GGRNA Home | Help | Advanced search

2024-03-29 15:24:12, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_005733               3471 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens kinesin family member 20A (KIF20A), mRNA.
ACCESSION   NM_005733
VERSION     NM_005733.2  GI:195539383
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3471)
  AUTHORS   Yamashita,J., Fukushima,S., Jinnin,M., Honda,N., Makino,K.,
            Sakai,K., Masuguchi,S., Inoue,Y. and Ihn,H.
  TITLE     Kinesin family member 20A is a novel melanoma-associated antigen
  JOURNAL   Acta Derm. Venereol. 92 (6), 593-597 (2012)
   PUBMED   22854760
  REMARK    GeneRIF: Primary melanomas that were positive for KIF20A showed a
            significantly greater thickness than those that were negative, and
            patients with KIF20A+ melanoma tended to develop recurrence
            earlier.
REFERENCE   2  (bases 1 to 3471)
  AUTHORS   Yan,G.R., Zou,F.Y., Dang,B.L., Zhang,Y., Yu,G., Liu,X. and He,Q.Y.
  TITLE     Genistein-induced mitotic arrest of gastric cancer cells by
            downregulating KIF20A, a proteomics study
  JOURNAL   Proteomics 12 (14), 2391-2399 (2012)
   PUBMED   22887948
  REMARK    GeneRIF: Used proteomics to identify the genistein-induced protein
            alterations in gastric cancer cells and found the silencing of
            KIF20A inhibited cell viability and induced G2/M arrest,& also
            increased cancer cell sensitivity to genistein inhibition.
REFERENCE   3  (bases 1 to 3471)
  AUTHORS   Hummer,S. and Mayer,T.U.
  TITLE     Cdk1 negatively regulates midzone localization of the mitotic
            kinesin Mklp2 and the chromosomal passenger complex
  JOURNAL   Curr. Biol. 19 (7), 607-612 (2009)
   PUBMED   19303298
  REMARK    GeneRIF: Data demonstrate that Mklp2 and the chromosomal passenger
            complex mutually depend on each other for microtubule midzone
            localization, and that the association between the CPC and Mklp2 is
            negatively regulated by Cdk1.
REFERENCE   4  (bases 1 to 3471)
  AUTHORS   Nousiainen,M., Sillje,H.H., Sauer,G., Nigg,E.A. and Korner,R.
  TITLE     Phosphoproteome analysis of the human mitotic spindle
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 103 (14), 5391-5396 (2006)
   PUBMED   16565220
REFERENCE   5  (bases 1 to 3471)
  AUTHORS   Taniuchi,K., Nakagawa,H., Nakamura,T., Eguchi,H., Ohigashi,H.,
            Ishikawa,O., Katagiri,T. and Nakamura,Y.
  TITLE     Down-regulation of RAB6KIFL/KIF20A, a kinesin involved with
            membrane trafficking of discs large homologue 5, can attenuate
            growth of pancreatic cancer cell
  JOURNAL   Cancer Res. 65 (1), 105-112 (2005)
   PUBMED   15665285
  REMARK    GeneRIF: Collaboration of RAB6KIFL and disc large homologue 5 is
            likely to be involved in pancreatic cancer.
REFERENCE   6  (bases 1 to 3471)
  AUTHORS   Hill,E., Clarke,M. and Barr,F.A.
  TITLE     The Rab6-binding kinesin, Rab6-KIFL, is required for cytokinesis
  JOURNAL   EMBO J. 19 (21), 5711-5719 (2000)
   PUBMED   11060022
  REMARK    GeneRIF: KIF20A (Rab6KIFL/MKlp2) is required for cytokinesis
REFERENCE   7  (bases 1 to 3471)
  AUTHORS   Opdam,F.J., Echard,A., Croes,H.J., van den Hurk,J.A., van de
            Vorstenbosch,R.A., Ginsel,L.A., Goud,B. and Fransen,J.A.
  TITLE     The small GTPase Rab6B, a novel Rab6 subfamily member, is cell-type
            specifically expressed and localised to the Golgi apparatus
  JOURNAL   J. Cell. Sci. 113 (PT 15), 2725-2735 (2000)
   PUBMED   10893188
REFERENCE   8  (bases 1 to 3471)
  AUTHORS   Lai,F., Fernald,A.A., Zhao,N. and Le Beau,M.M.
