GGRNA Home | Help | Advanced search

2020-10-26 19:11:26, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_005646               5130 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens TAR (HIV-1) RNA binding protein 1 (TARBP1), mRNA.
ACCESSION   NM_005646
VERSION     NM_005646.3  GI:110825987
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 5130)
  AUTHORS   Sand,M., Skrygan,M., Georgas,D., Arenz,C., Gambichler,T., Sand,D.,
            Altmeyer,P. and Bechara,F.G.
  TITLE     Expression levels of the microRNA maturing microprocessor complex
            component DGCR8 and the RNA-induced silencing complex (RISC)
            components argonaute-1, argonaute-2, PACT, TARBP1, and TARBP2 in
            epithelial skin cancer
  JOURNAL   Mol. Carcinog. 51 (11), 916-922 (2012)
   PUBMED   22025453
  REMARK    GeneRIF: DGCR8, AGO1, AGO2, PACT, and TARBP1 expression levels were
            significantly higher in the epithelial skin cancer groups than the
            healthy controls (P > 0.05).
REFERENCE   2  (bases 1 to 5130)
  AUTHORS   Daniels,S.M., Melendez-Pena,C.E., Scarborough,R.J., Daher,A.,
            Christensen,H.S., El Far,M., Purcell,D.F., Laine,S. and Gatignol,A.
  TITLE     Characterization of the TRBP domain required for dicer interaction
            and function in RNA interference
  JOURNAL   BMC Mol. Biol. 10, 38 (2009)
   PUBMED   19422693
  REMARK    GeneRIF: Binding of Dicer to TRBPs is critical for RNAi function.
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 5130)
  AUTHORS   Wu,H., Min,J., Zeng,H. and Plotnikov,A.N.
  TITLE     Crystal structure of the methyltransferase domain of human TARBP1
  JOURNAL   Proteins 72 (1), 519-525 (2008)
   PUBMED   18412263
  REMARK    GeneRIF: The crystal structure of methyltransferase domain of human
            TARBP1 protein in complex with S-adenosyl-L-homocysteine (AdoHcy)
            at 1.6-A resolution, is reported.
REFERENCE   4  (bases 1 to 5130)
  AUTHORS   Seshadri,S., DeStefano,A.L., Au,R., Massaro,J.M., Beiser,A.S.,
            Kelly-Hayes,M., Kase,C.S., D'Agostino,R.B. Sr., Decarli,C.,
            Atwood,L.D. and Wolf,P.A.
  TITLE     Genetic correlates of brain aging on MRI and cognitive test
            measures: a genome-wide association and linkage analysis in the
            Framingham Study
  JOURNAL   BMC Med. Genet. 8 (SUPPL 1), S15 (2007)
   PUBMED   17903297
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 5130)
  AUTHORS   Yedavalli,V.S., Benkirane,M. and Jeang,K.T.
  TITLE     Tat and trans-activation-responsive (TAR) RNA-independent induction
            of HIV-1 long terminal repeat by human and murine cyclin T1
            requires Sp1
  JOURNAL   J. Biol. Chem. 278 (8), 6404-6410 (2003)
   PUBMED   12458222
  REMARK    GeneRIF: induces induction of HIV-1 long terminal repeat by human
            and murine cyclin T1 and requires Sp1.
REFERENCE   6  (bases 1 to 5130)
  AUTHORS   Wu-Baer,F., Lane,W.S. and Gaynor,R.B.
  TITLE     Identification of a group of cellular cofactors that stimulate the
            binding of RNA polymerase II and TRP-185 to human immunodeficiency
            virus 1 TAR RNA
  JOURNAL   J. Biol. Chem. 271 (8), 4201-4208 (1996)
   PUBMED   8626763
REFERENCE   7  (bases 1 to 5130)
  AUTHORS   Wu-Baer,F., Lane,W.S. and Gaynor,R.B.
