GGRNA Home | Help | Advanced search

2024-04-24 17:04:49, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_005302               3815 bp    mRNA    linear   PRI 17-JUN-2013
DEFINITION  Homo sapiens G protein-coupled receptor 37 (endothelin receptor
            type B-like) (GPR37), mRNA.
ACCESSION   NM_005302
VERSION     NM_005302.3  GI:408968120
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3815)
  AUTHORS   Fujita-Jimbo,E., Yu,Z.L., Li,H., Yamagata,T., Mori,M., Momoi,T. and
            Momoi,M.Y.
  TITLE     Mutation in Parkinson disease-associated, G-protein-coupled
            receptor 37 (GPR37/PaelR) is related to autism spectrum disorder
  JOURNAL   PLoS ONE 7 (12), E51155 (2012)
   PUBMED   23251443
  REMARK    GeneRIF: results suggested that some alleles in GPR37 were related
            to the deleterious effect of ASD. GPR37 is associated with the
            dopamine transporter to modulate dopamine uptake, and regulates
            behavioral responses to dopaminergic drugs
REFERENCE   2  (bases 1 to 3815)
  AUTHORS   Marazziti,D., Di Pietro,C., Mandillo,S., Golini,E., Matteoni,R. and
            Tocchini-Valentini,G.P.
  TITLE     Absence of the GPR37/PAEL receptor impairs striatal Akt and ERK2
            phosphorylation, DeltaFosB expression, and conditioned place
            preference to amphetamine and cocaine
  JOURNAL   FASEB J. 25 (6), 2071-2081 (2011)
   PUBMED   21372109
REFERENCE   3  (bases 1 to 3815)
  AUTHORS   Dunham,J.H., Meyer,R.C., Garcia,E.L. and Hall,R.A.
  TITLE     GPR37 surface expression enhancement via N-terminal truncation or
            protein-protein interactions
  JOURNAL   Biochemistry 48 (43), 10286-10297 (2009)
   PUBMED   19799451
  REMARK    GeneRIF: GPR37 surface trafficking in heterologous cells can be
            greatly enhanced by N-terminal truncation, coexpression with other
            receptors, and coexpression with syntenin-1.
REFERENCE   4  (bases 1 to 3815)
  AUTHORS   Marazziti,D., Di Pietro,C., Golini,E., Mandillo,S., Matteoni,R. and
            Tocchini-Valentini,G.P.
  TITLE     Induction of macroautophagy by overexpression of the Parkinson's
            disease-associated GPR37 receptor
  JOURNAL   FASEB J. 23 (6), 1978-1987 (2009)
   PUBMED   19218498
  REMARK    GeneRIF: Data show that GPR37 overexpression can induce cellular
            autophagy, which may prevent the selective degeneration of
            GPR37-expressing neurons, as reported for Parkinson's and related
            neurodegenerative diseases.
REFERENCE   5  (bases 1 to 3815)
  AUTHORS   Wang,H.Q., Imai,Y., Inoue,H., Kataoka,A., Iita,S., Nukina,N. and
            Takahashi,R.
  TITLE     Pael-R transgenic mice crossed with parkin deficient mice displayed
            progressive and selective catecholaminergic neuronal loss
  JOURNAL   J. Neurochem. 107 (1), 171-185 (2008)
   PUBMED   18691389
  REMARK    GeneRIF: Parkin-ko/Pael-R-tg mice represents an AR-JP mouse model
            displaying chronic and selective loss of catecholaminergic neurons.
REFERENCE   6  (bases 1 to 3815)
  AUTHORS   Imai,Y., Soda,M., Hatakeyama,S., Akagi,T., Hashikawa,T.,
            Nakayama,K.I. and Takahashi,R.
  TITLE     CHIP is associated with Parkin, a gene responsible for familial
            Parkinson's disease, and enhances its ubiquitin ligase activity
  JOURNAL   Mol. Cell 10 (1), 55-67 (2002)
   PUBMED   12150907
REFERENCE   7  (bases 1 to 3815)
  AUTHORS   Imai,Y., Soda,M., Inoue,H., Hattori,N., Mizuno,Y. and Takahashi,R.
