2024-04-24 17:04:49, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_005302 3815 bp mRNA linear PRI 17-JUN-2013 DEFINITION Homo sapiens G protein-coupled receptor 37 (endothelin receptor type B-like) (GPR37), mRNA. ACCESSION NM_005302 VERSION NM_005302.3 GI:408968120 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 3815) AUTHORS Fujita-Jimbo,E., Yu,Z.L., Li,H., Yamagata,T., Mori,M., Momoi,T. and Momoi,M.Y. TITLE Mutation in Parkinson disease-associated, G-protein-coupled receptor 37 (GPR37/PaelR) is related to autism spectrum disorder JOURNAL PLoS ONE 7 (12), E51155 (2012) PUBMED 23251443 REMARK GeneRIF: results suggested that some alleles in GPR37 were related to the deleterious effect of ASD. GPR37 is associated with the dopamine transporter to modulate dopamine uptake, and regulates behavioral responses to dopaminergic drugs REFERENCE 2 (bases 1 to 3815) AUTHORS Marazziti,D., Di Pietro,C., Mandillo,S., Golini,E., Matteoni,R. and Tocchini-Valentini,G.P. TITLE Absence of the GPR37/PAEL receptor impairs striatal Akt and ERK2 phosphorylation, DeltaFosB expression, and conditioned place preference to amphetamine and cocaine JOURNAL FASEB J. 25 (6), 2071-2081 (2011) PUBMED 21372109 REFERENCE 3 (bases 1 to 3815) AUTHORS Dunham,J.H., Meyer,R.C., Garcia,E.L. and Hall,R.A. TITLE GPR37 surface expression enhancement via N-terminal truncation or protein-protein interactions JOURNAL Biochemistry 48 (43), 10286-10297 (2009) PUBMED 19799451 REMARK GeneRIF: GPR37 surface trafficking in heterologous cells can be greatly enhanced by N-terminal truncation, coexpression with other receptors, and coexpression with syntenin-1. REFERENCE 4 (bases 1 to 3815) AUTHORS Marazziti,D., Di Pietro,C., Golini,E., Mandillo,S., Matteoni,R. and Tocchini-Valentini,G.P. TITLE Induction of macroautophagy by overexpression of the Parkinson's disease-associated GPR37 receptor JOURNAL FASEB J. 23 (6), 1978-1987 (2009) PUBMED 19218498 REMARK GeneRIF: Data show that GPR37 overexpression can induce cellular autophagy, which may prevent the selective degeneration of GPR37-expressing neurons, as reported for Parkinson's and related neurodegenerative diseases. REFERENCE 5 (bases 1 to 3815) AUTHORS Wang,H.Q., Imai,Y., Inoue,H., Kataoka,A., Iita,S., Nukina,N. and Takahashi,R. TITLE Pael-R transgenic mice crossed with parkin deficient mice displayed progressive and selective catecholaminergic neuronal loss JOURNAL J. Neurochem. 107 (1), 171-185 (2008) PUBMED 18691389 REMARK GeneRIF: Parkin-ko/Pael-R-tg mice represents an AR-JP mouse model displaying chronic and selective loss of catecholaminergic neurons. REFERENCE 6 (bases 1 to 3815) AUTHORS Imai,Y., Soda,M., Hatakeyama,S., Akagi,T., Hashikawa,T., Nakayama,K.I. and Takahashi,R. TITLE CHIP is associated with Parkin, a gene responsible for familial Parkinson's disease, and enhances its ubiquitin ligase activity JOURNAL Mol. Cell 10 (1), 55-67 (2002) PUBMED 12150907 REFERENCE 7 (bases 1 to 3815) AUTHORS Imai,Y., Soda,M., Inoue,H., Hattori,N., Mizuno,Y. and Takahashi,R. TITLE An unfolded putative transmembrane polypeptide, which can lead to endoplasmic reticulum stress, is a substrate of Parkin JOURNAL Cell 105 (7), 891-902 (2001) PUBMED 11439185 REFERENCE 8 (bases 1 to 3815) AUTHORS Donohue,P.J., Shapira,H., Mantey,S.A., Hampton,L.L., Jensen,R.T. and Battey,J.F. TITLE A human gene encodes a putative G protein-coupled receptor highly expressed in the central nervous system JOURNAL Brain Res. Mol. Brain Res. 54 (1), 152-160 (1998) PUBMED 9526070 REFERENCE 9 (bases 1 to 3815) AUTHORS Marazziti,D., Golini,E., Gallo,A., Lombardi,M.S., Matteoni,R. and Tocchini-Valentini,G.P. TITLE Cloning of GPR37, a gene located on chromosome 7 encoding a putative G-protein-coupled peptide receptor, from a human frontal brain EST library JOURNAL Genomics 45 (1), 68-77 (1997) PUBMED 9339362 REFERENCE 10 (bases 1 to 3815) AUTHORS Zeng,Z., Su,K., Kyaw,H. and Li,Y. TITLE A novel endothelin receptor type-B-like gene enriched in the brain JOURNAL Biochem. Biophys. Res. Commun. 