2024-05-02 06:17:12, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_005315 618 bp mRNA linear PRI 17-APR-2013 DEFINITION Homo sapiens goosecoid homeobox 2 (GSC2), mRNA. ACCESSION NM_005315 VERSION NM_005315.1 GI:4885362 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 618) AUTHORS Inouye,M., Ripatti,S., Kettunen,J., Lyytikainen,L.P., Oksala,N., Laurila,P.P., Kangas,A.J., Soininen,P., Savolainen,M.J., Viikari,J., Kahonen,M., Perola,M., Salomaa,V., Raitakari,O., Lehtimaki,T., Taskinen,M.R., Jarvelin,M.R., Ala-Korpela,M., Palotie,A. and de Bakker,P.I. TITLE Novel Loci for metabolic networks and multi-tissue expression studies reveal genes for atherosclerosis JOURNAL PLoS Genet. 8 (8), E1002907 (2012) PUBMED 22916037 REFERENCE 2 (bases 1 to 618) AUTHORS Galili,N., Nayak,S., Epstein,J.A. and Buck,C.A. TITLE Rnf4, a RING protein expressed in the developing nervous and reproductive systems, interacts with Gscl, a gene within the DiGeorge critical region JOURNAL Dev. Dyn. 218 (1), 102-111 (2000) PUBMED 10822263 REFERENCE 3 (bases 1 to 618) AUTHORS Gottlieb,S., Hanes,S.D., Golden,J.A., Oakey,R.J. and Budarf,M.L. TITLE Goosecoid-like, a gene deleted in DiGeorge and velocardiofacial syndromes, recognizes DNA with a bicoid-like specificity and is expressed in the developing mouse brain JOURNAL Hum. Mol. Genet. 7 (9), 1497-1505 (1998) PUBMED 9700206 REFERENCE 4 (bases 1 to 618) AUTHORS Funke,B., Saint-Jore,B., Puech,A., Sirotkin,H., Edelmann,L., Carlson,C., Raft,S., Pandita,R.K., Kucherlapati,R., Skoultchi,A. and Morrow,B.E. TITLE Characterization and mutation analysis of goosecoid-like (GSCL), a homeodomain-containing gene that maps to the critical region for VCFS/DGS on 22q11 JOURNAL Genomics 46 (3), 364-372 (1997) PUBMED 9441739 REFERENCE 5 (bases 1 to 618) AUTHORS Gottlieb,S., Emanuel,B.S., Driscoll,D.A., Sellinger,B., Wang,Z., Roe,B. and Budarf,M.L. TITLE The DiGeorge syndrome minimal critical region contains a goosecoid-like (GSCL) homeobox gene that is expressed early in human development JOURNAL Am. J. Hum. Genet. 60 (5), 1194-1201 (1997) PUBMED 9150167 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from U96402.1. Summary: Goosecoidlike (GSCL), a homeodomain-containing gene, resides in the critical region for VCFS/DGS on 22q11. Velocardiofacial syndrome (VCFS) is a developmental disorder characterized by conotruncal heart defects, craniofacial anomalies, and learning disabilities. VCFS is phenotypically related to DiGeorge syndrome (DGS) and both syndromes are associated with hemizygous 22q11 deletions. Because many of the tissues and structures affected in VCFS/DGS derive from the pharyngeal arches of the developing embryo, it is believed that haploinsufficiency of a gene involved in embryonic development may be responsible for its etiology. The gene is expressed in a limited number of adult tissues, as well as in early human development. [provided by RefSeq, Jul 2008]. Sequence Note: This RefSeq record was created from genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by experimental evidence. ##Evidence-Data-START## RNAseq introns :: mixed/partial sample support ERS025084, ERS025085 [ECO:0000350] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..618 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="22" /map="22q11.21" gene 1..618 /gene="GSC2" /gene_synonym="GSCL" /note="goosecoid homeobox 2" /db_xref="GeneID:2928" /db_xref="HGNC:4613" /db_xref="HPRD:03506" /db_xref="MIM:601845" CDS 1..618 /gene="GSC2" /gene_synonym="GSCL" /note="GSC-2; GSC-L" /codon_start=1 /product="homeobox protein goosecoid-2" /protein_id="NP_005306.1" /db_xref="GI:4885363" /db_xref="CCDS:CCDS13757.1" /db_xref="GeneID:2928" /db_xref="HGNC:4613" /db_xref="HPRD:03506" /db_xref="MIM:601845" /translation="
MAAAAGGAASRRGAGRPCPFSIEHILSSLPERSLPARAACPPQPAGRQSPAKPEEPGAPEAAPCACCCCCGPRAAPCGPPEAAAGLGARLAWPLRLGPAVPLSLGAPAGGSGALPGAVGPGSQRRTRRHRTIFSEEQLQALEALFVQNQYPDVSTRERLAGRIRLREERVEVWFKNRRAKWRHQKRASASARLLPGVKKSPKGSC
" misc_feature 379..555 /gene="GSC2" /gene_synonym="GSCL" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:28970" misc_feature order(379..393,397..399,448..450,466..468,505..507, 511..516,523..528,532..540,544..549) /gene="GSC2" /gene_synonym="GSCL" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:28970" misc_feature order(385..387,394..396,514..516,523..528,535..537) /gene="GSC2" /gene_synonym="GSCL" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:28970" STS 1..618 /gene="GSC2" /gene_synonym="GSCL" /db_xref="UniSTS:481722" exon 1..259 /gene="GSC2" /gene_synonym="GSCL" /inference="alignment:Splign:1.39.8" variation 139 /gene="GSC2" /gene_synonym="GSCL" /replace="c" /replace="t" /db_xref="dbSNP:34341950" exon 260..513 /gene="GSC2" /gene_synonym="GSCL" /inference="alignment:Splign:1.39.8" exon 514..618 /gene="GSC2" /gene_synonym="GSCL" /inference="alignment:Splign:1.39.8" ORIGIN
atggcggcagcggctgggggcgcggcgagccgccggggtgccgggcggccctgccccttctccatcgagcacatcctctccagcctgcccgagcggagcctcccggcccgggccgcctgcccaccgcagcccgccggtcgccagagccccgcgaagccagaggagcccggggcgcccgaggctgcgccctgcgcctgctgctgctgctgcggcccccgcgcggcgccctgcgggcccccagaggcggccgccgggctgggcgctcgtctggcgtggccgctgaggctgggaccggcggtgcccttgtctctgggtgcgccagccggaggttccggggcgctcccgggcgcggtcggcccgggttcgcagcggcgcacgaggcgccaccgcaccatcttcagcgaagagcagctgcaggcgctcgaggcgcttttcgtgcagaaccagtatcctgacgtgagtacgcgcgagcgcctggccggccgcatccgccttcgcgaggagcgcgtggaggtctggttcaagaaccgccgggccaaatggcgacaccagaagcgcgcgtcggcttccgcgaggctcctgcccggcgtcaagaagtccccgaaggggagctgctga
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:2928 -> Molecular function: GO:0003677 [DNA binding] evidence: TAS GeneID:2928 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IDA GeneID:2928 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA GeneID:2928 -> Biological process: GO:0006357 [regulation of transcription from RNA polymerase II promoter] evidence: IDA GeneID:2928 -> Biological process: GO:0009653 [anatomical structure morphogenesis] evidence: TAS GeneID:2928 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.