  TITLE     cDNA cloning, expression pattern, genomic structure and chromosomal
            location of RAB6KIFL, a human kinesin-like gene
  JOURNAL   Gene 248 (1-2), 117-125 (2000)
   PUBMED   10806357
REFERENCE   9  (bases 1 to 3471)
  AUTHORS   Horrevoets,A.J., Fontijn,R.D., van Zonneveld,A.J., de Vries,C.J.,
            ten Cate,J.W. and Pannekoek,H.
  TITLE     Vascular endothelial genes that are responsive to tumor necrosis
            factor-alpha in vitro are expressed in atherosclerotic lesions,
            including inhibitor of apoptosis protein-1, stannin, and two novel
            genes
  JOURNAL   Blood 93 (10), 3418-3431 (1999)
   PUBMED   10233894
REFERENCE   10 (bases 1 to 3471)
  AUTHORS   Echard,A., Jollivet,F., Martinez,O., Lacapere,J.J., Rousselet,A.,
            Janoueix-Lerosey,I. and Goud,B.
  TITLE     Interaction of a Golgi-associated kinesin-like protein with Rab6
  JOURNAL   Science 279 (5350), 580-585 (1998)
   PUBMED   9438855
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            DC402781.1, BC012999.2 and AK025790.1.
            On Aug 2, 2008 this sequence version replaced gi:5032012.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK025790.1, BC012999.2 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025085 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-462               DC402781.1         10-471
            463-3421            BC012999.2         1-2959
            3422-3471           AK025790.1         2981-3030
FEATURES             Location/Qualifiers
     source          1..3471
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="5"
                     /map="5q31"
     gene            1..3471
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /note="kinesin family member 20A"
                     /db_xref="GeneID:10112"
                     /db_xref="HGNC:9787"
                     /db_xref="HPRD:09292"
                     /db_xref="MIM:605664"
     exon            1..475
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /inference="alignment:Splign:1.39.8"
     variation       41
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187858303"
     variation       113
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192986534"
     variation       146
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183712991"
     variation       225
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:7729926"
     variation       267
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12109653"
     variation       399
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17171770"
     variation       437
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17171772"
     exon            476..661
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    479..481
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /note="upstream in-frame stop codon"
     CDS             497..3169
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /note="RAB6 interacting, kinesin-like (rabkinesin6);
                     mitotic kinesin-like protein 2; GG10_2; rabkinesin-6;
                     rab6-interacting kinesin-like protein"
                     /codon_start=1
                     /product="kinesin-like protein KIF20A"
                     /protein_id="NP_005724.1"
                     /db_xref="GI:5032013"
                     /db_xref="CCDS:CCDS4199.1"
                     /db_xref="GeneID:10112"
                     /db_xref="HGNC:9787"
                     /db_xref="HPRD:09292"
                     /db_xref="MIM:605664"
                     /translation="
MSQGILSPPAGLLSDDDVVVSPMFESTAADLGSVVRKNLLSDCSVVSTSLEDKQQVPSEDSMEKVKVYLRVRPLLPSELERQEDQGCVRIENVETLVLQAPKDSFALKSNERGIGQATHRFTFSQIFGPEVGQASFFNLTVKEMVKDVLKGQNWLIYTYGVTNSGKTHTIQGTIKDGGILPRSLALIFNSLQGQLHPTPDLKPLLSNEVIWLDSKQIRQEEMKKLSLLNGGLQEEELSTSLKRSVYIESRIGTSTSFDSGIAGLSSISQCTSSSQLDETSHRWAQPDTAPLPVPANIRFSIWISFFEIYNELLYDLLEPPSQQRKRQTLRLCEDQNGNPYVKDLNWIHVQDAEEAWKLLKVGRKNQSFASTHLNQNSSRSHSIFSIRILHLQGEGDIVPKISELSLCDLAGSERCKDQKSGERLKEAGNINTSLHTLGRCIAALRQNQQNRSKQNLVPFRDSKLTRVFQGFFTGRGRSCMIVNVNPCASTYDETLHVAKFSAIASQLVHAPPMQLGFPSLHSFIKEHSLQVSPSLEKGAKADTGLDDDIENEADISMYGKEELLQVVEAMKTLLLKERQEKLQLEMHLRDEICNEMVEQMQQREQWCSEHLDTQKELLEEMYEEKLNILKESLTSFYQEEIQERDEKIEELEALLQEARQQSVAHQQSGSELALRRSQRLAASASTQQLQEVKAKLQQCKAELNSTTEELHKYQKMLEPPPSAKPFTIDVDKKLEEGQKNIRLLRTELQKLGESLQSAERACCHSTGAGKLRQALTTCDDILIKQDQTLAELQNNMVLVKLDLRKKAACIAEQYHTVLKLQGQVSAKKRLGTNQENQQPNQQPPGKKPFLRNLLPRTPTCQSSTDCSPYARILRSRRSPLLKSGPFGKKY
"
     misc_feature    500..502
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N-acetylserine; propagated from
                     UniProtKB/Swiss-Prot (O95235.1); acetylation site"
     misc_feature    515..517
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O95235.1); phosphorylation site"
     misc_feature    536..538
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O95235.1); phosphorylation site"
     misc_feature    557..559
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O95235.1); phosphorylation site"
     misc_feature    641..643
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /citation=[4]
     misc_feature    683..>1075
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /note="Myosin and Kinesin motor domain. These ATPases
                     belong to the P-loop NTPase family and provide the driving
                     force in myosin and kinesin mediated processes; Region:
                     Motor_domain; cl00286"
                     /db_xref="CDD:212601"
     misc_feature    order(710..715,980..1003)
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /note="ATP-binding site [chemical binding]; other site"
