2024-04-25 15:54:49, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_005360 2656 bp mRNA linear PRI 11-JUL-2013 DEFINITION Homo sapiens v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog (MAF), transcript variant 1, mRNA. ACCESSION NM_005360 VERSION NM_005360.4 GI:197313768 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 2656) AUTHORS Kottgen A, Albrecht E, Teumer A, Vitart V, Krumsiek J, Hundertmark C, Pistis G, Ruggiero D, O'Seaghdha CM, Haller T, Yang Q, Tanaka T, Johnson AD, Kutalik Z, Smith AV, Shi J, Struchalin M, Middelberg RP, Brown MJ, Gaffo AL, Pirastu N, Li G, Hayward C, Zemunik T, Huffman J, Yengo L, Zhao JH, Demirkan A, Feitosa MF, Liu X, Malerba G, Lopez LM, van der Harst P, Li X, Kleber ME, Hicks AA, Nolte IM, Johansson A, Murgia F, Wild SH, Bakker SJ, Peden JF, Dehghan A, Steri M, Tenesa A, Lagou V, Salo P, Mangino M, Rose LM, Lehtimaki T, Woodward OM, Okada Y, Tin A, Muller C, Oldmeadow C, Putku M, Czamara D, Kraft P, Frogheri L, Thun GA, Grotevendt A, Gislason GK, Harris TB, Launer LJ, McArdle P, Shuldiner AR, Boerwinkle E, Coresh J, Schmidt H, Schallert M, Martin NG, Montgomery GW, Kubo M, Nakamura Y, Tanaka T, Munroe PB, Samani NJ, Jacobs DR Jr, Liu K, D'Adamo P, Ulivi S, Rotter JI, Psaty BM, Vollenweider P, Waeber G, Campbell S, Devuyst O, Navarro P, Kolcic I, Hastie N, Balkau B, Froguel P, Esko T, Salumets A, Khaw KT, Langenberg C, Wareham NJ, Isaacs A, Kraja A, Zhang Q, Wild PS, Scott RJ, Holliday EG, Org E, Viigimaa M, Bandinelli S, Metter JE, Lupo A, Trabetti E, Sorice R, Doring A, Lattka E, Strauch K, Theis F, Waldenberger M, Wichmann HE, Davies G, Gow AJ, Bruinenberg M, Stolk RP, Kooner JS, Zhang W, Winkelmann BR, Boehm BO, Lucae S, Penninx BW, Smit JH, Curhan G, Mudgal P, Plenge RM, Portas L, Persico I, Kirin M, Wilson JF, Mateo Leach I, van Gilst WH, Goel A, Ongen H, Hofman A, Rivadeneira F, Uitterlinden AG, Imboden M, von Eckardstein A, Cucca F, Nagaraja R, Piras MG, Nauck M, Schurmann C, Budde K, Ernst F, Farrington SM, Theodoratou E, Prokopenko I, Stumvoll M, Jula A, Perola M, Salomaa V, Shin SY, Spector TD, Sala C, Ridker PM, Kahonen M, Viikari J, Hengstenberg C, Nelson CP, Meschia JF, Nalls MA, Sharma P, Singleton AB, Kamatani N, Zeller T, Burnier M, Attia J, Laan M, Klopp N, Hillege HL, Kloiber S, Choi H, Pirastu M, Tore S, Probst-Hensch NM, Volzke H, Gudnason V, Parsa A, Schmidt R, Whitfield JB, Fornage M, Gasparini P, Siscovick DS, Polasek O, Campbell H, Rudan I, Bouatia-Naji N, Metspalu A, Loos RJ, van Duijn CM, Borecki IB, Ferrucci L, Gambaro G, Deary IJ, Wolffenbuttel BH, Chambers JC, Marz W, Pramstaller PP, Snieder H, Gyllensten U, Wright AF, Navis G, Watkins H, Witteman JC, Sanna S, Schipf S, Dunlop MG, Tonjes A, Ripatti S, Soranzo N, Toniolo D, Chasman DI, Raitakari O, Kao WH, Ciullo M, Fox CS, Caulfield M, Bochud M and Gieger C. CONSRTM LifeLines Cohort Study; CARDIoGRAM Consortium; DIAGRAM Consortium; ICBP Consortium; MAGIC Consortium TITLE Genome-wide association analyses identify 18 new loci associated with serum urate concentrations JOURNAL Nat. Genet. 