Home |
Help |
Advanced search
2024-04-19 14:21:24, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_005687 2233 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens phenylalanyl-tRNA synthetase, beta subunit (FARSB),
mRNA.
ACCESSION NM_005687
VERSION NM_005687.3 GI:124028524
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2233)
AUTHORS Klipcan,L., Moor,N., Finarov,I., Kessler,N., Sukhanova,M. and
Safro,M.G.
TITLE Crystal structure of human mitochondrial PheRS complexed with
tRNA(Phe) in the active 'open' state
JOURNAL J. Mol. Biol. 415 (3), 527-537 (2012)
PUBMED 22137894
REMARK GeneRIF: Human PheRS recognizes C74, the G1-C72 base pair, and the
'discriminator' base A73, proposed to contribute to tRNA(Phe)
identity in the yeast mitochondrial enzyme.
REFERENCE 2 (bases 1 to 2233)
AUTHORS Finarov,I., Moor,N., Kessler,N., Klipcan,L. and Safro,M.G.
TITLE Structure of human cytosolic phenylalanyl-tRNA synthetase: evidence
for kingdom-specific design of the active sites and tRNA binding
patterns
JOURNAL Structure 18 (3), 343-353 (2010)
PUBMED 20223217
REMARK GeneRIF: Structure of human cytosolic phenylalanyl-tRNA synthetase:
evidence for kingdom-specific design of the active sites and tRNA
binding patterns
REFERENCE 3 (bases 1 to 2233)
AUTHORS Yu,X.Y., Finn,J., Hill,J.M., Wang,Z.G., Keith,D., Silverman,J. and
Oliver,N.
TITLE A series of spirocyclic analogues as potent inhibitors of bacterial
phenylalanyl-tRNA synthetases
JOURNAL Bioorg. Med. Chem. Lett. 14 (5), 1339-1342 (2004)
PUBMED 14980694
REFERENCE 4 (bases 1 to 2233)
AUTHORS Vasil'eva,I.A., Bogachev,V.S., Favre,A., Lavrik,O.I. and Moor,N.A.
TITLE Role of low-molecular-weight substrates in functional binding of
the tRNAPhe acceptor end by phenylalanyl-tRNA synthetase
JOURNAL Biochemistry Mosc. 69 (2), 143-153 (2004)
PUBMED 15000680
REFERENCE 5 (bases 1 to 2233)
AUTHORS Moor,N., Lavrik,O., Favre,A. and Safro,M.
TITLE Prokaryotic and eukaryotic tetrameric phenylalanyl-tRNA synthetases
display conservation of the binding mode of the tRNA(Phe) CCA end
JOURNAL Biochemistry 42 (36), 10697-10708 (2003)
PUBMED 12962494
REFERENCE 6 (bases 1 to 2233)
AUTHORS Moor,N., Linshiz,G. and Safro,M.
TITLE Cloning and expression of human phenylalanyl-tRNA synthetase in
Escherichia coli: comparative study of purified recombinant enzymes
JOURNAL Protein Expr. Purif. 24 (2), 260-267 (2002)
PUBMED 11858721
REFERENCE 7 (bases 1 to 2233)
AUTHORS Rodova,M., Ankilova,V. and Safro,M.G.
TITLE Human phenylalanyl-tRNA synthetase: cloning, characterization of
the deduced amino acid sequences in terms of the structural domains
and coordinately regulated expression of the alpha and beta
subunits in chronic myeloid leukemia cells
JOURNAL Biochem. Biophys. Res. Commun. 255 (3), 765-773 (1999)
PUBMED 10049785
REFERENCE 8 (bases 1 to 2233)
AUTHORS Sen,S., Zhou,H., Ripmaster,T., Hittelman,W.N., Schimmel,P. and
White,R.A.
TITLE Expression of a gene encoding a tRNA synthetase-like protein is
enhanced in tumorigenic human myeloid leukemia cells and is cell
cycle stage- and differentiation-dependent
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 94 (12), 6164-6169 (1997)
PUBMED 9177188
REFERENCE 9 (bases 1 to 2233)
AUTHORS Nazarenko,I.A., Peterson,E.T., Zakharova,O.D., Lavrik,O.I. and
Uhlenbeck,O.C.