                     /db_xref="CDD:73261"
     misc_feature    1226..1228
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /citation=[4]
     misc_feature    <1391..2011
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /note="Kinesin motor domain, KIF23-like subgroup. Members
                     of this group may play a role in mitosis. This catalytic
                     (head) domain has ATPase activity and belongs to the
                     larger group of P-loop NTPases. Kinesins are
                     microtubule-dependent molecular motors that play...;
                     Region: KISc_KIF23_like; cd01368"
                     /db_xref="CDD:73262"
     misc_feature    order(1874..1876,1883..1885,1892..1894)
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /note="microtubule interaction site [polypeptide binding];
                     other site"
                     /db_xref="CDD:73262"
     misc_feature    2078..2080
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine, by PLK1; propagated from
                     UniProtKB/Swiss-Prot (O95235.1); phosphorylation site"
     misc_feature    2078..2080
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /citation=[4]
     misc_feature    2090..2092
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O95235.1); phosphorylation site"
     misc_feature    2090..2092
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /citation=[4]
     misc_feature    2090..2092
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    2162..2164
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /citation=[4]
     misc_feature    2480..2482
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O95235.1); phosphorylation site"
     misc_feature    2498..2500
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O95235.1); phosphorylation site"
     misc_feature    2783..3166
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O95235.1);
                     Region: Globular (Potential)"
     misc_feature    2969..2971
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O95235.1); phosphorylation site"
     misc_feature    3065..3067
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine; propagated from
                     UniProtKB/Swiss-Prot (O95235.1); phosphorylation site"
     misc_feature    3095..3097
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O95235.1); phosphorylation site"
     misc_feature    3095..3097
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /citation=[4]
     variation       512
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142351139"
     variation       519
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116046687"
     variation       520
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201784256"
     variation       592
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140571402"
     variation       627
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150704301"
     variation       631
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138569484"
     exon            662..751
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /inference="alignment:Splign:1.39.8"
     variation       683
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3734116"
     variation       688
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146894462"
     variation       713
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372749091"
     variation       728
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76413256"
     variation       741
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:376212126"
     exon            752..871
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /inference="alignment:Splign:1.39.8"
     variation       761
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372207043"
     variation       762
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370256011"
     variation       780
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373433800"
     variation       808
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1048957"
     variation       825
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377492009"
     variation       826
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199865484"
     variation       840
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371087091"
     variation       847
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34756161"
     exon            872..1010
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /inference="alignment:Splign:1.39.8"
     variation       968
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:138159079"
     variation       1002
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200872203"
     variation       1003
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375606679"
     exon            1011..1198
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /inference="alignment:Splign:1.39.8"
     variation       1024
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:367756689"
     variation       1037
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200026092"
     variation       1041
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148216162"
     variation       1050
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374271585"
     variation       1051
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371671153"
     variation       1065
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200853662"
     variation       1068
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141777523"
     variation       1074
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374761244"
