2024-03-29 17:53:05, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_005607 4550 bp mRNA linear PRI 15-JUL-2013 DEFINITION Homo sapiens protein tyrosine kinase 2 (PTK2), transcript variant 2, mRNA. ACCESSION NM_005607 VERSION NM_005607.4 GI:313851042 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 4550) AUTHORS Crompton,B.D., Carlton,A.L., Thorner,A.R., Christie,A.L., Du,J., Calicchio,M.L., Rivera,M.N., Fleming,M.D., Kohl,N.E., Kung,A.L. and Stegmaier,K. TITLE High-throughput tyrosine kinase activity profiling identifies FAK as a candidate therapeutic target in Ewing sarcoma JOURNAL Cancer Res. 73 (9), 2873-2883 (2013) PUBMED 23536552 REMARK GeneRIF: small-molecule inhibition of FAK attenuates Ewing sarcoma tumor growth in vivo REFERENCE 2 (bases 1 to 4550) AUTHORS Ritt,M., Guan,J.L. and Sivaramakrishnan,S. TITLE Visualizing and manipulating focal adhesion kinase regulation in live cells JOURNAL J. Biol. Chem. 288 (13), 8875-8886 (2013) PUBMED 23393139 REMARK GeneRIF: Tyr-397 phosphorylation, rather than kinase activity of FAK, is the key determinant of cell migration REFERENCE 3 (bases 1 to 4550) AUTHORS Chen,D., Zhang,B., Kang,J., Ma,X., Lu,Y. and Gong,L. TITLE Expression and clinical significance of FAK, ILK, and PTEN in salivary adenoid cystic carcinoma JOURNAL Acta Otolaryngol. 133 (2), 203-208 (2013) PUBMED 23186335 REMARK GeneRIF: FAK expression was positively correlated with ILK expression but negatively correlated with PTEN expression in SACC tissues. FAK and ILK expression was positively associated with advanced stage REFERENCE 4 (bases 1 to 4550) AUTHORS Serna-Marquez,N., Villegas-Comonfort,S., Galindo-Hernandez,O., Navarro-Tito,N., Millan,A. and Salazar,E.P. TITLE Role of LOXs and COX-2 on FAK activation and cell migration induced by linoleic acid in MDA-MB-231 breast cancer cells JOURNAL Cell Oncol (Dordr) 36 (1), 65-77 (2013) PUBMED 23179791 REMARK GeneRIF: Data indicate that focal adhesion kinase (FAK) activation and cell migration require Src, Gi/Go, COX-2 and LOXs activities. REFERENCE 5 (bases 1 to 4550) AUTHORS Ross,S.H., Spanjaard,E., Post,A., Vliem,M.J., Kristyanto,H., Bos,J.L. and de Rooij,J. TITLE Rap1 can bypass the FAK-Src-Paxillin cascade to induce cell spreading and focal adhesion formation JOURNAL PLoS ONE 7 (11), E50072 (2012) PUBMED 23209645 REMARK GeneRIF: Rap1 can induce cell adhesion and stimulate an accelerated rate of cell spreading through mechanisms that bypass the canonical FAK-Src-Paxillin signalling cascade REFERENCE 6 (bases 1 to 4550) AUTHORS Polte,T.R. and Hanks,S.K. TITLE Interaction between focal adhesion kinase and Crk-associated tyrosine kinase substrate p130Cas JOURNAL Proc. Natl. Acad. Sci. U.S.A. 92 (23), 10678-10682 (1995) PUBMED 7479864 REFERENCE 7 (bases 1 to 4550) AUTHORS Guinebault,C., Payrastre,B., Racaud-Sultan,C., Mazarguil,H., Breton,M., Mauco,G., Plantavid,M. and Chap,H. TITLE Integrin-dependent translocation of phosphoinositide 3-kinase to the cytoskeleton of thrombin-activated platelets involves specific interactions of p85 alpha with actin filaments and focal adhesion kinase JOURNAL J. Cell Biol. 129 (3), 831-842 (1995) PUBMED 7537275 REFERENCE 8 (bases 1 to 4550) AUTHORS Calalb,M.B., Polte,T.R. and Hanks,S.K. TITLE Tyrosine phosphorylation of focal adhesion kinase at sites in the catalytic domain regulates kinase activity: a role for Src family kinases JOURNAL Mol. Cell. Biol. 15 (2), 954-963 (1995) PUBMED 7529876 REFERENCE 9 (bases 1 to 4550) AUTHORS Bergman,M., Joukov,V., Virtanen,I. and Alitalo,K. TITLE Overexpressed Csk tyrosine kinase is localized in focal