  TITLE     An unfolded putative transmembrane polypeptide, which can lead to
            endoplasmic reticulum stress, is a substrate of Parkin
  JOURNAL   Cell 105 (7), 891-902 (2001)
   PUBMED   11439185
REFERENCE   8  (bases 1 to 3815)
  AUTHORS   Donohue,P.J., Shapira,H., Mantey,S.A., Hampton,L.L., Jensen,R.T.
            and Battey,J.F.
  TITLE     A human gene encodes a putative G protein-coupled receptor highly
            expressed in the central nervous system
  JOURNAL   Brain Res. Mol. Brain Res. 54 (1), 152-160 (1998)
   PUBMED   9526070
REFERENCE   9  (bases 1 to 3815)
  AUTHORS   Marazziti,D., Golini,E., Gallo,A., Lombardi,M.S., Matteoni,R. and
            Tocchini-Valentini,G.P.
  TITLE     Cloning of GPR37, a gene located on chromosome 7 encoding a
            putative G-protein-coupled peptide receptor, from a human frontal
            brain EST library
  JOURNAL   Genomics 45 (1), 68-77 (1997)
   PUBMED   9339362
REFERENCE   10 (bases 1 to 3815)
  AUTHORS   Zeng,Z., Su,K., Kyaw,H. and Li,Y.
  TITLE     A novel endothelin receptor type-B-like gene enriched in the brain
  JOURNAL   Biochem. Biophys. Res. Commun. 233 (2), 559-567 (1997)
   PUBMED   9144577
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DB475687.1, BC040007.1,
            AF017262.1, DB517451.1 and DB495592.1.
            On Oct 16, 2012 this sequence version replaced gi:31377788.
            
            Summary: This gene is a member of the G protein-coupled receptor
            family. The encoded protein contains seven transmembrane domains
            and is found in cell and endoplasmic reticulum membranes. G
            protein-coupled receptors are involved in translating outside
            signals into G protein mediated intracellular effects. This gene
            product interacts with Parkin and is involved in juvenile Parkinson
            disease. [provided by RefSeq, Oct 2012].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC040007.1, AF017262.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025082, ERS025084 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-398               DB475687.1         3-400
            399-2095            BC040007.1         1-1697
            2096-2096           AF017262.1         1064-1064
            2097-3355           BC040007.1         1699-2957
            3356-3640           DB517451.1         175-459
            3641-3815           DB495592.1         332-506
FEATURES             Location/Qualifiers
     source          1..3815
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="7"
                     /map="7q31"
     gene            1..3815
                     /gene="GPR37"
                     /gene_synonym="EDNRBL; hET(B)R-LP; PAELR"
                     /note="G protein-coupled receptor 37 (endothelin receptor
                     type B-like)"
                     /db_xref="GeneID:2861"
                     /db_xref="HGNC:4494"
                     /db_xref="HPRD:03992"
                     /db_xref="MIM:602583"
     exon            1..2072
                     /gene="GPR37"
                     /gene_synonym="EDNRBL; hET(B)R-LP; PAELR"
                     /inference="alignment:Splign:1.39.8"
     variation       342
                     /gene="GPR37"