     variation       1128
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146249990"
     variation       1135
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368612950"
     variation       1149
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201497719"
     variation       1191
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201917136"
     exon            1199..1328
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /inference="alignment:Splign:1.39.8"
     variation       1202
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373041750"
     variation       1237
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144853219"
     variation       1238
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200525885"
     variation       1239
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:73261939"
     variation       1324
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377038296"
     exon            1329..1523
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /inference="alignment:Splign:1.39.8"
     variation       1378
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139271096"
     variation       1389
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144155991"
     variation       1390
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146016855"
     variation       1409
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372432130"
     variation       1411
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139724681"
     variation       1452
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375379655"
     variation       1453
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369402135"
     variation       1458
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202175686"
     variation       1467
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368663116"
     variation       1487
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:113568069"
     variation       1492
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141701454"
     variation       1493
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369749108"
     exon            1524..1635
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /inference="alignment:Splign:1.39.8"
     variation       1528
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370270564"
     variation       1546
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372178864"
     variation       1556
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201289940"
     variation       1583
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202142584"
     variation       1584
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199833523"
     STS             1606..1730
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /standard_name="RH48412"
                     /db_xref="UniSTS:13253"
     variation       1631
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372477891"
     exon            1636..1704
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /inference="alignment:Splign:1.39.8"
     variation       1651
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:112235103"
     variation       1671
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:145778060"
     variation       1679
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375381895"
     variation       1682
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371570693"
     variation       1683
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:148948773"
     exon            1705..1848
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /inference="alignment:Splign:1.39.8"
     variation       1737
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144942820"
     variation       1738
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199628808"
     variation       1750
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145418441"
     variation       1754
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368505414"
     variation       1774
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371153965"
     variation       1786
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370662508"
     variation       1796
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147723176"
     variation       1802
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201009097"
     variation       1818
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371794710"
     exon            1849..2014
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /inference="alignment:Splign:1.39.8"
     variation       1893
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112052250"
     variation       1920
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375073812"
     variation       1944
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:36032759"
     variation       1946
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142495138"
     variation       2014
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369666761"
     exon            2015..2179
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /inference="alignment:Splign:1.39.8"
     variation       2018
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372591952"
     variation       2022
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377556004"
     variation       2039
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147526398"
     variation       2058
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148375900"
     variation       2062
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140741750"
     variation       2094