adhesions, causes reorganization of alpha v beta 5 integrin, and interferes with HeLa cell spreading JOURNAL Mol. Cell. Biol. 15 (2), 711-722 (1995) PUBMED 7529872 REFERENCE 10 (bases 1 to 4550) AUTHORS Schaller,M.D., Hildebrand,J.D., Shannon,J.D., Fox,J.W., Vines,R.R. and Parsons,J.T. TITLE Autophosphorylation of the focal adhesion kinase, pp125FAK, directs SH2-dependent binding of pp60src JOURNAL Mol. Cell. Biol. 14 (3), 1680-1688 (1994) PUBMED 7509446 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DB478006.1, DA236314.1, AL832961.1, AC100860.2, AB209083.1 and BF434494.1. On Dec 10, 2010 this sequence version replaced gi:27886592. Summary: This gene encodes a cytoplasmic protein tyrosine kinase which is found concentrated in the focal adhesions that form between cells growing in the presence of extracellular matrix constituents. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Activation of this gene may be an important early step in cell growth and intracellular signal transduction pathways triggered in response to certain neural peptides or to cell interactions with the extracellular matrix. Several transcript variants encoding different isoforms have been found for this gene, but the full-length natures of only three of them have been determined. [provided by RefSeq, Dec 2010]. Transcript Variant: This variant (2) encodes the longest isoform (b). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AL832961.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support ERS025081, ERS025082 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-28 DB478006.1 1-28 29-117 DA236314.1 1-89 118-203 AL832961.1 1-86 204-204 AC100860.2 82135-82135 205-4162 AL832961.1 88-4045 4163-4519 AB209083.1 3893-4249 4520-4550 BF434494.1 1-31 c FEATURES Location/Qualifiers source 1..4550 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="8" /map="8q24.3" gene 1..4550 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /note="protein tyrosine kinase 2" /db_xref="GeneID:5747" /db_xref="HGNC:9611" /db_xref="HPRD:02859" /db_xref="MIM:600758" exon 1..189 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" misc_feature 102..104 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /note="upstream in-frame stop codon" exon 190..267 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" CDS 234..3458 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /EC_number="2.7.10.2" /note="isoform b is encoded by transcript variant 2; focal adhesion kinase 1; FAK-related non-kinase polypeptide; FADK 1; protein phosphatase 1, regulatory subunit 71; focal adhesion kinase-related nonkinase; protein phosphatase 1 regulatory subunit 71; PTK2 protein tyrosine kinase 2" /codon_start=1 /product="focal adhesion kinase 1 isoform b" /protein_id="NP_005598.3" /db_xref="GI:27886593" /db_xref="GeneID:5747" /db_xref="HGNC:9611" /db_xref="HPRD:02859" /db_xref="MIM:600758" /translation="
MISADCNLCLPEYDRYLASSKIMAAAYLDPNLNHTPNSSTKTHLGTGMERSPGAMERVLKVFHYFESNSEPTTWASIIRHGDATDVRGIIQKIVDSHKVKHVACYGFRLSHLRSEEVHWLHVDMGVSSVREKYELAHPPEEWKYELRIRYLPKGFLNQFTEDKPTLNFFYQQVKSDYMLEIADQVDQEIALKLGCLEIRRSYWEMRGNALEKKSNYEVLEKDVGLKRFFPKSLLDSVKAKTLRKLIQQTFRQFANLNREESILKFFEILSPVYRFDKECFKCALGSSWIISVELAIGPEEGISYLTDKGCNPTHLADFTQVQTIQYSNSEDKDRKGMLQLKIAGAPEPLTVTAPSLTIAENMADLIDGYCRLVNGTSQSFIIRPQKEGERALPSIPKLANSEKQGMRTHAVSVSETDDYAEIIDEEDTYTMPSTRDYEIQRERIELGRCIGEGQFGDVHQGIYMSPENPALAVAIKTCKNCTSDSVREKFLQEALTMRQFDHPHIVKLIGVITENPVWIIMELCTLGELRSFLQVRKYSLDLASLILYAYQLSTALAYLESKRFVHRDIAARNVLVSSNDCVKLGDFGLSRYMEDSTYYKASKGKLPIKWMAPESINFRRFTSASDVWMFGVCMWEILMHGVKPFQGVKNNDVIGRIENGERLPMPPNCPPTLYSLMTKCWAYDPSRRPRFTELKAQLSTILEEEKAQQEERMRMESRRQATVSWDSGGSDEAPPKPSRPGYPSPRSSEGFYPSPQHMVQTNHYQVSGYPGSHGITAMAGSIYPGQASLLDQTDSWNHRPQEIAMWQPNVEDSTVLDLRGIGQVLPTHLMEERLIRQQQEMEEDQRWLEKEERFLKPDVRLSRGSIDREDGSLQGPIGNQHIYQPVGKPDPAAPPKKPPRPGAPGHLGSLASLSSPADSYNEGVKLQPQEISPPPTANLDRSNDKVYENVTGLVKAVIEMSSKIQPAPPEEYVPMVKEVGLALRTLLATVDETIPLLPASTHREIEMAQKLLNSDLGELINKMKLAQQYVMTSLQQEYKKQMLTAAHALAVDAKNLLDVIDQARLKMLGQTRPH