TITLE Recognition nucleotides for human phenylalanyl-tRNA synthetase
JOURNAL Nucleic Acids Res. 20 (3), 475-478 (1992)
PUBMED 1741281
REFERENCE 10 (bases 1 to 2233)
AUTHORS Archambault de Vencay,J., Thomes,J.C. and Julien,R.
TITLE Phenylalanyl-tRNA synthetase of the human placenta. Evidence for
different enzymatic forms in equilibrium
JOURNAL FEBS Lett. 89 (1), 98-102 (1978)
PUBMED 658405
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AC104772.3, AF042346.1 and
AC097461.3.
On Jan 23, 2007 this sequence version replaced gi:19923332.
Summary: This gene encodes a highly conserved enzyme that belongs
to the aminoacyl-tRNA synthetase class IIc subfamily. This enzyme
comprises the regulatory beta subunits that form a tetramer with
two catalytic alpha subunits. In the presence of ATP, this tetramer
is responsible for attaching L-phenylalanine to the terminal
adenosine of the appropriate tRNA. A pseudogene located on
chromosome 10 has been identified. [provided by RefSeq, Jul 2008].
##Evidence-Data-START##
Transcript exon combination :: D84430.1, AF042346.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025084 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-35 AC104772.3 39762-39796 c
36-1787 AF042346.1 1-1752
1788-2233 AC097461.3 123246-123691 c
FEATURES Location/Qualifiers
source 1..2233
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="2"
/map="2q36.1"
gene 1..2233
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/note="phenylalanyl-tRNA synthetase, beta subunit"
/db_xref="GeneID:10056"
/db_xref="HGNC:17800"
/db_xref="MIM:609690"
exon 1..93
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/inference="alignment:Splign:1.39.8"
misc_feature 21..23
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/note="upstream in-frame stop codon"
CDS 36..1805
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/EC_number="6.1.1.20"
/note="phenylalanyl-tRNA synthetase beta-subunit;
phenylalanine-tRNA synthetase-like, beta subunit;
phenylalanyl-tRNA synthetase-like, beta subunit;
phenylalanine tRNA ligase 1, beta, cytoplasmic;
phenylalanine-tRNA ligase beta chain; phenylalanyl-tRNA
synthetase beta chain; phenylalanine--tRNA ligase beta
chain"
/codon_start=1
/product="phenylalanine--tRNA ligase beta subunit"
/protein_id="NP_005678.3"
/db_xref="GI:124028525"
/db_xref="CCDS:CCDS2454.1"
/db_xref="GeneID:10056"
/db_xref="HGNC:17800"
/db_xref="MIM:609690"
/translation="
MPTVSVKRDLLFQALGRTYTDEEFDELCFEFGLELDEITSEKEIISKEQGNVKAAGASDVVLYKIDVPANRYDLLCLEGLVRGLQVFKERIKAPVYKRVMPDGKIQKLIITEETAKIRPFAVAAVLRNIKFTKDRYDSFIELQEKLHQNICRKRALVAIGTHDLDTLSGPFTYTAKRPSDIKFKPLNKTKEYTACELMNIYKTDNHLKHYLHIIENKPLYPVIYDSNGVVLSMPPIINGDHSRITVNTRNIFIECTGTDFTKAKIVLDIIVTMFSEYCENQFTVEAAEVVFPNGKSHTFPELAYRKEMVRADLINKKVGIRETPENLAKLLTRMYLKSEVIGDGNQIEIEIPPTRADIIHACDIVEDAAIAYGYNNIQMTLPKTYTIANQFPLNKLTELLRHDMAAAGFTEALTFALCSQEDIADKLGVDISATKAVHISNPKTAEFQVARTTLLPGLLKTIAANRKMPLPLKLFEISDIVIKDSNTDVGAKNYRHLCAVYYNKNPGFEIIHGLLDRIMQLLDVPPGEDKGGYVIKASEGPAFFPGRCAEIFARGQSVGKLGVLHPDVITKFELTMPCSSLEINVGPFL
"
misc_feature 36..1802
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/note="probable phenylalanyl-tRNA synthetase beta chain;
Region: PLN02265"
/db_xref="CDD:177906"
misc_feature 387..872
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/note="B3/4 domain; Region: B3_4; smart00873"
/db_xref="CDD:197941"
misc_feature 948..1157
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/note="tRNA synthetase B5 domain; Region: B5; smart00874"
