GGRNA Home | Help | Advanced search

2020-10-24 06:45:08, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_005713               5395 bp    mRNA    linear   PRI 04-MAY-2013
DEFINITION  Homo sapiens collagen, type IV, alpha 3 (Goodpasture antigen)
            binding protein (COL4A3BP), transcript variant 1, mRNA.
ACCESSION   NM_005713
VERSION     NM_005713.2  GI:194306557
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 5395)
  AUTHORS   Sugiki,T., Takeuchi,K., Yamaji,T., Takano,T., Tokunaga,Y.,
            Kumagai,K., Hanada,K., Takahashi,H. and Shimada,I.
  TITLE     Structural basis for the Golgi association by the pleckstrin
            homology domain of the ceramide trafficking protein (CERT)
  JOURNAL   J. Biol. Chem. 287 (40), 33706-33718 (2012)
   PUBMED   22869376
  REMARK    GeneRIF: Structural basis for the Golgi association by the
            pleckstrin homology domain of the ceramide trafficking protein
            (CERT)
REFERENCE   2  (bases 1 to 5395)
  AUTHORS   Olayioye,M.A. and Hausser,A.
  TITLE     Integration of non-vesicular and vesicular transport processes at
            the Golgi complex by the PKD-CERT network
  JOURNAL   Biochim. Biophys. Acta 1821 (8), 1096-1103 (2012)
   PUBMED   22226883
  REMARK    GeneRIF: CERT is at a convergence point of non-vesicular and
            vesicular transport processes and plays a central role within the
            PKD signaling network at the Golgi complex. (Review)
            Review article
REFERENCE   3  (bases 1 to 5395)
  AUTHORS   Heering,J., Weis,N., Holeiter,M., Neugart,F., Staebler,A.,
            Fehm,T.N., Bischoff,A., Schiller,J., Duss,S., Schmid,S., Korte,T.,
            Herrmann,A. and Olayioye,M.A.
  TITLE     Loss of the ceramide transfer protein augments EGF receptor
            signaling in breast cancer
  JOURNAL   Cancer Res. 72 (11), 2855-2866 (2012)
   PUBMED   22472120
  REMARK    GeneRIF: Loss of the ceramide transfer protein augments EGF
            receptor signaling in breast cancer.
REFERENCE   4  (bases 1 to 5395)
  AUTHORS   Mencarelli,C., Bode,G.H., Losen,M., Kulharia,M., Molenaar,P.C.,
            Veerhuis,R., Steinbusch,H.W., De Baets,M.H., Nicolaes,G.A. and
            Martinez-Martinez,P.
  TITLE     Goodpasture antigen-binding protein/ceramide transporter binds to
            human serum amyloid P-component and is present in brain amyloid
            plaques
  JOURNAL   J. Biol. Chem. 287 (18), 14897-14911 (2012)
   PUBMED   22396542
  REMARK    GeneRIF: The START domain in GPBP is important for this
            interaction. SAP and GPBP form complexes in blood and partly
            colocalize in amyloid plaques from Alzheimer disease patients.
REFERENCE   5  (bases 1 to 5395)
  AUTHORS   Chandran,S. and Machamer,C.E.
  TITLE     Inactivation of ceramide transfer protein during pro-apoptotic
            stress by Golgi disassembly and caspase cleavage
  JOURNAL   Biochem. J. 442 (2), 391-401 (2012)
   PUBMED   22129459
  REMARK    GeneRIF: during cellular stress, disassembly of Golgi structure
            together with inactivation of CERT by caspases causes a reduction
            in ceramide trafficking and sphingomyelin synthesis, and could
            contribute to the cellular response to pro-apoptotic stress
REFERENCE   6  (bases 1 to 5395)
  AUTHORS   Kumagai,K., Yasuda,S., Okemoto,K., Nishijima,M., Kobayashi,S. and
            Hanada,K.