" misc_feature 384..386 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 405..1073 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /note="Band 4.1 homologues; Region: B41; smart00295" /db_xref="CDD:197635" misc_feature 690..692 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /experiment="experimental evidence, no additional details recorded" /note="sumoylation site; modified site" misc_feature 726..1043 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /note="FERM central domain; Region: FERM_M; pfam00373" /db_xref="CDD:201187" misc_feature 1467..1469 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:02859" misc_feature 1488..1490 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /experiment="experimental evidence, no additional details recorded" /note="dephosphorylation site; modified site" /db_xref="HPRD:02513" misc_feature 1488..1490 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /experiment="experimental evidence, no additional details recorded" /note="dephosphorylation site; modified site" misc_feature 1488..1490 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /citation=[8] /citation=[10] /db_xref="HPRD:02859" misc_feature 1518..1520 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /citation=[8] /db_xref="HPRD:01819" misc_feature 1518..1520 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:03131" misc_feature 1542..2351 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /note="Catalytic domain of the Protein Tyrosine Kinase, Focal Adhesion Kinase; Region: PTKc_FAK; cd05056" /db_xref="CDD:133187" misc_feature 1563..2327 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /note="Protein tyrosine kinase; Region: Pkinase_Tyr; pfam07714" /db_xref="CDD:203736" misc_feature order(1581..1583,1587..1595,1605..1607,1653..1655, 1659..1661,1710..1712,1797..1799,1803..1805,1815..1817, 1935..1937,1947..1952,1956..1958,1989..1991,2040..2054, 2079..2081,2181..2183) /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /note="active site" /db_xref="CDD:133187" misc_feature order(1581..1583,1587..1595,1605..1607,1653..1655, 1659..1661,1710..1712,1797..1799,1803..1805,1815..1817) /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:133187" misc_feature order(1935..1937,1947..1949,2040..2054,2079..2081, 2181..2183) /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /note="substrate binding site [chemical binding]; other site" /db_xref="CDD:133187" misc_feature 1986..2060 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /note="activation loop (A-loop); other site" /db_xref="CDD:133187" misc_feature 2025..2027 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /citation=[8] /db_xref="HPRD:01819" misc_feature 2025..2027 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /citation=[8] /db_xref="HPRD:00975" misc_feature 2025..2027 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:01266" misc_feature 2028..2030 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /citation=[8] /db_xref="HPRD:01819" misc_feature 2028..2030 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /citation=[8] /db_xref="HPRD:00975" misc_feature 2028..2030 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:01266" misc_feature 2409..2411 