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369856608"
     variation       2111
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:35308118"
     variation       2133
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:186065162"
     variation       2160
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374372473"
     exon            2180..2319
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /inference="alignment:Splign:1.39.8"
     variation       2189
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199695708"
     variation       2214
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370818208"
     variation       2225
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200142157"
     variation       2229
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374968389"
     variation       2233
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114549959"
     variation       2276
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138366667"
     variation       2277
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200404024"
     variation       2296
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201044865"
     variation       2306
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367612363"
     exon            2320..2422
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /inference="alignment:Splign:1.39.8"
     variation       2324
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201005105"
     variation       2348
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368278547"
     variation       2400
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141655710"
     variation       2418
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371593852"
     exon            2423..2621
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /inference="alignment:Splign:1.39.8"
     variation       2426
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146201395"
     variation       2439
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138029974"
     variation       2463
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142562832"
     variation       2472
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370275040"
     variation       2487
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202002672"
     variation       2493
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199720988"
     variation       2521
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200214829"
     variation       2537
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372480821"
     variation       2548
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144189626"
     variation       2590
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376501457"
     exon            2622..2713
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /inference="alignment:Splign:1.39.8"
     variation       2623
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375432339"
     variation       2628
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148685779"
     variation       2661
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200621216"
     variation       2679
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141428538"
     variation       2689
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34771967"
     exon            2714..2851
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /inference="alignment:Splign:1.39.8"
     variation       2734
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371748909"
     variation       2747
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200327073"
     variation       2776
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:139234483"
     variation       2777
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376634823"
     variation       2795
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145457733"
     variation       2811
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147681099"
     exon            2852..3471
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /inference="alignment:Splign:1.39.8"
     variation       2897
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140968747"
     variation       2907
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201151118"
     variation       2937
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61753425"
     variation       2975
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:17234961"
     variation       3005
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199689290"
     variation       3012
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3172747"
     variation       3095
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:202090102"
     variation       3116
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376617326"
     variation       3117
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369743232"
     variation       3125
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373613515"
     STS             3128..3283
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /standard_name="RH48651"
                     /db_xref="UniSTS:79834"
     variation       3192
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201144199"
     variation       3195
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367709537"
     variation       3210
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372910057"
     variation       3217
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374451548"
     variation       3232
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:143544966"