/db_xref="CDD:197942"
misc_feature 1209..1799
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/note="Phenylalanyl-tRNA synthetase (PheRS) beta chain
core domain. PheRS belongs to class II aminoacyl-tRNA
synthetases (aaRS) based upon its structure. While class
II aaRSs generally aminoacylate the 3'-OH ribose of the
appropriate tRNA, PheRS is an...; Region:
PheRS_beta_core; cd00769"
/db_xref="CDD:29814"
misc_feature order(1215..1220,1239..1241,1248..1250,1260..1262,
1266..1268,1272..1280,1344..1355,1386..1388,1428..1430,
1455..1457,1470..1472,1476..1478,1482..1484,1512..1514,
1575..1577)
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/note="dimer interface [polypeptide binding]; other site"
/db_xref="CDD:29814"
misc_feature 1260..1280
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/note="motif 1; other site"
/db_xref="CDD:29814"
misc_feature 1404..1415
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/note="motif 3; other site"
/db_xref="CDD:29814"
misc_feature 1476..1484
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/note="motif 2; other site"
/db_xref="CDD:29814"
exon 94..149
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/inference="alignment:Splign:1.39.8"
exon 150..304
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/inference="alignment:Splign:1.39.8"
exon 305..374
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/inference="alignment:Splign:1.39.8"
exon 375..490
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/inference="alignment:Splign:1.39.8"
exon 491..641
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/inference="alignment:Splign:1.39.8"
exon 642..750
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/inference="alignment:Splign:1.39.8"
exon 751..821
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/inference="alignment:Splign:1.39.8"
exon 822..883
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/inference="alignment:Splign:1.39.8"
exon 884..935
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/inference="alignment:Splign:1.39.8"
exon 936..997
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/inference="alignment:Splign:1.39.8"
exon 998..1205
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/inference="alignment:Splign:1.39.8"
exon 1206..1286
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/inference="alignment:Splign:1.39.8"
exon 1287..1379
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/inference="alignment:Splign:1.39.8"
exon 1380..1497
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/inference="alignment:Splign:1.39.8"
exon 1498..1653
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/inference="alignment:Splign:1.39.8"
exon 1654..2233
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/inference="alignment:Splign:1.39.8"
variation 1675
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1802198"
STS 1679..1884
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/standard_name="HSC2BG052"
/db_xref="UniSTS:33717"
STS 1746..1886
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/standard_name="G62071"
/db_xref="UniSTS:139192"
STS 1771..1874
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/standard_name="A002O40"
/db_xref="UniSTS:33045"
polyA_signal 1911..1916
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
polyA_site 1931
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/note="The 3' most polyA site has not been determined.
This is a major polyA site."