                     /gene_synonym="EDNRBL; hET(B)R-LP; PAELR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1557969"
     variation       400
                     /gene="GPR37"
                     /gene_synonym="EDNRBL; hET(B)R-LP; PAELR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11542914"
     variation       404
                     /gene="GPR37"
                     /gene_synonym="EDNRBL; hET(B)R-LP; PAELR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2239532"
     variation       515
                     /gene="GPR37"
                     /gene_synonym="EDNRBL; hET(B)R-LP; PAELR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11542915"
     variation       779
                     /gene="GPR37"
                     /gene_synonym="EDNRBL; hET(B)R-LP; PAELR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34961856"
     variation       970
                     /gene="GPR37"
                     /gene_synonym="EDNRBL; hET(B)R-LP; PAELR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1003897"
     variation       972
                     /gene="GPR37"
                     /gene_synonym="EDNRBL; hET(B)R-LP; PAELR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1003898"
     misc_feature    1005..1007
                     /gene="GPR37"
                     /gene_synonym="EDNRBL; hET(B)R-LP; PAELR"
                     /note="upstream in-frame stop codon"
     CDS             1050..2891
                     /gene="GPR37"
                     /gene_synonym="EDNRBL; hET(B)R-LP; PAELR"
                     /note="Parkin-associated endothelin receptor-like
                     receptor; probable G-protein coupled receptor 37;
                     ETBR-LP-1; endothelin B receptor-like protein 1"
                     /codon_start=1
                     /product="probable G-protein coupled receptor 37
                     precursor"
                     /protein_id="NP_005293.1"
                     /db_xref="GI:4885323"
                     /db_xref="CCDS:CCDS5792.1"
                     /db_xref="GeneID:2861"
                     /db_xref="HGNC:4494"
                     /db_xref="HPRD:03992"
                     /db_xref="MIM:602583"
                     /translation="
MRAPGALLARMSRLLLLLLLKVSASSALGVAPASRNETCLGESCAPTVIQRRGRDAWGPGNSARDVLRARAPREEQGAAFLAGPSWDLPAAPGRDPAAGRGAEASAAGPPGPPTRPPGPWRWKGARGQEPSETLGRGNPTALQLFLQISEEEEKGPRGAGISGRSQEQSVKTVPGASDLFYWPRRAGKLQGSHHKPLSKTANGLAGHEGWTIALPGRALAQNGSLGEGIHEPGGPRRGNSTNRRVRLKNPFYPLTQESYGAYAVMCLSVVIFGTGIIGNLAVMCIVCHNYYMRSISNSLLANLAFWDFLIIFFCLPLVIFHELTKKWLLEDFSCKIVPYIEVASLGVTTFTLCALCIDRFRAATNVQMYYEMIENCSSTTAKLAVIWVGALLLALPEVVLRQLSKEDLGFSGRAPAERCIIKISPDLPDTIYVLALTYDSARLWWYFGCYFCLPTLFTITCSLVTARKIRKAEKACTRGNKRQIQLESQMNCTVVALTILYGFCIIPENICNIVTAYMATGVSQQTMDLLNIISQFLLFFKSCVTPVLLFCLCKPFSRAFMECCCCCCEECIQKSSTVTSDDNDNEYTTELELSPFSTIRREMSTFASVGTHC
"
     sig_peptide     1050..1130
                     /gene="GPR37"
                     /gene_synonym="EDNRBL; hET(B)R-LP; PAELR"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     mat_peptide     1131..2888
                     /gene="GPR37"
                     /gene_synonym="EDNRBL; hET(B)R-LP; PAELR"
                     /product="probable G-protein coupled receptor 37"
     misc_feature    1899..2693