  TITLE     The cellular factor TRP-185 regulates RNA polymerase II binding to
            HIV-1 TAR RNA
  JOURNAL   EMBO J. 14 (23), 5995-6009 (1995)
   PUBMED   8846792
REFERENCE   8  (bases 1 to 5130)
  AUTHORS   Wu-Baer,F., Sigman,D. and Gaynor,R.B.
  TITLE     Specific binding of RNA polymerase II to the human immunodeficiency
            virus trans-activating region RNA is regulated by cellular
            cofactors and Tat
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 92 (16), 7153-7157 (1995)
   PUBMED   7638159
REFERENCE   9  (bases 1 to 5130)
  AUTHORS   Sheline,C.T., Milocco,L.H. and Jones,K.A.
  TITLE     Two distinct nuclear transcription factors recognize loop and bulge
            residues of the HIV-1 TAR RNA hairpin
  JOURNAL   Genes Dev. 5 (12B), 2508-2520 (1991)
   PUBMED   1752441
REFERENCE   10 (bases 1 to 5130)
  AUTHORS   Wu,F., Garcia,J., Sigman,D. and Gaynor,R.
  TITLE     tat regulates binding of the human immunodeficiency virus
            trans-activating region RNA loop-binding protein TRP-185
  JOURNAL   Genes Dev. 5 (11), 2128-2140 (1991)
   PUBMED   1936997
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from U38847.1, AL136124.10 and
            AL355472.19.
            On Jul 28, 2006 this sequence version replaced gi:19743835.
            
            Summary: HIV-1, the causative agent of acquired immunodeficiency
            syndrome (AIDS), contains an RNA genome that produces a
            chromosomally integrated DNA during the replicative cycle.
            Activation of HIV-1 gene expression by the transactivator Tat is
            dependent on an RNA regulatory element (TAR) located downstream of
            the transcription initiation site. This element forms a stable
            stem-loop structure and can be bound by either the protein encoded
            by this gene or by RNA polymerase II. This protein may act to
            disengage RNA polymerase II from TAR during transcriptional
            elongation. Alternatively spliced transcripts of this gene may
            exist, but their full-length natures have not been determined.
            [provided by RefSeq, Jul 2008].
            
            ##Evidence-Data-START##
            Transcript exon combination :: U38847.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-485               U38847.1           1-485
            486-486             AL136124.10        60276-60276         c
            487-3515            U38847.1           487-3515
            3516-3516           AL136124.10        2399-2399           c
            3517-3737           U38847.1           3517-3737
            3738-3738           AL355472.19        82785-82785         c
            3739-4256           U38847.1           3739-4256
            4257-4275           AL355472.19        66092-66110         c
            4276-5098           U38847.1           4276-5098
            5099-5130           AL355472.19        63599-63630         c
FEATURES             Location/Qualifiers
     source          1..5130
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1q42.3"
     gene            1..5130
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /note="TAR (HIV-1) RNA binding protein 1"
                     /db_xref="GeneID:6894"
                     /db_xref="HGNC:11568"
                     /db_xref="MIM:605052"
     CDS             1..4866
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /note="TAR (HIV) RNA-binding protein 1; TAR (HIV) RNA
                     binding protein 1; TAR RNA loop binding protein; TAR
                     RNA-binding protein 1; TAR RNA-binding protein of 185 kDa;
