the immunoglobulin (Ig) superfamily. [provided by
RefSeq, Jul 2008].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: U79725.1, BC107165.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025094, ERS025098 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
FEATURES Location/Qualifiers
source 1..2793
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="1"
/map="1q24.1"
gene 1..2793
/gene="GPA33"
/gene_synonym="A33"
/note="glycoprotein A33 (transmembrane)"
/db_xref="GeneID:10223"
/db_xref="HGNC:4445"
/db_xref="HPRD:03704"
/db_xref="MIM:602171"
exon 1..387
/gene="GPA33"
/gene_synonym="A33"
/inference="alignment:Splign:1.39.8"
variation 36
/gene="GPA33"
/gene_synonym="A33"
/replace="c"
/replace="t"
/db_xref="dbSNP:2281960"
variation 39
/gene="GPA33"
/gene_synonym="A33"
/replace="c"
/replace="t"
/db_xref="dbSNP:2281961"
variation 109
/gene="GPA33"
/gene_synonym="A33"
/replace="c"
/replace="t"
/db_xref="dbSNP:2281962"
misc_feature 192..194
/gene="GPA33"
/gene_synonym="A33"
/note="upstream in-frame stop codon"
STS 273..1379
/gene="GPA33"
/gene_synonym="A33"
/db_xref="UniSTS:481386"
variation 294
/gene="GPA33"
/gene_synonym="A33"
/replace="a"
/replace="c"
/db_xref="dbSNP:28384507"
STS 323..1347
/gene="GPA33"
/gene_synonym="A33"
/db_xref="UniSTS:481998"
CDS 345..1304
/gene="GPA33"
/gene_synonym="A33"
/note="cell surface A33 antigen; transmembrane
glycoprotein A33"
/codon_start=1
/product="cell surface A33 antigen precursor"
/protein_id="NP_005805.1"
/db_xref="GI:5031561"
/db_xref="CCDS:CCDS1258.1"
/db_xref="GeneID:10223"
/db_xref="HGNC:4445"
/db_xref="HPRD:03704"
/db_xref="MIM:602171"
/translation="
MVGKMWPVLWTLCAVRVTVDAISVETPQDVLRASQGKSVTLPCTYHTSTSSREGLIQWDKLLLTHTERVVIWPFSNKNYIHGELYKNRVSISNNAEQSDASITIDQLTMADNGTYECSVSLMSDLEGNTKSRVRLLVLVPPSKPECGIEGETIIGNNIQLTCQSKEGSPTPQYSWKRYNILNQEQPLAQPASGQPVSLKNISTDTSGYYICTSSNEEGTQFCNITVAVRSPSMNVALYVGIAVGVVAALIIIGIIIYCCCCRGKDDNTEDKEDARPNREAYEEPPEQLRELSREREEEDDYRQEEQRSTGRESPDHLDQ
"
sig_peptide 345..407
/gene="GPA33"
/gene_synonym="A33"
/inference="COORDINATES: ab initio prediction:SignalP:4.0"
misc_feature 405..746
/gene="GPA33"
/gene_synonym="A33"
/note="Immunoglobulin V-set domain; Region: V-set;
pfam07686"
/db_xref="CDD:203725"
mat_peptide 408..1301
/gene="GPA33"
/gene_synonym="A33"
/product="cell surface A33 antigen"
/note="A33 antigen"
misc_feature 447..731
/gene="GPA33"
/gene_synonym="A33"
/note="Immunoglobulin domain; Region: Ig; cl11960"
/db_xref="CDD:213125"
misc_feature 810..998
/gene="GPA33"
/gene_synonym="A33"
/note="Immunoglobulin C-2 Type; Region: IGc2; smart00408"
/db_xref="CDD:197706"
misc_feature 1050..1112
/gene="GPA33"
/gene_synonym="A33"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q99795.1);
transmembrane region"
exon 388..542
/gene="GPA33"
/gene_synonym="A33"
/inference="alignment:Splign:1.39.8"
variation 402
/gene="GPA33"
/gene_synonym="A33"
/replace="a"
/replace="g"
/db_xref="dbSNP:2274531"
exon 543..759
/gene="GPA33"
/gene_synonym="A33"
/inference="alignment:Splign:1.39.8"
exon 760..915
/gene="GPA33"
/gene_synonym="A33"
/inference="alignment:Splign:1.39.8"
variation 839
/gene="GPA33"
/gene_synonym="A33"
/replace="g"
/replace="t"
/db_xref="dbSNP:2228399"
exon 916..1035
/gene="GPA33"
/gene_synonym="A33"
/inference="alignment:Splign:1.39.8"
exon 1036..1171
/gene="GPA33"
/gene_synonym="A33"
/inference="alignment:Splign:1.39.8"
exon 1172..2793
/gene="GPA33"
/gene_synonym="A33"
/inference="alignment:Splign:1.39.8"
STS 1389..1531
/gene="GPA33"
/gene_synonym="A33"