45 (2), 145-154 (2013) PUBMED 23263486 REFERENCE 2 (bases 1 to 2656) AUTHORS Bernhard,F., Landgraf,K., Kloting,N., Berthold,A., Buttner,P., Friebe,D., Kiess,W., Kovacs,P., Bluher,M. and Korner,A. TITLE Functional relevance of genes implicated by obesity genome-wide association study signals for human adipocyte biology JOURNAL Diabetologia 56 (2), 311-322 (2013) PUBMED 23229156 REMARK GeneRIF: Results imply a regulatory role for TMEM18, BDNF, MTCH2 and NEGR1 in adipocyte differentiation and biology. In addition, we show a variation of MAF expression during adipogenesis, while NPC1, PTER and SH2B1 were not regulated. REFERENCE 3 (bases 1 to 2656) AUTHORS Porcu,E., Medici,M., Pistis,G., Volpato,C.B., Wilson,S.G., Cappola,A.R., Bos,S.D., Deelen,J., den Heijer,M., Freathy,R.M., Lahti,J., Liu,C., Lopez,L.M., Nolte,I.M., O'Connell,J.R., Tanaka,T., Trompet,S., Arnold,A., Bandinelli,S., Beekman,M., Bohringer,S., Brown,S.J., Buckley,B.M., Camaschella,C., de Craen,A.J., Davies,G., de Visser,M.C., Ford,I., Forsen,T., Frayling,T.M., Fugazzola,L., Gogele,M., Hattersley,A.T., Hermus,A.R., Hofman,A., Houwing-Duistermaat,J.J., Jensen,R.A., Kajantie,E., Kloppenburg,M., Lim,E.M., Masciullo,C., Mariotti,S., Minelli,C., Mitchell,B.D., Nagaraja,R., Netea-Maier,R.T., Palotie,A., Persani,L., Piras,M.G., Psaty,B.M., Raikkonen,K., Richards,J.B., Rivadeneira,F., Sala,C., Sabra,M.M., Sattar,N., Shields,B.M., Soranzo,N., Starr,J.M., Stott,D.J., Sweep,F.C., Usala,G., van der Klauw,M.M., van Heemst,D., van Mullem,A., Vermeulen,S.H., Visser,W.E., Walsh,J.P., Westendorp,R.G., Widen,E., Zhai,G., Cucca,F., Deary,I.J., Eriksson,J.G., Ferrucci,L., Fox,C.S., Jukema,J.W., Kiemeney,L.A., Pramstaller,P.P., Schlessinger,D., Shuldiner,A.R., Slagboom,E.P., Uitterlinden,A.G., Vaidya,B., Visser,T.J., Wolffenbuttel,B.H., Meulenbelt,I., Rotter,J.I., Spector,T.D., Hicks,A.A., Toniolo,D., Sanna,S., Peeters,R.P. and Naitza,S. TITLE A meta-analysis of thyroid-related traits reveals novel loci and gender-specific differences in the regulation of thyroid function JOURNAL PLoS Genet. 9 (2), E1003266 (2013) PUBMED 23408906 REFERENCE 4 (bases 1 to 2656) AUTHORS Zhang,M., Clausell,A., Robinson,T., Yin,J., Chen,E., Johnson,L., Weiss,G., Sabbaj,S., Lowe,R.M., Wagner,F.H., Goepfert,P.A., Kutsch,O. and Cron,R.Q. TITLE Host factor transcriptional regulation contributes to preferential expression of HIV type 1 in IL-4-producing CD4 T cells JOURNAL J. Immunol. 189 (6), 2746-2757 (2012) PUBMED 22875803 REMARK GeneRIF: c-Maf increases human immunodeficiency virus (HIV)-1 expression in interleukin (IL)-4-producing CD4 T cells by binding the proximal HIV-1 long terminal repeat region (LTR) and augmenting HIV-1 transcription. REFERENCE 5 (bases 1 to 2656) AUTHORS Okada Y, Sim X, Go MJ, Wu JY, Gu D, Takeuchi F, Takahashi A, Maeda S, Tsunoda T, Chen P, Lim SC, Wong TY, Liu J, Young TL, Aung T, Seielstad M, Teo YY, Kim YJ, Lee JY, Han BG, Kang D, Chen CH, Tsai FJ, Chang LC, Fann SJ, Mei H, Rao DC, Hixson JE, Chen S, Katsuya T, Isono M, Ogihara T, Chambers JC, Zhang W, Kooner JS, Albrecht E, Yamamoto K, Kubo M, Nakamura Y, Kamatani N, Kato N, He J, Chen YT, Cho YS, Tai ES and Tanaka T. CONSRTM KidneyGen Consortium; CKDGen Consortium; GUGC consortium TITLE Meta-analysis identifies multiple loci associated with kidney function-related traits in east Asian populations JOURNAL Nat. Genet. 