  TITLE     CERT mediates intermembrane transfer of various molecular species
            of ceramides
  JOURNAL   J. Biol. Chem. 280 (8), 6488-6495 (2005)
   PUBMED   15596449
  REMARK    GeneRIF: results indicate that CERT can mediate transfer of various
            types of ceramides that naturally exist and their close relatives
REFERENCE   7  (bases 1 to 5395)
  AUTHORS   Hanada,K., Kumagai,K., Yasuda,S., Miura,Y., Kawano,M., Fukasawa,M.
            and Nishijima,M.
  TITLE     Molecular machinery for non-vesicular trafficking of ceramide
  JOURNAL   Nature 426 (6968), 803-809 (2003)
   PUBMED   14685229
  REMARK    GeneRIF: CERT mediates the intracellular trafficking of ceramide in
            a non-vesicular manner
REFERENCE   8  (bases 1 to 5395)
  AUTHORS   Raya,A., Revert-Ros,F., Martinez-Martinez,P., Navarro,S.,
            Rosello,E., Vieites,B., Granero,F., Forteza,J. and Saus,J.
  TITLE     Goodpasture antigen-binding protein, the kinase that phosphorylates
            the goodpasture antigen, is an alternatively spliced variant
            implicated in autoimmune pathogenesis
  JOURNAL   J. Biol. Chem. 275 (51), 40392-40399 (2000)
   PUBMED   11007769
REFERENCE   9  (bases 1 to 5395)
  AUTHORS   Raya,A., Revert,F., Navarro,S. and Saus,J.
  TITLE     Characterization of a novel type of serine/threonine kinase that
            specifically phosphorylates the human goodpasture antigen
  JOURNAL   J. Biol. Chem. 274 (18), 12642-12649 (1999)
   PUBMED   10212244
REFERENCE   10 (bases 1 to 5395)
  AUTHORS   Kalluri,R.
  TITLE     Goodpasture syndrome
  JOURNAL   Kidney Int. 55 (3), 1120-1122 (1999)
   PUBMED   10027952
  REMARK    Review article
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AK292087.1, AY453386.1,
            AK000604.1 and AC008897.7.
            On Jul 18, 2008 this sequence version replaced gi:5031716.
            
            Summary: This gene encodes a kinase that specifically
            phosphorylates the N-terminal region of the non-collagenous domain
            of the alpha 3 chain of type IV collagen, known as the Goodpasture
            antigen. Goodpasture disease is the result of an autoimmune
            response directed at this antigen. One isoform of this protein is
            also involved in ceramide intracellular transport. Three transcript
            variants encoding different isoforms have been found for this gene.
            [provided by RefSeq, Jul 2008].
            
            Transcript Variant: This variant (1) differs in the 5' UTR and
            coding region compared to variant 3. The resulting isoform (1) is
            shorter at the N-terminus compared to isoform 3.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data because no single transcript was available
            for the full length of the gene. The extent of this transcript is
            supported by transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            CDS exon combination :: AF136450.1, AY453386.1 [ECO:0000331]
            RNAseq introns       :: mixed/partial sample support ERS025081,
                                    ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-422               AK292087.1         1-422
            423-2297            AY453386.1         1-1875
            2298-3228           AK000604.1         1240-2170
            3229-5395           AC008897.7         28425-30591
FEATURES             Location/Qualifiers
     source          1..5395
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="5"
                     /map="5q13.3"
     gene            1..5395
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /note="collagen, type IV, alpha 3 (Goodpasture antigen)
                     binding protein"
                     /db_xref="GeneID:10087"