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /experiment="experimental evidence, no additional details recorded" /note="proteolytic cleavage site; modified site" /db_xref="HPRD:00476" misc_feature 2463..2465 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 2817..2819 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 2826..2828 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 2847..2849 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:02859" misc_feature 2880..2882 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /citation=[8] /db_xref="HPRD:01819" misc_feature 3027..3029 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 3039..3455 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /note="Focal adhesion targeting region; Region: Focal_AT; pfam03623" /db_xref="CDD:146323" misc_feature 3039..3041 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 3072..3074 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:01819" misc_feature 3072..3074 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:02859" misc_feature 3345..3347 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" exon 268..494 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" exon 495..661 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" exon 662..749 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" exon 750..829 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" exon 830..892 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" exon 893..947 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" exon 948..1088 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" exon 1089..1166 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" exon 1167..1274 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" exon 1275..1392 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" exon 1393..1423 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" exon 1424..1476 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" STS 1434..1730 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /standard_name="Ptk2" /db_xref="UniSTS:516686" exon 1477..1533 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" exon 1534..1631 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" exon 1632..1716 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" exon 1717..1817 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" exon 1818..1933 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" exon 1934..2034 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" exon 2035..2124 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" exon 2125..2329 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" exon 2330..2441 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" exon 2442..2528 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" exon 2529..2666 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" variation 2631 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /replace="c" /replace="t" /db_xref="dbSNP:1126498" exon 2667..2798 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" exon 2799..2861 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" exon 2862..2901 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" exon 2902..3008 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" exon 3009..3164 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" exon 3165..3245 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" exon 3246..4542 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /inference="alignment:Splign:1.39.8" STS 3470..3819 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /standard_name="SHGC-12766" /db_xref="UniSTS:44306" STS 