44 (8), 904-909 (2012) PUBMED 22797727 REMARK Publication Status: Online-Only REFERENCE 6 (bases 1 to 2656) AUTHORS Christodoulopoulos,P., Cameron,L., Nakamura,Y., Lemiere,C., Muro,S., Dugas,M., Boulet,L.P., Laviolette,M., Olivenstein,R. and Hamid,Q. TITLE TH2 cytokine-associated transcription factors in atopic and nonatopic asthma: evidence for differential signal transducer and activator of transcription 6 expression JOURNAL J. Allergy Clin. Immunol. 107 (4), 586-591 (2001) PUBMED 11295643 REFERENCE 7 (bases 1 to 2656) AUTHORS Chesi,M., Bergsagel,P.L., Shonukan,O.O., Martelli,M.L., Brents,L.A., Chen,T., Schrock,E., Ried,T. and Kuehl,W.M. TITLE Frequent dysregulation of the c-maf proto-oncogene at 16q23 by translocation to an Ig locus in multiple myeloma JOURNAL Blood 91 (12), 4457-4463 (1998) PUBMED 9616139 REFERENCE 8 (bases 1 to 2656) AUTHORS Hedge,S.P., Kumar,A., Kurschner,C. and Shapiro,L.H. TITLE c-Maf interacts with c-Myb to regulate transcription of an early myeloid gene during differentiation JOURNAL Mol. Cell. Biol. 18 (5), 2729-2737 (1998) PUBMED 9566892 REFERENCE 9 (bases 1 to 2656) AUTHORS Kurschner,C. and Morgan,J.I. TITLE USF2/FIP associates with the b-Zip transcription factor, c-Maf, via its bHLH domain and inhibits c-Maf DNA binding activity JOURNAL Biochem. Biophys. Res. Commun. 231 (2), 333-339 (1997) PUBMED 9070273 REMARK Erratum:[Biochem Biophys Res Commun 1997 Apr 7;233(1):293] REFERENCE 10 (bases 1 to 2656) AUTHORS Kerppola,T.K. and Curran,T. TITLE Maf and Nrl can bind to AP-1 sites and form heterodimers with Fos and Jun JOURNAL Oncogene 9 (3), 675-684 (1994) PUBMED 8108109 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BC038438.1, BF726289.1, AF055377.1, BC081542.1 and BE644986.1. This sequence is a reference standard in the RefSeqGene project. On Aug 28, 2008 this sequence version replaced gi:73427804. Summary: The protein encoded by this gene is a DNA-binding, leucine zipper-containing transcription factor that acts as a homodimer or as a heterodimer. Depending on the binding site and binding partner, the encoded protein can be a transcriptional activator or repressor. This protein plays a role in the regulation of several cellular processes, including embryonic lens fiber cell development, increased T-cell susceptibility to apoptosis, and chondrocyte terminal differentiation. Defects in this gene are a cause of juvenile-onset pulverulent cataract as well as congenital cerulean cataract 4 (CCA4). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]. Transcript Variant: This variant (1) is spliced and encodes the longer isoform (a). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF055377.1, DA961675.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025081, ERS025082 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-814 BC038438.1 1-814 815-1147 BF726289.1 98-430 1148-1338 BC038438.1 1145-1335 1339-2066 AF055377.1 1323-2050 2067-2161 BC081542.1 5591-5685 2162-2656 BE644986.1 1-495 c FEATURES Location/Qualifiers source 1..2656 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="16" /map="16q22-q23" gene 1..2656 /gene="MAF" /gene_synonym="c-MAF; CCA4" /note="v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog" /db_xref="GeneID:4094" /db_xref="HGNC:6776" /db_xref="HPRD:01518" /db_xref="MIM:177075" exon 1..1941 /gene="MAF" /gene_synonym="c-MAF; CCA4" /inference="alignment:Splign:1.39.8" variation 44 /gene="MAF" /gene_synonym="c-MAF; CCA4" /replace="g" /replace="t" /db_xref="dbSNP:2288066" misc_feature 662..664 /gene="MAF" /gene_synonym="c-MAF; CCA4" /note="upstream in-frame stop codon" variation 672 /gene="MAF" /gene_synonym="c-MAF; CCA4" /replace="c" /replace="t" /db_xref="dbSNP:3743596" variation 736 /gene="MAF" /gene_synonym="c-MAF; CCA4" /replace="c" /replace="t" /db_xref="dbSNP:4081752" CDS 824..2035 /gene="MAF" /gene_synonym="c-MAF; CCA4" /note="isoform a is encoded by transcript variant 1; Avian musculoaponeurotic fibrosarcoma (MAF) protooncogene; transcription factor Maf; T lymphocyte c-maf long form; c-maf proto-oncogene; proto-oncogene c-Maf" /codon_start=1 /product="transcription factor Maf isoform a" /protein_id="NP_005351.2" /db_xref="GI:5453736" /db_xref="CCDS:CCDS10928.1" /db_xref="GeneID:4094" /db_xref="HGNC:6776" /db_xref="HPRD:01518" /db_xref="MIM:177075" /translation="
MASELAMSNSDLPTSPLAMEYVNDFDLMKFEVKKEPVETDRIISQCGRLIAGGSLSSTPMSTPCSSVPPSPSFSAPSPGSGSEQKAHLEDYYWMTGYPQQLNPEALGFSPEDAVEALISNSHQLQGGFDGYARGAQQLAAAAGAGAGASLGGSGEEMGPAAAVVSAVIAAAAAQSGAGPHYHHHHHHAAGHHHHPTAGAPGAAGSAAASAGGAGGAGGGGPASAGGGGGGGGGGGGGGAAGAGGALHPHHAAGGLHFDDRFSDEQLVTMSVRELNRQLRGVSKEEVIRLKQKRRTLKNRGYAQSCRFKRVQQRHVLESEKNQLLQQVDHLKQEISRLVRERDAYKEKYEKLVSSGFRENGSSSDNPSSPEFFITEPTRKLEPSVGYATFWKPQHRVLTSVFTK
" misc_feature 1079..1183 /gene="MAF" /gene_synonym="c-MAF; CCA4" /note="Maf N-terminal region; Region: Maf_N; pfam08383" /db_xref="CDD:116963" misc_feature 1199..1942 /gene="MAF" /gene_synonym="c-MAF; CCA4" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (O75444.2); Region: Represses ARE-mediated transcription" misc_feature 1604..1882 /gene="MAF" /gene_synonym="c-MAF; CCA4" /note="bZIP Maf transcription factor; Region: bZIP_Maf; pfam03131" /db_xref="CDD:190534" misc_feature 1685..1762 /gene="MAF" /gene_synonym="c-MAF; CCA4" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (O75444.2); Region: Basic motif (By similarity)" misc_feature 1769..1834 /gene="MAF" /gene_synonym="c-MAF; CCA4" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (O75444.2); Region: Leucine-zipper (By similarity)" variation 902 /gene="MAF" /gene_synonym="c-MAF; CCA4" /replace="a" /replace="c" /db_xref="dbSNP:866051" variation 1882 /gene="MAF" /gene_synonym="c-MAF; CCA4" /replace="a" /replace="c" /db_xref="dbSNP:1046957" exon 1942..2647 /gene="MAF" /gene_synonym="c-MAF; CCA4" /inference="alignment:Splign:1.39.8" polyA_signal 2138..2143 /gene="MAF" /gene_synonym="c-MAF; CCA4" polyA_site 2161 /gene="MAF" /gene_synonym="c-MAF; CCA4" variation 2211 /gene="MAF" /gene_synonym="c-MAF; CCA4" /replace="a" /replace="g" /db_xref="dbSNP:2287974" variation 2220 /gene="MAF" /gene_synonym="c-MAF; CCA4" /replace="c" /replace="g" /db_xref="dbSNP:30412" variation 2435 /gene="MAF" /gene_synonym="c-MAF; CCA4" /replace="a" /replace="g" /db_xref="dbSNP:30411" polyA_site 2647 /gene="MAF" /gene_synonym="c-MAF; CCA4" ORIGIN