                     tRNA methyltransferase 3 homolog"
                     /codon_start=1
                     /product="probable methyltransferase TARBP1"
                     /protein_id="NP_005637.3"
                     /db_xref="GI:110825988"
                     /db_xref="CCDS:CCDS1601.1"
                     /db_xref="GeneID:6894"
                     /db_xref="HGNC:11568"
                     /db_xref="MIM:605052"
                     /translation="
MEWVLAEALLSQSRDPRALLGALCQGEASAERVETLRFLLQRLEDEEARGSGGAGALPEAAREVAAGYLVPLLRSLRGRPAGGPDPSLQPRHRRRVLRAAGAALRSCVRLAGRPQLAAALAEEALRDLLAGWRAPGAEAAVEVLAAVGPCLRPREDGPLLERVAGTAVALALGGGGDGDEAGPAEDAAALVAGRLLPVLVQCGGAALRAVWGGLAAPGASLGSGRVEEKLLVLSALAEKLLPEPGGDRARGAREAGPDARRCWRFWRTVQAGLGQADALTRKRARYLLQRAVEVSAELGADCTCGPQEGNGPSLFWWSERKKDELLKFWENYILIMETLEGNQIHVIKPVLPKLNNLFEYAVSEENGCWLFHPSWHMCIYKRMFESENKILSKEGVIHFLELYETKILPFSPEFSEFIIGPLMDALSESSLYSRSPGQPIGSCSPLGLKLQKFLVTYISLLPEEIKSSFLLKFIRKMTSRHWCAVPILFLSKALANVPRHKALGIDGLLALRDVIHCTMITHQILLRGAAQCYLLQTAMNLLDVEKVSLSDVSTFLMSLRQEESLGRGTSLWTELCDWLRVNESYFKPSPTCSSIGLHKTSLNAYVKSIVQEYVKSSAWETGENCFMPDWFEAKLVSLMVLLAVDVEGMKTQYSGKQRTENVLRIFLDPLLDVLMKFSTNAYMPLLKTDRCLQLLLKLLNTCRLKGSSAQDDEVSTVLQNFFMSTTESISEFILRRLTMNELNSVSDLDRCHLYLMVLTELINLHLKVGWKRGNPIWRVISLLKNASIQHLQEMDSGQEPTVGSQIQRVVSMAALAMVCEAIDQKPELQLDSLHAGPLESFLSSLQLNQTLQKPHAEEQSSYAHPLECSSVLEESSSSQGWGKIVAQYIHDQWVCLSFLLKKYHTLIPTTGSEILEPFLPAVQMPIRTLQSALEALTVLSSDQVLPVFHCLKVLVPKLLTSSESLCIESFDMAWKIISSLSNTQLIFWANLKAFVQFVFDNKVLTIAAKIKGQAYFKIKEIMYKIIEMSAIKTGVFNTLISYCCQSWIVSASNVSQGSLSSAKNYSELILEACIFGTVFRRDQRLVQDVQTFIENLGHDCAANIVMENTKREDHYVRICAVKFLCLLDGSNMSHKLFIEDLAIKLLDKDELVSKSKKRYYVNSLQHRVKNRVWQTLLVLFPRLDQNFLNGIIDRIFQAGFTNNQASIKYFIEWIIILILHKFPQFLPKFWDCFSYGEENLKTSICTFLAVLSHLDIITQNIPEKKLILKQALIVVLQWCFNHNFSVRLYALVALKKLWTVCKVLSVEEFDALTPVIESSLHQVESMHGAGNAKKNWQRIQEHFFFATFHPLKDYCLETIFYILPRLSGLIEDEWITIDKFTRFTDVPLAAGFQWYLSQTQLSKLKPGDWSQQDIGTNLVEADNQAEWTDVQKKIIPWNSRVSDLDLELLFQDRAARLGKSISRLIVVASLIDKPTNLGGLCRTCEVFGASVLVVGSLQCISDKQFQHLSVSAEQWLPLVEVKPPQLIDYLQQKKTEGYTIIGVEQTAKSLDLTQYCFPEKSLLLLGNEREGIPANLIQQLDVCVEIPQQGIIRSLNVHVSGALLIWEYTRQQLLSHGDTKP
"
     misc_feature    4324..4326
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q13395.1); phosphorylation site"
     misc_feature    4387..4818
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /note="SpoU rRNA Methylase family; Region: SpoU_methylase;
                     pfam00588"
                     /db_xref="CDD:201328"
     exon            1..931
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /inference="alignment:Splign:1.39.8"
     exon            932..1029
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /inference="alignment:Splign:1.39.8"
     exon            1030..1099
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /inference="alignment:Splign:1.39.8"
     variation       1035
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3754307"
     exon            1100..1248
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /inference="alignment:Splign:1.39.8"
     exon            1249..1301
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /inference="alignment:Splign:1.39.8"
     exon            1302..1399
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /inference="alignment:Splign:1.39.8"
     exon            1400..1535
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /inference="alignment:Splign:1.39.8"
     exon            1536..1632
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /inference="alignment:Splign:1.39.8"
     exon            1633..1722
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /inference="alignment:Splign:1.39.8"