variation 1967
/gene="FARSB"
/gene_synonym="FARSLB; FRSB; HSPC173; PheHB; PheRS"
/replace="a"
/replace="g"
/db_xref="dbSNP:3211018"
ORIGIN
agctcgctgcgcaggcgcagtgagttcgacacaccatgccgactgtcagcgtgaagcgtgatctgctcttccaagccctgggccgcacctacactgacgaagaatttgatgaactatgttttgaatttggtctggagcttgatgaaattacatctgagaaggaaataataagtaaagaacaaggtaatgtaaaggcagcaggagcctctgatgttgttctttacaaaattgacgtccctgccaatagatatgatctcctgtgtctggaaggattggttcgaggacttcaggtcttcaaagaaaggataaaggctccagtgtataaacgggtaatgcctgatggaaaaatccagaaattgattatcacagaagagacagctaagatacgtccttttgcggtagcagcagttctccgtaatataaagtttactaaagatcgatatgacagcttcattgaacttcaggagaaattacatcagaatatttgcaggaaaagagcactggttgccattggtacccatgatttggacactttgtcgggcccatttacttatactgcaaagcgtccttcagatatcaaattcaagcctctaaataagaccaaggagtatacagcctgtgaactgatgaacatatacaagactgacaatcacctgaaacattatttacatatcattgaaaacaaacccctgtatccagttatctatgatagcaatggtgtcgtcctttcaatgcctcccatcatcaatggggatcattccagaataacagtaaatactagaaatatttttattgaatgcacgggaactgactttactaaggcaaaaatagttcttgatattattgtcaccatgttcagtgaatattgtgagaatcaatttacggtcgaagctgctgaagtggtttttcctaatggaaaatcacatacctttccagaattagcttaccgaaaggagatggtgagagctgacctaattaacaaaaaagttggaatcagagaaactccagaaaatcttgccaaacttctgaccaggatgtatttaaaatcagaagtcataggtgatgggaatcagattgagattgaaatccctccaaccagagctgacattatccatgcatgtgatattgtagaagatgcagctattgcttatggatataacaacattcagatgactctcccgaaaacttacaccatagctaatcaatttcctcttaataagctcactgaacttctccgacatgacatggcagccgctggcttcactgaagcacttacctttgccctgtgctcccaagaagatattgctgataaactaggtgtggatatctctgcaacaaaggcagtccacataagtaatcctaaaacagctgaatttcaggtggcacgcactacccttcttcctggcctcctgaagaccatagcagcaaatcgtaagatgccccttccactgaaactgtttgaaatctctgacattgtaataaaagattctaatacagatgtaggtgcaaaaaactacagacatctctgtgctgtttattacaacaagaatcctgggtttgagatcattcatgggctgctggacagaattatgcagttgctcgatgtgcctcctggtgaagacaaggggggatatgtgatcaaagcatcagaagggcctgctttcttccccgggcgatgtgcagagatctttgccaggggtcaaagcgtcgggaagcttggggtccttcatcctgacgttatcaccaaatttgagctgaccatgccctgctcctccctagaaatcaatgttggaccctttttgtgaagattggtctctgtggtgtgattctcttcccaggtgtccctttctcctcccctagtgtccttaagtcctcctccacagggaacatctatttgggctttgatgtttaataaagtagaaagcactgtctggctgtgtgggtagagaccatcctttccctgcatattaggccagcttgtgccatataccagtgtggtgtctgtgtgtgaagctgcattgttgggtaaaagccccgtggagtgctggagaaatgcactagcagagtgcaggatctgttctgaaaggcagacgtgctcctcagacatcagaacatcacattggaacggattactcctgcataacaagatcccatttctttccttattgataaaacaagataatcgatgagaattcatgttgcatgagttcgagataactgaggggtttagctt
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:10056 -> Molecular function: GO:0000287 [magnesium ion binding] evidence: IEA
GeneID:10056 -> Molecular function: GO:0003723 [RNA binding] evidence: IEA
GeneID:10056 -> Molecular function: GO:0004826 [phenylalanine-tRNA ligase activity] evidence: IEA
GeneID:10056 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
GeneID:10056 -> Biological process: GO:0006412 [translation] evidence: TAS
GeneID:10056 -> Biological process: GO:0006418 [tRNA aminoacylation for protein translation] evidence: TAS
GeneID:10056 -> Biological process: GO:0006432 [phenylalanyl-tRNA aminoacylation] evidence: IEA
GeneID:10056 -> Biological process: GO:0010467 [gene expression] evidence: TAS
GeneID:10056 -> Cellular component: GO:0005737 [cytoplasm] evidence: TAS
GeneID:10056 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_005678 -> EC 6.1.1.20
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.