gaggctttaaaatcttttttcatcttctagctgtagctcgggctgcttgtcggcttggcctccccctcccccctttgctctctgcctcgtctttccccaggacttcgctattttgcttttttaaaaaaaggcaagaaagaactaaactcccccctccctctcctccagtcgggctgcacctctgccttgcactttgcacagaggtagagagcgcgcgagggagagagaggaaagaaaaaaaataataaagagagccaagcagaagaggaggcgagaagcatgaagtgttaactcccccgtgccaaggcccgcgccgcccggacagacgcccgccgcgcctccagccccgagcggacgccgcgcgcgccctgcctgcagcccgggccggcgaggcgagcccttccttatgcaaagcgcgcagcggagcggcgagcgggggacgccgcgcaccgggccgggctcctccagcttcgccgccgcagccaccaccgccgccaccgcagctcgcggaggatcttcccgagcctgaagccgccggctcggcgcgcaaggaggcgagcgagcaaggaggggccggggcgagcgagggagcacattggcgtgagcaggggggagggagggcgggcgcggggggcgcgggcagggcgggggggtgtgtgtgtgagcgcgctcggaggtttcgggccagccaccgccgcgcaagctagaagcgccccagcccggcaagctggctcacccgctggccacccagcacagcccgctggcccctctcctgcagcccatctggcggagcggcggcggcggcggcggcggcggcaggagaatggcatcagaactggcaatgagcaactccgacctgcccaccagtcccctggccatggaatatgttaatgacttcgatctgatgaagtttgaagtgaaaaaggaaccggtggagaccgaccgcatcatcagccagtgcggccgtctcatcgccgggggctcgctgtcctccacccccatgagcacgccgtgcagctcggtgcccccttcccccagcttctcggcgcccagcccgggctcgggcagcgagcagaaggcgcacctggaagactactactggatgaccggctacccgcagcagctgaaccccgaggcgctgggcttcagccccgaggacgcggtcgaggcgctcatcagcaacagccaccagctccagggcggcttcgatggctacgcgcgcggggcgcagcagctggccgcggcggccggggccggtgccggcgcctccttgggcggcagcggcgaggagatgggccccgccgccgccgtggtgtccgccgtgatcgccgcggccgccgcgcagagcggcgcgggcccgcactaccaccaccaccaccaccacgccgccggccaccaccaccacccgacggccggcgcgcccggcgccgcgggcagcgcggccgcctcggccggtggcgctgggggcgcgggcggcggtggcccggccagcgctgggggcggcggcggcggcggcggcggcggaggcggcgggggcgcggcgggggcggggggcgccctgcacccgcaccacgccgccggcggcctgcacttcgacgaccgcttctccgacgagcagctggtgaccatgtctgtgcgcgagctgaaccggcagctgcgcggggtcagcaaggaggaggtgatccggctgaagcagaagaggcggaccctgaaaaaccgcggctatgcccagtcctgccgcttcaagagggtgcagcagagacacgtcctggagtcggagaagaaccagctgctgcagcaagtcgaccacctcaagcaggagatctccaggctggtgcgcgagagggacgcgtacaaggagaaatacgagaagttggtgagcagcggcttccgagaaaacggctcgagcagcgacaacccgtcctctcccgagtttttcataactgagcccactcgcaagttggagccatcagtgggatacgccacattttggaagccccagcatcgtgtacttaccagtgtgttcacaaaatgaaatttgtgtgagagctgtacattaaaaaaaatcatcattattattattatttgcagtcatggagaaccacctacccctgacttctgtttagtctcctttttaaataaaaattactgtgttagagaagaaggctattaaatgtagtagttaactatgcctcttgtctgggggtttcatagagaccggtaggaaagcgcactcctgcttttcgatttatggtgtgtgcaagtaaacaggtgcattgctttcaacctgccatactagttttaaaaattcactgaaattacaaagatacatatatatgcatatatataatggaaagtttcccggaatgcaacaattagcattttaaaatcatatataggcatgcacattctaaatagtactttttcatgcttcattgtttctctggcagataattttactaagaagaaaaatagatattcgactccccttccctaaacaaatccacgggcagaggctccagcggagccgagccccctggttttctcgtaggccctagacggtgttgcatttatcagtgatgtcaaacgtgctcatttgtcagacatagctgtaaatgaaaacaatgtgtggcaaaatacaaagttaaaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:4094 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA GeneID:4094 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA GeneID:4094 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IEA GeneID:4094 -> Biological process: GO:0001816 [cytokine production] evidence: IEA GeneID:4094 -> Biological process: GO:0006366 [transcription from RNA polymerase II promoter] evidence: TAS GeneID:4094 -> Biological process: GO:0032330 [regulation of chondrocyte differentiation] evidence: IEA GeneID:4094 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IEA GeneID:4094 -> Biological process: GO:0048468 [cell development] evidence: IEA GeneID:4094 -> Biological process: GO:0048839 [inner ear development] evidence: IEA GeneID:4094 -> Biological process: GO:0070306 [lens fiber cell differentiation] evidence: IEA GeneID:4094 -> Cellular component: GO:0000785 [chromatin] evidence: TAS GeneID:4094 -> Cellular component: GO:0005634 [nucleus] evidence: IEA GeneID:4094 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.