/standard_name="RH103589"
/db_xref="UniSTS:97914"
variation 2494
/gene="GPA33"
/gene_synonym="A33"
/replace="c"
/replace="t"
/db_xref="dbSNP:12461"
STS 2538..2651
/gene="GPA33"
/gene_synonym="A33"
/standard_name="SHGC-53101"
/db_xref="UniSTS:46908"
variation 2613
/gene="GPA33"
/gene_synonym="A33"
/replace="a"
/replace="c"
/db_xref="dbSNP:11736"
polyA_signal 2777..2782
/gene="GPA33"
/gene_synonym="A33"
ORIGIN
ctacccctttgtgagcagtctaggactttgtacacctgttaagtagggagaaggcaggggaggtggctggtttaaggggaacttgagggaagtagggaagactcctcttgggacctttggagtaggtgacacatgagcccagccccagctcacctgccaatccagctgaggagctcacctgccaatccagctgaggctgggcagaggtgggtgagaagagggaaaattgcagggacctccagttgggccaggccagaagctgctgtagctttaaccagacagctcagacctgtctggaggctgccagtgacaggttaggtttagggcagagaagaagcaagaccatggtggggaagatgtggcctgtgttgtggacactctgtgcagtcagggtgaccgtcgatgccatctctgtggaaactccgcaggacgttcttcgggcttcgcagggaaagagtgtcaccctgccctgcacctaccacacttccacctccagtcgagagggacttattcaatgggataagctcctcctcactcatacggaaagggtggtcatctggccgttttcaaacaaaaactacatccatggtgagctttataagaatcgcgtcagcatatccaacaatgctgagcagtccgatgcctccatcaccattgatcagctgaccatggctgacaacggcacctacgagtgttctgtctcgctgatgtcagacctggagggcaacaccaagtcacgtgtccgcctgttggtcctcgtgccaccctccaaaccagaatgcggcatcgagggagagaccataattgggaacaacatccagctgacctgccaatcaaaggagggctcaccaacccctcagtacagctggaagaggtacaacatcctgaatcaggagcagcccctggcccagccagcctcaggtcagcctgtctccctgaagaatatctccacagacacatcgggttactacatctgtacctccagcaatgaggaggggacgcagttctgcaacatcacggtggccgtcagatctccctccatgaacgtggccctgtatgtgggcatcgcggtgggcgtggttgcagccctcattatcattggcatcatcatctactgctgctgctgccgagggaaggacgacaacactgaagacaaggaggatgcaaggccgaaccgggaagcctatgaggagccaccagagcagctaagagaactttccagagagagggaggaggaggatgactacaggcaagaagagcagaggagcactgggcgtgaatccccggaccacctcgaccagtgacaggccagcagcagagggcggcggaggaagggttaggggttcattctcccgcttcctggcctcccttctcctttctaagccctgttctcctgtccctccatcccagacattgatggggacatttcttccccagtgtcagctgtggggaacatggctggcctggtaagggggtccctgtgctgatcctgctgacctcactgtcctgtgaagtaacccctcctggctgtgacacctggtgcgggcctggccctcactcaagaccaggctgcagcctccacttccctcgtagttggcaggagctcctggaagcacagcgctgagcatggggcgctcccactcagaactctccagggaggcgatgccagccttggggggtgggggctgtcctgctcacctgtgtgcccagcacctggaggggcaccaggtggagggtttgcactccacacatctttcttgaatgaatgaaagaataagtgagtatgcttgggccctgcattggcctggcctccagctcccactccctttccaacctcacttcccgtagctgccagtatgttccaaaccctcctgggaaggccacctcccactcctgctgcacaggccctggggagcttttgcccacacactttccatctctgcctgtcaatatcgtacctgtccctccaggcccatctcaaatcacaaggatttctctaaccctatcctaattgtccacatacgtggaaacaatcctgttactctgtcccacgtccaatcatgggccacaaggcacagtcttctgagcgagtgctctcactgtattagagcgccagctccttggggcagggcctgggcctcatggcttttgctttccctgaagccctagtagctggcgcccatcctagtgggcacttaagcttaattggggaaactgctttgattggttgtgccttcccttctctggtctccttgagatgatcgtagacacagggatgattcccacccaaacccacgtattcattcagtgagttaaacacgaattgatttaaagtgaacacacacaagggagcttgcttgcagatggtctgagttcttgtgtcctggtaattcctctccaggccagaataattggcatgtctcctcaacccacatggggttcctggttgttcctgcatcccgatacctcagccctggccctgcccagcccatttgggctctggttttctggtggggctgtcctgctgccctcccacagcctccttctgtttgtcgagcatttcttctactcttgagagctcaggcagcgttagggctgcttaggtctcatggaccagtggctggtctcacccaactgcagtttactattgctatcttttctggatgatcagaaaaataattccataaatctattgtctacttgcgattttttaaaaaatgtatatttttatatatattgttaaatcctttgcttcattccaaatgctttcagtaataataaaattgtgggtgg
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:10223 -> Molecular function: GO:0004872 [receptor activity] evidence: TAS
GeneID:10223 -> Cellular component: GO:0005887 [integral to plasma membrane] evidence: TAS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.