3503..3639 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /standard_name="WI-18850" /db_xref="UniSTS:37328" STS 3532..3808 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /standard_name="RH69012" /db_xref="UniSTS:3029" STS 3791..3956 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /standard_name="STS-T29673" /db_xref="UniSTS:29448" variation 4163 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /replace="a" /replace="t" /db_xref="dbSNP:7460" STS 4309..4500 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /standard_name="A006E44" /db_xref="UniSTS:62565" STS 4309..4500 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /standard_name="G20751" /db_xref="UniSTS:62564" STS 4384..4517 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" /standard_name="WI-11480" /db_xref="UniSTS:74034" polyA_signal 4500..4505 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" polyA_site 4522 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" polyA_site 4542 /gene="PTK2" /gene_synonym="FADK; FAK; FAK1; FRNK; p125FAK; pp125FAK; PPP1R71" ORIGIN
gcgcacgcgcgcgggcccgcgccgacgcagcacggcctcgagggcgcgagcccgcgccgccgccgccgccgccggtcccggaccactgtgagcccgcggcgtgaggcgtgggaggaagcgcggctgctgtcgcccagcgccgccccgtcgtcgtctgccttcgcttcacggcgccgagccgcggtccgaagtcttgctgtgtcacccaggctgccaggctggagtggagtggcatgatctcggctgactgcaacctctgcctcccagaatatgacagatacctagcatctagcaaaataatggcagctgcttaccttgaccccaacttgaatcacacaccaaattcgagtactaagactcacctgggtactggtatggaacgttctcctggtgcaatggagcgagtattaaaggtctttcattattttgaaagcaatagtgagccaaccacctgggccagtattatcaggcatggagatgctactgatgtcaggggcatcattcagaagatagtggacagtcacaaagtaaagcatgtggcctgctatggattccgcctcagtcacctgcggtcagaggaggttcactggcttcacgtggatatgggcgtctccagtgtgagggagaagtatgagcttgctcacccaccagaggagtggaaatatgaattgagaattcgttatttgccaaaaggatttctaaaccagtttactgaagataagccaactttgaatttcttctatcaacaggtgaagagcgattatatgttagagatagctgatcaagtggaccaggaaattgctttgaagttgggttgtctagaaatacggcgatcatactgggagatgcggggcaatgcactagaaaagaagtctaactatgaagtattagaaaaagatgttggtttaaagcgattttttcctaagagtttactggattctgtcaaggccaaaacactaagaaaactgatccaacaaacatttagacaatttgccaaccttaatagagaagaaagtattctgaaattctttgagatcctgtctccagtctacagatttgataaggaatgcttcaagtgtgctcttggttcaagctggattatttcagtggaactggcaatcggcccagaagaaggaatcagttacctaacggacaagggctgcaatcccacacatcttgctgacttcactcaagtgcaaaccattcagtattcaaacagtgaagacaaggacagaaaaggaatgctacaactaaaaatagcaggtgcacccgagcctctgacagtgacggcaccatccctaaccattgcggagaatatggctgacctaatagatgggtactgccggctggtgaatggaacctcgcagtcatttatcatcagacctcagaaagaaggtgaacgggctttgccatcaataccaaagttggccaacagcgaaaagcaaggcatgcggacacacgccgtctctgtgtcagaaacagatgattatgctgagattatagatgaagaagatacttacaccatgccctcaaccagggattatgagattcaaagagaaagaatagaacttggacgatgtattggagaaggccaatttggagatgtacatcaaggcatttatatgagtccagagaatccagctttggcggttgcaattaaaacatgtaaaaactgtacttcggacagcgtgagagagaaatttcttcaagaagccttaacaatgcgtcagtttgaccatcctcatattgtgaagctgattggagtcatcacagagaatcctgtctggataatcatggagctgtgcacacttggagagctgaggtcatttttgcaagtaaggaaatacagtttggatctagcatctttgatcctgtatgcctatcagcttagtacagctcttgcatatctagagagcaaaagatttgtacacagggacattgctgctcggaatgttctggtgtcctcaaatgattgtgtaaaattaggagactttggattatcccgatatatggaagatagtacttactacaaagcttccaaaggaaaattgcctattaaatggatggctccagagtcaatcaattttcgacgttttacctcagctagtgacgtatggatgtttggtgtgtgtatgtgggagatactgatgcatggtgtgaagccttttcaaggagtgaagaacaatgatgtaatcggtcgaattgaaaatggggaaagattaccaatgcctccaaattgtcctcctaccctctacagccttatgacgaaatgctgggcctatgaccccagcaggcggcccaggtttactgaacttaaagctcagctcagcacaatcctggaggaagagaaggctcagcaagaagagcgcatgaggatggagtccagaagacaggccacagtgtcctgggactccggagggtctgatgaagcaccgcccaagcccagcagaccgggttatcccagtccgaggtccagcgaaggattttatcccagcccacagcacatggtacaaaccaatcattaccaggtttctggctaccctggttcacatggaatcacagccatggctggcagcatctatccaggtcaggcatctcttttggaccaaacagattcatggaatcatagacctcaggagatagcaatgtggcagcccaatgtggaggactctacagtattggacctgcgagggattgggcaagtgttgccaacccatctgatggaagagcgtctaatccgacagcaacaggaaatggaagaagatcagcgctggctggaaaaagaggaaagatttctgaaacctgatgtgagactctctcgaggcagtattgacagggaggatggaagtcttcagggtccgattggaaaccaacatatatatcagcctgtgggtaaaccagatcctgcagctccaccaaagaaaccgcctcgccctggagctcccggtcatctgggaagccttgccagcctcagcagccctgctgacagctacaacgagggtgtcaagcttcagccccaggaaatcagcccccctcctactgccaacctggaccggtcgaatgataaggtgtacgagaatgtgacgggcctggtgaaagctgtcatcgagatgtccagtaaaatccagccagccccaccagaggagtatgtccctatggtgaaggaagtcggcttggccctgaggacattattggccactgtggatgagaccattcccctcctaccagccagcacccaccgagagattgagatggcacagaagctattgaactctgacctgggtgagctcatcaacaagatgaaactggcccagcagtatgtcatgaccagcctccagcaagagtacaaaaagcaaatgctgactgctgctcacgccctggctgtggatgccaaaaacttactcgatgtcattgaccaagcaagactgaaaatgcttgggcagacgagaccacactgagcctcccctaggagcacgtcttgctaccctcttttgaagatgttctctagccttccaccagcagcgaggaattaaccctgtgtcctcagtcgccagcacttacagctccaacttttttgaatgaccatctggttgaaaaatctttctcatataagtttaaccacactttgatttgggttcattttttgttttgtttttttcaatcatgatattcagaaaaatccaggatccaaaatgtggcgtttttctaagaatgaaaattatatgtaagcttttaagcatcatgaagaacaatttatgttcacattaagatacgttctaaagggggatggccaaggggtgacatcttaattcctaaactaccttagctgcatagtggaagaggagagcatgaagcaaagaattccaggaaacccaagaggctgagaattcttttgtctaccatagaattattatccagactggaatttttgtttgttagaacacccttcagttgcaatatgctaatcccactttacaaagaatataaaagctatattttgaagacttgagttatttcagaaaaaactacagccctttttgtcttacctgccttttactttcgtgtggatatgtgaagcattgggtcgggaactagctgtagaacacaactaaaaactcatgtcttttttcacagaataatgtgccagttttttgtagcaatgttatttctcttggaagcagaaatgctttgtaccagagcacctccaaactgcattgaggagaagttccagaaccatcccctttttccatttttatataatttataaagaaagattaaagccatgttgactattttacagccactggagttaactaacccttccttgtatctgtcttcccaggagagaatgaagcaaaacaggaatttggttttcttttgatgtccagttacaccatccattctgttaattttgaaaaaatataccctccctttagtttgttgggggatataaattattctcaggaagaatataatgaactgtacagttactttgacctattaaaaaggtgttaccagtaaagttcttgttgtaatatccttaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:5747 -> Molecular function: GO:0003779 [actin binding] evidence: IDA GeneID:5747 -> Molecular function: GO:0004672 [protein kinase activity] evidence: TAS GeneID:5747 -> Molecular function: GO:0004715 [non-membrane spanning protein tyrosine kinase activity] evidence: IDA GeneID:5747 -> Molecular function: GO:0004871 [signal transducer activity] evidence: IEA GeneID:5747 -> Molecular function: GO:0005178 [integrin binding] evidence: IEA GeneID:5747 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:5747 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA GeneID:5747 -> Molecular function: GO:0008432 [JUN kinase binding] evidence: IDA GeneID:5747 -> Molecular function: GO:0019901 [protein kinase binding] evidence: IPI GeneID:5747 -> Molecular function: GO:0042169 [SH2 domain binding] evidence: IPI GeneID:5747 -> Molecular function: GO:0043548 [phosphatidylinositol 3-kinase binding] evidence: IEA GeneID:5747 -> Biological process: GO:0000226 [microtubule cytoskeleton organization] evidence: IEA GeneID:5747 -> Biological process: GO:0001525 [angiogenesis] evidence: TAS GeneID:5747 -> Biological process: GO:0001570 [vasculogenesis] evidence: IEA GeneID:5747 -> Biological process: GO:0001764 [neuron migration] evidence: IEA GeneID:5747 -> Biological process: GO:0001890 [placenta development] evidence: TAS GeneID:5747 -> Biological process: GO:0001934 [positive regulation of protein phosphorylation] evidence: IMP GeneID:5747 -> Biological process: GO:0003007 [heart morphogenesis] evidence: TAS GeneID:5747 -> Biological process: GO:0006915 [apoptotic process] evidence: TAS GeneID:5747 -> Biological process: GO:0006921 [cellular component disassembly involved in execution phase of apoptosis] evidence: TAS GeneID:5747 -> Biological process: GO:0007172 [signal complex assembly] evidence: IEA GeneID:5747 -> Biological process: GO:0007229 [integrin-mediated signaling pathway] evidence: IMP GeneID:5747 -> Biological process: GO:0007229 [integrin-mediated signaling pathway] evidence: TAS GeneID:5747 -> Biological process: GO:0007254 [JNK cascade] evidence: IEA GeneID:5747 -> Biological process: GO:0007411 [axon guidance] evidence: TAS GeneID:5747 -> Biological process: GO:0007596 [blood coagulation] evidence: TAS GeneID:5747 -> Biological process: GO:0008284 [positive regulation of cell proliferation] evidence: ISS GeneID:5747 -> Biological process: GO:0008360 [regulation of cell shape] evidence: IMP GeneID:5747 -> Biological process: GO:0009612 [response to mechanical stimulus] evidence: IEA GeneID:5747 -> Biological process: GO:0009749 [response to glucose stimulus] evidence: IEA GeneID:5747 -> Biological process: GO:0009790 [embryo development] evidence: TAS GeneID:5747 -> Biological process: GO:0010594 [regulation of endothelial cell migration] evidence: TAS GeneID:5747 -> Biological process: GO:0014068 [positive regulation of phosphatidylinositol 3-kinase cascade] evidence: IMP GeneID:5747 -> Biological process: GO:0014911 [positive regulation of smooth muscle cell migration] evidence: IEA GeneID:5747 -> Biological process: GO:0018108 [peptidyl-tyrosine phosphorylation] evidence: IDA GeneID:5747 -> Biological process: GO:0021955 [central nervous system neuron axonogenesis] evidence: IEA GeneID:5747 -> Biological process: GO:0022408 [negative regulation of cell-cell adhesion] evidence: IDA GeneID:5747 -> Biological process: GO:0030010 [establishment of cell polarity] evidence: TAS GeneID:5747 -> Biological process: GO:0030168 [platelet activation] evidence: TAS GeneID:5747 -> Biological process: GO:0030198 [extracellular matrix organization] evidence: IEA GeneID:5747 -> Biological process: GO:0030307 [positive regulation of cell growth] evidence: IEA GeneID:5747 -> Biological process: GO:0030335 [positive regulation of cell migration] evidence: IDA GeneID:5747 -> Biological process: GO:0030336 [negative regulation of cell migration] evidence: IEA GeneID:5747 -> Biological process: GO:0030644 [cellular chloride ion homeostasis] evidence: IEA GeneID:5747 -> Biological process: GO:0032319 [regulation of Rho GTPase activity] evidence: TAS GeneID:5747 -> Biological process: GO:0032355 [response to estradiol stimulus] evidence: IEA GeneID:5747 -> Biological process: GO:0033628 [regulation of cell adhesion mediated by integrin] evidence: IDA GeneID:5747 -> Biological process: GO:0038007 [netrin-activated signaling pathway] evidence: TAS GeneID:5747 -> Biological process: GO:0038096 [Fc-gamma receptor signaling pathway involved in phagocytosis] evidence: TAS GeneID:5747 -> Biological process: GO:0040023 [establishment of nucleus localization] evidence: IEA GeneID:5747 -> Biological process: GO:0042127 [regulation of cell proliferation] evidence: IMP GeneID:5747 -> Biological process: GO:0042493 [response to drug] evidence: IEA GeneID:5747 -> Biological process: GO:0043066 [negative regulation of apoptotic process] evidence: IMP GeneID:5747 -> Biological process: GO:0043542 [endothelial cell migration] evidence: IEA GeneID:5747 -> Biological process: GO:0043552 [positive regulation of phosphatidylinositol 3-kinase activity] evidence: TAS GeneID:5747 -> Biological process: GO:0045087 [innate immune response] evidence: TAS GeneID:5747 -> Biological process: GO:0045444 [fat cell differentiation] evidence: IEA GeneID:5747 -> Biological process: GO:0045667 [regulation of osteoblast differentiation] evidence: IMP GeneID:5747 -> Biological process: GO:0045785 [positive regulation of cell adhesion] evidence: IEA GeneID:5747 -> Biological process: GO:0045860 [positive regulation of protein kinase activity] evidence: IMP GeneID:5747 -> Biological process: GO:0045909 [positive regulation of vasodilation] evidence: IEA GeneID:5747 -> Biological process: GO:0046621 [negative regulation of organ growth] evidence: IEA GeneID:5747 -> Biological process: GO:0046685 [response to arsenic-containing substance] evidence: IEA GeneID:5747 -> Biological process: GO:0046777 [protein autophosphorylation] evidence: IDA GeneID:5747 -> Biological process: GO:0048013 [ephrin receptor signaling pathway] evidence: IDA GeneID:5747 -> Biological process: GO:0048661 [positive regulation of smooth muscle cell proliferation] evidence: IEA GeneID:5747 -> Biological process: GO:0048870 [cell motility] evidence: TAS GeneID:5747 -> Biological process: GO:0050766 [positive regulation of phagocytosis] evidence: IEA GeneID:5747 -> Biological process: GO:0050771 [negative regulation of axonogenesis] evidence: IEA GeneID:5747 -> Biological process: GO:0050806 [positive regulation of synaptic transmission] evidence: IEA GeneID:5747 -> Biological process: GO:0051493 [regulation of cytoskeleton organization] evidence: TAS GeneID:5747 -> Biological process: GO:0051893 [regulation of focal adhesion assembly] evidence: TAS GeneID:5747 -> Biological process: GO:0051897 [positive regulation of protein kinase B signaling cascade] evidence: IMP GeneID:5747 -> Biological process: GO:0051964 [negative regulation of synapse assembly] evidence: IEA GeneID:5747 -> Biological process: GO:0060252 [positive regulation of glial cell proliferation] evidence: IEA GeneID:5747 -> Biological process: GO:0060396 [growth hormone receptor signaling pathway] evidence: IDA GeneID:5747 -> Biological process: GO:2000060 [positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process] evidence: ISS GeneID:5747 -> Biological process: GO:2000811 [negative regulation of anoikis] evidence: IMP GeneID:5747 -> Cellular component: GO:0005634 [nucleus] evidence: IDA GeneID:5747 -> Cellular component: GO:0005730 [nucleolus] evidence: IEA GeneID:5747 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA GeneID:5747 -> Cellular component: GO:0005815 [microtubule organizing center] evidence: IEA GeneID:5747 -> Cellular component: GO:0005829 [cytosol] evidence: IDA GeneID:5747 -> Cellular component: GO:0005829 [cytosol] evidence: TAS GeneID:5747 -> Cellular component: GO:0005856 [cytoskeleton] evidence: TAS GeneID:5747 -> Cellular component: GO:0005925 [focal adhesion] evidence: IDA GeneID:5747 -> Cellular component: GO:0005938 [cell cortex] evidence: IEA GeneID:5747 -> Cellular component: GO:0014704 [intercalated disc] evidence: IEA GeneID:5747 -> Cellular component: GO:0016323 [basolateral plasma membrane] evidence: IEA GeneID:5747 -> Cellular component: GO:0016324 [apical plasma membrane] evidence: IEA GeneID:5747 -> Cellular component: GO:0016604 [nuclear body] evidence: IEA GeneID:5747 -> Cellular component: GO:0030027 [lamellipodium] evidence: IEA GeneID:5747 -> Cellular component: GO:0042383 [sarcolemma] evidence: IEA ANNOTATIONS from NCBI Entrez Gene (20130726): NP_005598 -> EC 2.7.10.2
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.