     exon            1723..1861
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /inference="alignment:Splign:1.39.8"
     exon            1862..1961
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /inference="alignment:Splign:1.39.8"
     variation       1956
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2102596"
     exon            1962..2134
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /inference="alignment:Splign:1.39.8"
     exon            2135..2232
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /inference="alignment:Splign:1.39.8"
     exon            2233..2394
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /inference="alignment:Splign:1.39.8"
     variation       2358
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3754311"
     exon            2395..2609
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /inference="alignment:Splign:1.39.8"
     exon            2610..2871
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /inference="alignment:Splign:1.39.8"
     exon            2872..3060
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /inference="alignment:Splign:1.39.8"
     exon            3061..3251
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /inference="alignment:Splign:1.39.8"
     variation       3113
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3820602"
     exon            3252..3323
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /inference="alignment:Splign:1.39.8"
     exon            3324..3444
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /inference="alignment:Splign:1.39.8"
     exon            3445..3555
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /inference="alignment:Splign:1.39.8"
     variation       3516
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1056488"
     exon            3556..3705
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /inference="alignment:Splign:1.39.8"
     exon            3706..3792
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /inference="alignment:Splign:1.39.8"
     variation       3738
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1141264"
     exon            3793..3989
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /inference="alignment:Splign:1.39.8"
     exon            3990..4071
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /inference="alignment:Splign:1.39.8"
     exon            4072..4243
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /inference="alignment:Splign:1.39.8"
     variation       4075
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3738616"
     exon            4244..4435
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /inference="alignment:Splign:1.39.8"
     variation       4257
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2175593"
     variation       4275
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2175594"
     variation       4287
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1134756"
     variation       4308
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1802871"
     variation       4381
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2275654"
     exon            4436..4560
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /inference="alignment:Splign:1.39.8"
     exon            4561..4697
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /inference="alignment:Splign:1.39.8"
     exon            4698..5130
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /inference="alignment:Splign:1.39.8"
     variation       4807
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12673"
     STS             4851..5010