     variation       3348
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:201817182"
     variation       3385
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148122140"
     misc_feature    <3422..>3471
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /note="highly similar to AF153329 Homo sapiens RAB6KIFL
                     mRNA"
     variation       3432
                     /gene="KIF20A"
                     /gene_synonym="MKLP2; RAB6KIFL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:185083015"
ORIGIN      
tttttccccttaagacaaagcaagcaccctaaaccagttaccctgtgcactcctgttaagattgttgctaaggaaggacaggagttggctgctgaagcctcaagatttcctttaggctcttaggtaagaaatgtctaaggttcaaggaaaaaggttaagttggaagaatcccaggcaaaataagtgcgaatccacgacagttggtaacccggacccacattagaactcagaggtcaagcagaagcgaacgactggaattccagtcaggcccgccccctttccttacgcggattggtagctgcaggcttccctatctgattggccgaacgaacgcagcgcgtaatttaaaatattgtatctgtaacaaagctgcacctcgtgggcggagttgtgctctgcggctgcgaaagtccagcttcggcgactaggtgtgagtaagccagtatcccaggaggagcaagtggcacgtcttcggacctaggctgcccctgccgtcatgtcgcaagggatcctttctccgccagcgggcttgctgtccgatgacgatgtcgtagtttctcccatgtttgagtccacagctgcagatttggggtctgtggtacgcaagaacctgctatcagactgctctgtcgtctctacctccctagaggacaagcagcaggttccatctgaggacagtatggagaaggtgaaagtatacttgagggttaggcccttgttaccttcagagttggaacgacaggaagatcagggttgtgtccgtattgagaatgtggagacccttgttctacaagcacccaaggactcttttgccctgaagagcaatgaacggggaattggccaagccacacacaggttcaccttttcccagatctttgggccagaagtgggacaggcatccttcttcaacctaactgtgaaggagatggtaaaggatgtactcaaagggcagaactggctcatctatacatatggagtcactaactcagggaaaacccacacgattcaaggtaccatcaaggatggagggattctcccccggtccctggcgctgatcttcaatagcctccaaggccaacttcatccaacacctgatctgaagcccttgctctccaatgaggtaatctggctagacagcaagcagatccgacaggaggaaatgaagaagctgtccctgctaaatggaggcctccaagaggaggagctgtccacttccttgaagaggagtgtctacatcgaaagtcggataggtaccagcaccagcttcgacagtggcattgctgggctctcttctatcagtcagtgtaccagcagtagccagctggatgaaacaagtcatcgatgggcacagccagacactgccccactacctgtcccggcaaacattcgcttctccatctggatctcattctttgagatctacaacgaactgctttatgacctattagaaccgcctagccaacagcgcaagaggcagactttgcggctatgcgaggatcaaaatggcaatccctatgtgaaagatctcaactggattcatgtgcaagatgctgaggaggcctggaagctcctaaaagtgggtcgtaagaaccagagctttgccagcacccacctcaaccagaactccagccgcagtcacagcatcttctcaatcaggatcctacaccttcagggggaaggagatatagtccccaagatcagcgagctgtcactctgtgatctggctggctcagagcgctgcaaagatcagaagagtggtgaacggttgaaggaagcaggaaacattaacacctctctacacaccctgggccgctgtattgctgcccttcgtcaaaaccagcagaaccggtcaaagcagaacctggttcccttccgtgacagcaagttgactcgagtgttccaaggtttcttcacaggccgaggccgttcctgcatgattgtcaatgtgaatccctgtgcatctacctatgatgaaactcttcatgtggccaagttctcagccattgctagccagcttgtgcatgccccacctatgcaactgggattcccatccctgcactcgttcatcaaggaacatagtcttcaggtatcccccagcttagagaaaggggctaaggcagacacaggccttgatgatgatattgaaaatgaagctgacatctccatgtatggcaaagaggagctcctacaagttgtggaagccatgaagacactgcttttgaaggaacgacaggaaaagctacagctggagatgcatctccgagatgaaatttgcaatgagatggtagaacagatgcaacagcgggaacagtggtgcagtgaacatttggacacccaaaaggaactattggaggaaatgtatgaagaaaaactaaatatcctcaaggagtcactgacaagtttttaccaagaagagattcaggagcgggatgaaaagattgaagagctagaagctctcttgcaggaagccagacaacagtcagtggcccatcagcaatcagggtctgaattggccctacggcggtcacaaaggttggcagcttctgcctccacccagcagcttcaggaggttaaagctaaattacagcagtgcaaagcagagctaaactctaccactgaagagttgcataagtatcagaaaatgttagaaccaccaccctcagccaagcccttcaccattgatgtggacaagaagttagaagagggccagaagaatataaggctgttgcggacagagcttcagaaacttggtgagtctctccaatcagcagagagagcttgttgccacagcactggggcaggaaaacttcgtcaagccttgaccacttgtgatgacatcttaatcaaacaggaccagactctggctgaactgcagaacaacatggtgctagtgaaactggaccttcggaagaaggcagcatgtattgctgagcagtatcatactgtgttgaaactccaaggccaggtttctgccaaaaagcgccttggtaccaaccaggaaaatcagcaaccaaaccaacaaccaccagggaagaaaccattccttcgaaatttacttccccgaacaccaacctgccaaagctcaacagactgcagcccttatgcccggatcctacgctcacggcgttcccctttactcaaatctgggccttttggcaaaaagtactaaggctgtggggaaagagaagagcagtcatggccctgaggtgggtcagctactctcctgaagaaataggtctcttttatgctttaccatatatcaggaattatatccaggatgcaatactcagacactagcttttttctcacttttgtattataaccacctatgtaatctcatgttgttgtttttttttatttacttatatgatttctatgcacacaaaaacagttatattaaagatattattgttcacattttttattgaattccaaatgtagcaaaatcattaaaacaaattataaaaggga
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:10112 -> Molecular function: GO:0003777 [microtubule motor activity] evidence: IEA
            GeneID:10112 -> Molecular function: GO:0005215 [transporter activity] evidence: TAS
            GeneID:10112 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
            GeneID:10112 -> Molecular function: GO:0008017 [microtubule binding] evidence: IEA
            GeneID:10112 -> Molecular function: GO:0019901 [protein kinase binding] evidence: IPI
            GeneID:10112 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: TAS
            GeneID:10112 -> Biological process: GO:0000910 [cytokinesis] evidence: IDA
            GeneID:10112 -> Biological process: GO:0000910 [cytokinesis] evidence: TAS
            GeneID:10112 -> Biological process: GO:0001578 [microtubule bundle formation] evidence: IDA
            GeneID:10112 -> Biological process: GO:0007018 [microtubule-based movement] evidence: IEA
            GeneID:10112 -> Biological process: GO:0015031 [protein transport] evidence: IEA
            GeneID:10112 -> Biological process: GO:0016192 [vesicle-mediated transport] evidence: TAS
            GeneID:10112 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
            GeneID:10112 -> Cellular component: GO:0005794 [Golgi apparatus] evidence: IEA
            GeneID:10112 -> Cellular component: GO:0005819 [spindle] evidence: IDA
            GeneID:10112 -> Cellular component: GO:0005871 [kinesin complex] evidence: IEA
            GeneID:10112 -> Cellular component: GO:0005874 [microtubule] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.