                     /gene="GPR37"
                     /gene_synonym="EDNRBL; hET(B)R-LP; PAELR"
                     /note="7 transmembrane receptor (rhodopsin family);
                     Region: 7tm_1; pfam00001"
                     /db_xref="CDD:200918"
     exon            2073..3815
                     /gene="GPR37"
                     /gene_synonym="EDNRBL; hET(B)R-LP; PAELR"
                     /inference="alignment:Splign:1.39.8"
     variation       2096
                     /gene="GPR37"
                     /gene_synonym="EDNRBL; hET(B)R-LP; PAELR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:724356"
     variation       2378
                     /gene="GPR37"
                     /gene_synonym="EDNRBL; hET(B)R-LP; PAELR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:3735270"
     STS             2690..2888
                     /gene="GPR37"
                     /gene_synonym="EDNRBL; hET(B)R-LP; PAELR"
                     /standard_name="GPR37"
                     /db_xref="UniSTS:503668"
     STS             3225..3331
                     /gene="GPR37"
                     /gene_synonym="EDNRBL; hET(B)R-LP; PAELR"
                     /standard_name="D7S532E"
                     /db_xref="UniSTS:55408"
     STS             3226..3334
                     /gene="GPR37"
                     /gene_synonym="EDNRBL; hET(B)R-LP; PAELR"
                     /standard_name="HSC24E072"
                     /db_xref="UniSTS:82516"
     polyA_signal    3333..3338
                     /gene="GPR37"
                     /gene_synonym="EDNRBL; hET(B)R-LP; PAELR"
     polyA_site      3356
                     /gene="GPR37"
                     /gene_synonym="EDNRBL; hET(B)R-LP; PAELR"
     polyA_signal    3389..3394
                     /gene="GPR37"
                     /gene_synonym="EDNRBL; hET(B)R-LP; PAELR"
     polyA_site      3419
                     /gene="GPR37"
                     /gene_synonym="EDNRBL; hET(B)R-LP; PAELR"
     STS             3708..3790
                     /gene="GPR37"
                     /gene_synonym="EDNRBL; hET(B)R-LP; PAELR"
                     /standard_name="RH93211"
                     /db_xref="UniSTS:84115"
ORIGIN      
ttagtgagtggtgaaccaccaggggatcccgtctccccacaaaccagtatctctccgaggaggaggcgaaggagtgggaggaggcaacgagccgagagtcgagcttcgcgggcgcgcgcagcggctggagcgcgggggcgaggccgggccacctccccttcccggccgcgcactgcctggcccgcggcggttccaggcaccacccttcccgtccgggctgagcccgctgtggcagtgactagctcccgcggctagcggcactgtccaccgacgagcggcgccctcttctcccccttctccccacgatttccttctctgcggcggcacgccgtccagcagcctgcttcgccccgtcgtcaactttgagctggaggagaagcaactttggcagtggccgcggggttggaatcccgcttctcctcggcagcagtaggctcgcaagtcgctggggttaggtggggcaagagtttcgccggcgcatcagcgctgcttcggactgtttgcaacgtgtttccagcgagctgggagcggggttgtgactgcgagtcgtctgggggagggggacttgtttttcttttcctctagagacctcggcttgcaactggatcaaacgctgtcgaaaggatgtaaataggcagagcaactgttaccaagaaggccaccacccccacccaaaggcagtgaggagtgtggggcttcgtctgggctcccccgagtctcaacagtaatcaacagtcaggtgttgattgcaacttttcaaggtcagccaccgggagtagcctattccctctaggaaccttggagggcataccttgctgggactcaacttggctgagaaatgcacaagatgccaaaggaggaaggattatagggggcgtgtgtgtgacccccaagaccgatcttccgctatcaccctaatctccggttccccgctacccgggcgggggtgagtatgtgacatgtgcctaactctcagcagcaacttcggcagcaggtgtcgatcctaactaagcaggagctgcggctgccgggtgtgccctcaccaagccatgcgagccccgggcgcgcttctcgcccgcatgtcgcggctactgcttctgctactgctcaaggtgtctgcctcttctgccctcggggtcgcccctgcgtccagaaacgaaacttgtctgggggagagctgtgcacctacagtgatccagcgccgcggcagggacgcctggggaccgggaaattctgcaagagacgttctgcgagcccgagcacccagggaggagcagggggcagcgtttcttgcgggaccctcctgggacctgccggcggccccgggccgtgacccggctgcaggcagaggggcggaggcgtcggcagccggacccccgggacctccaaccaggccacctggcccctggaggtggaaaggtgctcggggtcaggagccttctgaaactttggggagagggaaccccacggccctccagctcttccttcagatctcagaggaggaagagaagggtcccagaggcgctggcatttccgggcgtagccaggagcagagtgtgaagacagtccccggagccagcgatcttttttactggccaaggagagccgggaaactccagggttcccaccacaagcccctgtccaagacggccaatggactggcggggcacgaagggtggacaattgcactcccgggccgggcgctggcccagaatggatccttgggtgaaggaatccatgagcctgggggtccccgccggggaaacagcacgaaccggcgtgtgagactgaagaaccccttctacccgctgacccaggagtcctatggagcctacgcggtcatgtgtctgtccgtggtgatcttcgggaccggcatcattggcaacctggcggtgatgtgcatcgtgtgccacaactactacatgcggagcatctccaactccctcttggccaacctggccttctgggactttctcatcatcttcttctgccttccgctggtcatcttccacgagctgaccaagaagtggctgctggaggacttctcctgcaagatcgtgccctatatagaggtcgcttctctgggagtcaccactttcaccttatgtgctctgtgcatagaccgcttccgtgctgccaccaacgtacagatgtactacgaaatgatcgaaaactgttcctcaacaactgccaaacttgctgttatatgggtgggagctctattgttagcacttccagaagttgttctccgccagctgagcaaggaggatttggggtttagtggccgagctccggcagaaaggtgcattattaagatctctcctgatttaccagacaccatctatgttctagccctcacctacgacagtgcgagactgtggtggtattttggctgttacttttgtttgcccacgcttttcaccatcacctgctctctagtgactgcgaggaaaatccgcaaagcagagaaagcctgtacccgagggaataaacggcagattcaactagagagtcagatgaactgtacagtagtggcactgaccattttatatggattttgcattattcctgaaaatatctgcaacattgttactgcctacatggctacaggggtttcacagcagacaatggacctccttaatatcatcagccagttccttttgttctttaagtcctgtgtcaccccagtcctccttttctgtctctgcaaacccttcagtcgggccttcatggagtgctgctgctgttgctgtgaggaatgcattcagaagtcttcaacggtgaccagtgatgacaatgacaacgagtacaccacggaactcgaactctcgcctttcagtaccatacgccgtgaaatgtccacttttgcttctgtcggaactcattgctgaaggacagtacttggttgggtcagatttatttgtttgattttcatatcccgtgaaagtttttaattcatatttttccttatagggaaaaatgcaaaaaagaaacaataaagaaagaaatattaactactgtagaactgattttacaaattaatatttgtgctttgaaaaaaagtttctatttagttatttaagaagaatgagaaggccaatagttttagattattttatctggtatggtgctaatattttatttgaaaaaagttactgcaacttaacttaaaattgctaacgttttttcttcttttaaaaatacaattattgtatattgattatagcaatgtgattttgtaggttattttatatttgagttgtgattgaaagtatgttgtatatggtattgtgagatgatttgtacttggaagcattcacaaagtagcaccaaataaattacactttattctttaatgtcattgtcaatctacttttaaccaatattcaataaatcttctaattgccttaaagatacaattactggttctatgcacaatttaaaaccggccttactgttttataacgtattttcttttaaggcaggtaatcattatgttataaagaagtttttctaatagcagtattttatatgcatgattcataaaactatgttgtatgttaaaacaaagctgtatttttaatattcaggtatagatgtcaaattacttctgaatacttataaaatatgaataaatagcagagtaggaagaaagtttcttttttaaaaaattcacctctgaactagcacatagagctacagattttcccttggggaattatgggcagaatcaagaattttaaaatgcagttgtcatctgatttcctctgaacactgacctttgaagctttgtgaatcctacgtaaagcactctg
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:2861 -> Molecular function: GO:0004930 [G-protein coupled receptor activity] evidence: IEA
            GeneID:2861 -> Biological process: GO:0007186 [G-protein coupled receptor signaling pathway] evidence: TAS
            GeneID:2861 -> Cellular component: GO:0005789 [endoplasmic reticulum membrane] evidence: IEA
            GeneID:2861 -> Cellular component: GO:0005887 [integral to plasma membrane] evidence: TAS

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.