                     /db_xref="HGNC:2205"
                     /db_xref="HPRD:05246"
                     /db_xref="MIM:604677"
     exon            1..518
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    33..35
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /note="upstream in-frame stop codon"
     variation       174
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11549098"
     CDS             423..2297
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /EC_number="2.7.11.1"
                     /note="isoform 1 is encoded by transcript variant 1;
                     ceramide transporter; StAR-related lipid transfer (START)
                     domain containing 11; lipid-transfer protein CERTL; hCERT;
                     ceramide transfer protein"
                     /codon_start=1
                     /product="collagen type IV alpha-3-binding protein isoform
                     1"
                     /protein_id="NP_005704.1"
                     /db_xref="GI:5031717"
                     /db_xref="CCDS:CCDS4028.1"
                     /db_xref="GeneID:10087"
                     /db_xref="HGNC:2205"
                     /db_xref="HPRD:05246"
                     /db_xref="MIM:604677"
                     /translation="
MSDNQSWNSSGSEEDPETESGPPVERCGVLSKWTNYIHGWQDRWVVLKNNALSYYKSEDETEYGCRGSICLSKAVITPHDFDECRFDISVNDSVWYLRAQDPDHRQQWIDAIEQHKTESGYGSESSLRRHGSMVSLVSGASGYSATSTSSFKKGHSLREKLAEMETFRDILCRQVDTLQKYFDACADAVSKDELQRDKVVEDDEDDFPTTRSDGDFLHSTNGNKEKLFPHVTPKGINGIDFKGEAITFKATTAGILATLSHCIELMVKREDSWQKRLDKETEKKRRTEEAYKNAMTELKKKSHFGGPDYEEGPNSLINEEEFFDAVEAALDRQDKIEEQSQSEKVRLHWPTSLPSGDAFSSVGTHRFVQKPYSRSSSMSSIDLVSASDDVHRFSSQVEEMVQNHMTYSLQDVGGDANWQLVVEEGEMKVYRREVEENGIVLDPLKATHAVKGVTGHEVCNYFWNVDVRNDWETTIENFHVVETLADNAIIIYQTHKRVWPASQRDVLYLSVIRKIPALTENDPETWIVCNFSVDHDSAPLNNRCVRAKINVAMICQTLVSPPEGNQEISRDNILCKITYVANVNPGGWAPASVLRAVAKREYPKFLKRFTSYVQEKTAGKPILF
"
     misc_feature    498..767
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /note="Goodpasture antigen binding protein (GPBP)
                     Pleckstrin homology (PH) domain; Region: PH_GPBP; cd01247"
                     /db_xref="CDD:176323"
     misc_feature    order(498..500,504..506,543..545,549..557)
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /note="putative phosphoinositide binding site [chemical
                     binding]; other site"
                     /db_xref="CDD:176323"
     misc_feature    816..818
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine, by PKD; propagated from
                     UniProtKB/Swiss-Prot (Q9Y5P4.1); phosphorylation site"
     misc_feature    1365..1367
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q9Y5P4.1); phosphorylation site"
     misc_feature    1365..1367
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    1383..1403
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Y5P4.1);
                     Region: FFAT"
     misc_feature    1551..1553
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q9Y5P4.1); phosphorylation site"
     misc_feature    1593..2294
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /note="Ceramide-binding START domain of mammalian STARD11
                     and related domains; Region: START_STARD11-like; cd08872"
                     /db_xref="CDD:176881"
     misc_feature    order(1806..1808,1824..1826,1833..1838,1842..1847,
                     1899..1901,1905..1910,1914..1919,1923..1925,1932..1934,
                     1938..1940,1944..1946,2010..2012,2061..2063,2067..2069,
                     2073..2075,2157..2159,2169..2171,2175..2177,2202..2204,
                     2211..2216,2220..2228,2235..2237)
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /note="ceramide binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:176881"
     exon            519..653