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /standard_name="SHGC-76546"
                     /db_xref="UniSTS:52595"
     variation       4909
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:6870"
     STS             4917..5025
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /standard_name="A006I23"
                     /db_xref="UniSTS:62608"
     STS             4917..5025
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /standard_name="G20847"
                     /db_xref="UniSTS:62607"
     STS             4924..5024
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /standard_name="A009X31"
                     /db_xref="UniSTS:15874"
     STS             4924..5024
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /standard_name="G32953"
                     /db_xref="UniSTS:117531"
     STS             4967..5105
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
                     /standard_name="SGC31782"
                     /db_xref="UniSTS:83310"
     polyA_signal    5041..5046
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
     polyA_site      5065
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
     polyA_signal    5076..5081
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
     polyA_site      5095
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
     polyA_signal    5102..5107
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
     polyA_site      5130
                     /gene="TARBP1"
                     /gene_synonym="TRM3; TRP-185; TRP185"
ORIGIN      
atggagtgggtgctcgcggaagcgctgctctcgcagagccgggacccccgggccctgcttggggcgctgtgccaaggggaggcatccgcggagcgcgtggagacgctgcgcttccttctgcagcggctcgaggacgaggaggcgcgcggcagcgggggcgcaggcgcgctcccggaggcggcgcgcgaggtggctgcagggtacctcgtgccactgctgcggagcctgcgcggacgccccgcgggcggcccggaccccagtctgcagcctcgccaccgccggcgcgtgctgagggcggcgggcgcggccctgcgctcgtgcgtccgcctggccgggcgtccgcagctggcggccgcgctggctgaggaggcgctgcgcgatctgctcgccgggtggcgcgcgcctggcgccgaggctgccgtggaagtgctagcagccgtcgggccatgtttgcggccccgcgaggacgggccgctactggagcgcgtggcggggaccgccgtcgccctggcgctgggcgggggcggggacggggatgaggccgggcctgccgaggacgcggcggcgctggtggccgggcgactgctgccagtgctggtccaatgtggcggggcggcgctgcgggccgtgtggggcgggctggccgcgcctggggcgtccctggggtccggccgcgtagaggagaagctgctggtcctgagcgccctggccgagaagctgttgcccgagcccggcggcgaccgcgcccgcggcgcgcgcgaggcgggcccggacgcccggcgctgctggcgcttctggaggacggtgcaggcggggctgggccaggcggacgccctgacgcgcaagcgagcgcgctacctgctgcagagggcggtggaggtgtcggcggagctgggggccgactgcacctgcgggccccaggaaggaaacggcccaagtctgttttggtggtctgagaggaaaaaagatgagcttctaaagttttgggaaaattatattttaattatggagactttagaaggaaatcagatacatgttataaagccagttttaccaaagctaaacaatctgtttgaatatgcggtgtcagaggaaaatggatgttggctctttcacccatcctggcatatgtgtatttataaaagaatgtttgaaagtgaaaacaaaatcctgtccaaagaaggtgttatccattttttggagctgtatgaaacaaagattcttccattttcaccagaattttctgagtttattattggaccattaatggatgcgctttcagagagctctctgtatagcaggtccccaggccagccaataggaagctgttctccattgggactgaaattacagaagtttttagtcacttatatttctcttcttccagaagaaataaagagtagcttcctattgaagtttattcggaagatgacaagtaggcattggtgtgctgttcccattttgtttctatctaaggctttggcaaatgtcccaagacataaggccctgggtatagatgggcttcttgctctcagggatgttattcattgcactatgatcacacatcagattctcctgagaggggcagcccaatgctaccttcttcaaacagctatgaatttgctagatgtggagaaagtgtcactttctgatgtctcaacttttctcatgtctctgagacaagaggaatccttaggacgaggaacttcattgtggacagagctgtgtgactggctacgtgttaatgaaagctattttaagccatcccctacgtgtagctccattggacttcacaagacatctttaaatgcttatgtaaagagcattgttcaagagtatgttaagtcatctgcttgggaaacaggagaaaactgctttatgcctgattggtttgaagccaagcttgtttctctgatggtcttgctggctgtggatgtggaaggaatgaagactcagtatagcggaaagcagagaacagagaatgtattgcggatattcttagaccctcttctggatgtgcttatgaagtttagtaccaatgcctacatgcccttgctgaagactgacagatgcctccagctgctgttgaagctgttgaacacatgcaggttgaaaggttccagtgcccaagatgatgaggtgtctactgttcttcagaactttttcatgtctactacagagagcatttctgaatttattctcagaagacttactatgaatgagctaaatagtgtttcagatctggatcgttgccatttatacctgatggtgttaactgagcttataaatctgcatttgaaggttgggtggaaaaggggtaaccctatctggagagttatttctcttttgaaaaatgcatccattcagcatcttcaagagatggacagtggacaggagccaacagttggaagtcagattcagagagtagtgagcatggctgccttggccatggtgtgtgaggccatagaccagaagcctgagctgcagctggactctctccatgctgggcccctggaaagcttcctttcctctcttcagctcaatcagacgctgcagaagccccacgcagaggagcagagcagttatgctcaccccttggagtgcagcagtgttttggaagaatcgtcatcttcccaaggatggggaaaaatagttgcacaatatattcatgatcaatgggtgtgcctctctttcctgttgaaaaaatatcacacccttataccaaccacagggagtgaaattctggaaccgtttctacctgccgttcagatgccaataaggactttgcagtctgcactagaagccctcacagttctttcttctgatcaagttttaccagtgttccattgcttgaaagtgttggttcccaagcttctgacttcctctgaatcactctgcatagagtcttttgacatggcgtggaaaattatatcttctttaagcaacactcagctgatattctgggctaatttaaaagcttttgttcagtttgtttttgataacaaagttcttaccattgctgccaaaatcaagggccaggcatatttcaaaataaaagagattatgtacaagataattgaaatgtctgctataaagactggagtcttcaatacactgataagttactgctgtcagtcttggatagtgtctgcttcaaatgtgtcccaaggatctttatcaagtgctaaaaattatagcgaacttatccttgaggcttgtatatttggaactgtgtttaggcgtgatcaaagacttgttcaggatgtacagaccttcatagaaaaccttggacatgactgtgcggcaaatattgttatggaaaatactaagagagaagaccattatgtgagaatttgtgctgtcaaattcctgtgtttattagatggctccaatatgtcccacaagttgtttattgaggatcttgcaatcaagctattagataaagatgaattagtgtccaagtccaaaaaacgctactatgtgaattctctacagcacagagtgaaaaaccgagtgtggcagactctgctggtacttttccctagacttgaccagaatttcttgaatggaattattgacaggattttccaggctggtttcaccaacaatcaagcatccataaaatattttatagaatggattattatattgattcttcataaattccctcaatttcttccaaagttctgggattgtttttcttatggtgaagaaaatcttaaaacaagcatttgtacgtttttagcagttttatcacatttagacattattactcaaaatattccagaaaagaaactaattctgaagcaagcccttatagttgtgctgcagtggtgtttcaatcacaattttagtgttcgactgtatgctttagttgctcttaagaaactctggactgtgtgtaaagtgttaagtgttgaagaatttgatgccctgactcctgtgattgaatccagcctccatcaagtggaaagcatgcacggagcagggaatgccaagaagaattggcaacgcattcaggagcatttcttttttgcaacatttcacccactcaaggattattgtctagagaccatattttacatccttccacgcctttcaggccttattgaagatgaatggatcaccattgataaatttaccagattcactgatgttcctttagctgcgggatttcagtggtacctttctcaaactcaacttagtaaactaaaaccaggtgactggtctcagcaagacataggtactaatttggtcgaagcagataaccaagcggagtggaccgacgttcagaagaagattatcccgtggaacagtcgtgtttccgacttagacctggagctcctgtttcaggatcgtgctgccagacttggaaagtcaattagtagactcatcgttgtggcctcgctcatcgacaaaccgaccaatttaggaggactgtgcaggacctgtgaggtatttggggcttcagtgctcgttgttggcagccttcagtgtatcagcgacaaacagtttcagcacctcagtgtctctgcagaacagtggcttcctctagtggaggtaaaaccacctcagctaattgattatctgcagcagaagaaaacagaaggttataccatcattggagtggaacaaactgccaaaagtttagacctaacccaatattgctttcctgagaaatctctgctcttgttgggaaatgaacgtgagggaattccagcaaatctgatccaacagttggacgtttgtgtggaaattcctcaacagggcattatccgctccctgaatgtccatgtgagtggagccctgctgatctgggagtacaccaggcagcagctgctctcgcacggagataccaagccatgatgtgccttccttagtgaactgctgctgctgttcagacttttttaaaaaaaactatttggactaaagaaacagattctgaaatttattgtgataatttgtatttcttttttcttgcaatttaatgccaaaagtttgccatgtgccttaaacatattactatatattttcccctttaataaacactttttgttaaattgtattcttcctttaataaaatattttaagcaattgtggaaataaaacaatggattttttaagagagaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:6894 -> Molecular function: GO:0003723 [RNA binding] evidence: IEA
            GeneID:6894 -> Molecular function: GO:0008173 [RNA methyltransferase activity] evidence: IEA
            GeneID:6894 -> Biological process: GO:0006357 [regulation of transcription from RNA polymerase II promoter] evidence: TAS
            GeneID:6894 -> Biological process: GO:0006396 [RNA processing] evidence: IEA
            GeneID:6894 -> Cellular component: GO:0005634 [nucleus] evidence: TAS

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.