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /inference="alignment:Splign:1.39.8"
     exon            654..770
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /inference="alignment:Splign:1.39.8"
     exon            771..878
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /inference="alignment:Splign:1.39.8"
     exon            879..1017
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /inference="alignment:Splign:1.39.8"
     exon            1018..1101
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /inference="alignment:Splign:1.39.8"
     exon            1102..1259
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /inference="alignment:Splign:1.39.8"
     exon            1260..1352
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /inference="alignment:Splign:1.39.8"
     exon            1353..1439
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /inference="alignment:Splign:1.39.8"
     exon            1440..1532
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /inference="alignment:Splign:1.39.8"
     exon            1533..1610
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /inference="alignment:Splign:1.39.8"
     exon            1611..1706
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /inference="alignment:Splign:1.39.8"
     exon            1707..1839
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /inference="alignment:Splign:1.39.8"
     exon            1840..1910
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /inference="alignment:Splign:1.39.8"
     exon            1911..2039
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /inference="alignment:Splign:1.39.8"
     exon            2040..2169
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /inference="alignment:Splign:1.39.8"
     exon            2170..2306
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /inference="alignment:Splign:1.39.8"
     exon            2307..5395
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /inference="alignment:Splign:1.39.8"
     polyA_signal    5145..5150
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
     polyA_site      5165
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
     STS             5247..5351
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /standard_name="SHGC-36269"
                     /db_xref="UniSTS:82739"
     polyA_signal    5311..5316
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
     polyA_site      5334
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
     polyA_signal    5345..5350
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
     polyA_signal    5374..5379
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
     polyA_site      5393
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
     variation       5394
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:3180743"
     polyA_site      5395
                     /gene="COL4A3BP"
                     /gene_synonym="CERT; CERTL; GPBP; STARD11"
ORIGIN      
aaatagtgggccaggcaggaagatggcggcggtagcggaggtgtgagtggacgcgggactcagcggccggattttctcttcccttcttttcccttttccttccctatttgaaattggcatcgagggggctaagttcgggtggcagcgccgggcgcaacgcaggggtcacggcgacggcggcggcggctgacggctggaagggtaggcttccttcaccgctcgtcctccttcctcgctccgctcggtgtcaggcgcggcggcggcgcggcgggcggacttcgtccctcctcctgctcccccccacaccggagcgggcactcttcgcttcgccatcccccgacccttcaccccgaggactgggcgcctcctccggcgcagctgagggagcgggggccggtctcctgctcggttgtcgagcctccatgtcggataatcagagctggaactcgtcgggctcggaggaggatccagagacggagtctgggccgcctgtggagcgctgcggggtcctcagtaagtggacaaactacattcatgggtggcaggatcgttgggtagttttgaaaaataatgctctgagttactacaaatctgaagatgaaacagagtatggctgcagaggatccatctgtcttagcaaggctgtcatcacacctcacgattttgatgaatgtcgatttgatattagtgtaaatgatagtgtttggtatcttcgtgctcaggatccagatcatagacagcaatggatagatgccattgaacagcacaagactgaatctggatatggatctgaatccagcttgcgtcgacatggctcaatggtgtccctggtgtctggagcaagtggctactctgcaacatccacctcttcattcaagaaaggccacagtttacgtgagaagttggctgaaatggaaacatttagagacatcttatgtagacaagttgacacgctacagaagtactttgatgcctgtgctgatgctgtctctaaggatgaacttcaaagggataaagtggtagaagatgatgaagatgactttcctacaacgcgttctgatggtgacttcttgcatagtaccaacggcaataaagaaaagttatttccacatgtgacaccaaaaggaattaatggtatagactttaaaggggaagcgataacttttaaagcaactactgctggaatccttgcaacactttctcattgtattgaactaatggttaaacgtgaggacagctggcagaagagactggataaggaaactgagaagaaaagaagaacagaggaagcatataaaaatgcaatgacagaacttaagaaaaaatcccactttggaggaccagattatgaagaaggccctaacagtctgattaatgaagaagagttctttgatgctgttgaagctgctcttgacagacaagataaaatagaagaacagtcacagagtgaaaaggtgagattacattggcctacatccttgccctctggagatgccttttcttctgtggggacacatagatttgtccaaaagccctatagtcgctcttcctccatgtcttccattgatctagtcagtgcctctgatgatgttcacagattcagctcccaggttgaagagatggtgcagaaccacatgacttactcattacaggatgtaggcggagatgccaattggcagttggttgtagaagaaggagaaatgaaggtatacagaagagaagtagaagaaaatgggattgttctggatcctttaaaagctacccatgcagttaaaggcgtcacaggacatgaagtctgcaattatttctggaatgttgacgttcgcaatgactgggaaacaactatagaaaactttcatgtggtggaaacattagctgataatgcaatcatcatttatcaaacacacaagagggtgtggcctgcttctcagcgagacgtattatatctttctgtcattcgaaagataccagccttgactgaaaatgaccctgaaacttggatagtttgtaatttttctgtggatcatgacagtgctcctctaaacaaccgatgtgtccgtgccaaaataaatgttgctatgatttgtcaaaccttggtaagcccaccagagggaaaccaggaaattagcagggacaacattctatgcaagattacatatgtagctaatgtgaaccctggaggatgggcaccagcctcagtgttaagggcagtggcaaagcgagagtatcctaaatttctaaaacgttttacttcttacgtccaagaaaaaactgcaggaaagcctattttgttctagtattaacagtgactgaagcaaggctgtgtgacattccatgttggagaaaaaaagaaaaaaaaaagctgaatgctctaagctggaacgtaggatctatagccttgtctgtggcccaagaccttggccttgtgtacaaaaatgacaaaatattgcaatagcaaagctgaacatctaacactagctatctcttgctagatctccttgctcagcatataactataaatacatgtaaaattacatgtatatggctatatttttatttgcttgctcctagaagagaaaaaaaaatcaactttgaatcacaactaggaattgatgctttaatttttggatactttttcagaatttttaatttactatggtccggcctaagatcctctgttgtatcaggttttgtgcacaaaagaaaagcacaaaagttgaatgcacatggggcatgtgctttctgtgcaccaaatatctggatgaggttcttttttcaggcctacagtcaaatctgtgtccagaattttttgacttttttgctttgtataatcatagaattcattgctgctgatttctataatgattcatgttgtcatgtgtctcttaataactgagggctgtcagtaacctgtgattttgccttttctatagtcttactcccatgaagaaccttggttctgatggagaaagtgaaaagctttatttcttcccctagatatctttatatttctattatattttttagttgtgtactgtgtactagagatttttttcagtttgttatgaacacaatttggtaagccctaaattggttctgcctgtctccaaacagaaacatctgtacaaatcttgttggtatagactactttctggaaaatggtcaagataagttcatgttttcttgaaatttctaagatagtatatggtatcacttgtttaaagcaaatcagactgagtttgacatttaattcaatatttctggtattcagtaacgggtatatatgtttgttcttccagtttgggtcagtttaaaagatatgttgcaaagtatacatagaaaatgtgagcaatgcctctctttgccttttgatcagaaacttcagcagagcggtaaggattccacatgatttaaactgaaatgcttttctttgttgctgtaagaacttaaaatgtaaaatacctttttcagtttaagtcctgtaaacaacattgaagcatggagatgaggcaaggaatagtactcactgaagttgaaatgactgcccacttcaaaatcttcattgtgtttacacaccagtgtatttatacaaatcagaggcattttgtagatgctttgctgacttgttcagctctgtaaaaacacagaaatcagacccattttgtaaagcggaaaatcatgttacatggaacatgtcctgtatatatcacatacatggtaatggagtcttaatgataagtgcaagataataatttaatgatgggattagtctgatcgcttaatatgcacaatcctggaagtgaattacttgcatcagatatagtgatatttattattctgtacagagagaaaaatacatataaaacatatgcttacattacatgcacgcggatttcatgctccataatcttttctattttttaatttacctttctgtaaatgatgtgcatggaatatgccttatagaaaaatgctgttcataatttgactacgtggaaaagtgcctatatggtggtaatgctagtaaggcaaataagacaaattatcatgttggtttactacatcaccagttaacattttatattgtgatgtttaaaaaagaaaaatttatacctcaaatgtgtattttattttacaatcagctgtggggtatggggttgggatgggagaatgggggggttggggagggcaggtttattcaccatagccgctgataagaatcttcaaaaaaattctatatgcgcactataaatgtttctctgtttgccatttctggtaactatcatgaacacagacagttaactctttcataactgaattggatagctttattttacagaagtatggcaagtttacaaagcaatatctaaatctaattatcattagttgcatttggactaaatgtgatgatatacttttgcaattgattctgtaaataaaaggattacactaaaatatttgtattaaaagaagaaaagataacattttacctttagataactgcacttgtacctcactagagttaatcccacccaatcagattgagaaataaattggggaatgtggaaagagtccaaaagaggtcagaatttggagaggtactggccttctggacaacatttagaccctctacaattattttcattaagctgattcctacatcctgaatattcatgttttctcatctacagatatttgtcttcccccaaactaaaagaaaaaaaactaccctttactctcttttctactcagttactcttttgtgctatgttagaaacttgaaatatattggtgatgtggggattttgtccctgactgcccactgtacaggacaagagagtacagtgtttcagttggaattcaggactcctggttttgaggtagaggatgatcactgcagtacttggtttggaattgccacaggggtagctaaaccaaaggagggttatatctgcaagggaggtgtaagaaggcaaaataaggaaaaggaggaatgggttttctatttgttcagtttcatcaactaatttatacacttaatacaacttcagtgtcaattgctattaagaaatttttagttgggctgagctggttctcttgtgaaattgtgctggttatctttaagcttatcagttatttgtccaattaaacacttttcaccagtatttagtccgagttgtacagacgatgtatttggattttgtcatggttcatctacagactcaaaacataatcattttaaagtaccttgggagtgtgtagagtaacttctataatagctttatgatcctgatgatgttttttaaacacaataaagttggatcttccatgttacaatcacagaattaaaaccagtatttaaagtggaaaagtattaaaatattatggacaaata
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:10087 -> Molecular function: GO:0004672 [protein kinase activity] evidence: TAS
            GeneID:10087 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:10087 -> Molecular function: GO:0035620 [ceramide transporter activity] evidence: IDA
            GeneID:10087 -> Molecular function: GO:0070273 [phosphatidylinositol-4-phosphate binding] evidence: IDA
            GeneID:10087 -> Molecular function: GO:0097001 [ceramide binding] evidence: IDA
            GeneID:10087 -> Biological process: GO:0000902 [cell morphogenesis] evidence: IEA
            GeneID:10087 -> Biological process: GO:0001701 [in utero embryonic development] evidence: IEA
            GeneID:10087 -> Biological process: GO:0003007 [heart morphogenesis] evidence: IEA
            GeneID:10087 -> Biological process: GO:0006468 [protein phosphorylation] evidence: TAS
            GeneID:10087 -> Biological process: GO:0006665 [sphingolipid metabolic process] evidence: TAS
            GeneID:10087 -> Biological process: GO:0006672 [ceramide metabolic process] evidence: IEA
            GeneID:10087 -> Biological process: GO:0006936 [muscle contraction] evidence: IEA
            GeneID:10087 -> Biological process: GO:0006955 [immune response] evidence: NAS
            GeneID:10087 -> Biological process: GO:0007029 [endoplasmic reticulum organization] evidence: IEA
            GeneID:10087 -> Biological process: GO:0007165 [signal transduction] evidence: IEA
            GeneID:10087 -> Biological process: GO:0008283 [cell proliferation] evidence: IEA
            GeneID:10087 -> Biological process: GO:0030148 [sphingolipid biosynthetic process] evidence: TAS
            GeneID:10087 -> Biological process: GO:0034976 [response to endoplasmic reticulum stress] evidence: IEA
            GeneID:10087 -> Biological process: GO:0035621 [ER to Golgi ceramide transport] evidence: IGI
            GeneID:10087 -> Biological process: GO:0035621 [ER to Golgi ceramide transport] evidence: IMP
            GeneID:10087 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS
            GeneID:10087 -> Biological process: GO:0055088 [lipid homeostasis] evidence: IEA
            GeneID:10087 -> Biological process: GO:0070584 [mitochondrion morphogenesis] evidence: IEA
            GeneID:10087 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:10087 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
            GeneID:10087 -> Cellular component: GO:0005739 [mitochondrion] evidence: IEA
            GeneID:10087 -> Cellular component: GO:0005789 [endoplasmic reticulum membrane] evidence: TAS
            GeneID:10087 -> Cellular component: GO:0005794 [Golgi apparatus] evidence: IDA
            GeneID:10087 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
            GeneID:10087 -> Cellular component: GO:0048471 [perinuclear region of cytoplasm] evidence: IDA
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_005704 -> EC 2.7.11.1

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.