233 (2), 559-567 (1997) PUBMED 9144577 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DB475687.1, BC040007.1, AF017262.1, DB517451.1 and DB495592.1. On Oct 16, 2012 this sequence version replaced gi:31377788. Summary: This gene is a member of the G protein-coupled receptor family. The encoded protein contains seven transmembrane domains and is found in cell and endoplasmic reticulum membranes. G protein-coupled receptors are involved in translating outside signals into G protein mediated intracellular effects. This gene product interacts with Parkin and is involved in juvenile Parkinson disease. [provided by RefSeq, Oct 2012]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC040007.1, AF017262.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025082, ERS025084 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-398 DB475687.1 3-400 399-2095 BC040007.1 1-1697 2096-2096 AF017262.1 1064-1064 2097-3355 BC040007.1 1699-2957 3356-3640 DB517451.1 175-459 3641-3815 DB495592.1 332-506 FEATURES Location/Qualifiers source 1..3815 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="7" /map="7q31" gene 1..3815 /gene="GPR37" /gene_synonym="EDNRBL; hET(B)R-LP; PAELR" /note="G protein-coupled receptor 37 (endothelin receptor type B-like)" /db_xref="GeneID:2861" /db_xref="HGNC:4494" /db_xref="HPRD:03992" /db_xref="MIM:602583" exon 1..2072 /gene="GPR37" /gene_synonym="EDNRBL; hET(B)R-LP; PAELR" /inference="alignment:Splign:1.39.8" variation 342 /gene="GPR37" /gene_synonym="EDNRBL; hET(B)R-LP; PAELR" /replace="c" /replace="t" /db_xref="dbSNP:1557969" variation 400 /gene="GPR37" /gene_synonym="EDNRBL; hET(B)R-LP; PAELR" /replace="a" /replace="g" /db_xref="dbSNP:11542914" variation 404 /gene="GPR37" /gene_synonym="EDNRBL; hET(B)R-LP; PAELR" /replace="g" /replace="t" /db_xref="dbSNP:2239532" variation 515 /gene="GPR37" /gene_synonym="EDNRBL; hET(B)R-LP; PAELR" /replace="c" /replace="g" /db_xref="dbSNP:11542915" variation 779 /gene="GPR37" /gene_synonym="EDNRBL; hET(B)R-LP; PAELR" /replace="a" /replace="g" /db_xref="dbSNP:34961856" variation 970 /gene="GPR37" /gene_synonym="EDNRBL; hET(B)R-LP; PAELR" /replace="c" /replace="t" /db_xref="dbSNP:1003897" variation 972 /gene="GPR37" /gene_synonym="EDNRBL; hET(B)R-LP; PAELR" /replace="c" /replace="t" /db_xref="dbSNP:1003898" misc_feature 1005..1007 /gene="GPR37" /gene_synonym="EDNRBL; hET(B)R-LP; PAELR" /note="upstream in-frame stop codon" CDS 1050..2891 /gene="GPR37" /gene_synonym="EDNRBL; hET(B)R-LP; PAELR" /note="Parkin-associated endothelin receptor-like receptor; probable G-protein coupled receptor 37; ETBR-LP-1; endothelin B receptor-like protein 1" /codon_start=1 /product="probable G-protein coupled receptor 37 precursor" /protein_id="NP_005293.1" /db_xref="GI:4885323" /db_xref="CCDS:CCDS5792.1" /db_xref="GeneID:2861" /db_xref="HGNC:4494" /db_xref="HPRD:03992" /db_xref="MIM:602583" /translation="
MRAPGALLARMSRLLLLLLLKVSASSALGVAPASRNETCLGESCAPTVIQRRGRDAWGPGNSARDVLRARAPREEQGAAFLAGPSWDLPAAPGRDPAAGRGAEASAAGPPGPPTRPPGPWRWKGARGQEPSETLGRGNPTALQLFLQISEEEEKGPRGAGISGRSQEQSVKTVPGASDLFYWPRRAGKLQGSHHKPLSKTANGLAGHEGWTIALPGRALAQNGSLGEGIHEPGGPRRGNSTNRRVRLKNPFYPLTQESYGAYAVMCLSVVIFGTGIIGNLAVMCIVCHNYYMRSISNSLLANLAFWDFLIIFFCLPLVIFHELTKKWLLEDFSCKIVPYIEVASLGVTTFTLCALCIDRFRAATNVQMYYEMIENCSSTTAKLAVIWVGALLLALPEVVLRQLSKEDLGFSGRAPAERCIIKISPDLPDTIYVLALTYDSARLWWYFGCYFCLPTLFTITCSLVTARKIRKAEKACTRGNKRQIQLESQMNCTVVALTILYGFCIIPENICNIVTAYMATGVSQQTMDLLNIISQFLLFFKSCVTPVLLFCLCKPFSRAFMECCCCCCEECIQKSSTVTSDDNDNEYTTELELSPFSTIRREMSTFASVGTHC
" sig_peptide 1050..1130 /gene="GPR37" /gene_synonym="EDNRBL; hET(B)R-LP; PAELR" /inference="COORDINATES: ab initio prediction:SignalP:4.0" mat_peptide 1131..2888 /gene="GPR37" /gene_synonym="EDNRBL; hET(B)R-LP; PAELR" /product="probable G-protein coupled receptor 37" misc_feature 1899..2693 /gene="GPR37" /gene_synonym="EDNRBL; hET(B)R-LP; PAELR" /note="7 transmembrane receptor (rhodopsin family); Region: 7tm_1; pfam00001" /db_xref="CDD:200918" exon 2073..3815 /gene="GPR37" /gene_synonym="EDNRBL; hET(B)R-LP; PAELR" /inference="alignment:Splign:1.39.8" variation 2096 /gene="GPR37" /gene_synonym="EDNRBL; hET(B)R-LP; PAELR" /replace="c" /replace="t" /db_xref="dbSNP:724356" variation 2378 /gene="GPR37" /gene_synonym="EDNRBL; hET(B)R-LP; PAELR" /replace="c" /replace="g" /db_xref="dbSNP:3735270" STS 2690..2888 /gene="GPR37" /gene_synonym="EDNRBL; hET(B)R-LP; PAELR" /standard_name="GPR37" /db_xref="UniSTS:503668" STS 3225..3331 /gene="GPR37" /gene_synonym="EDNRBL; hET(B)R-LP; PAELR" /standard_name="D7S532E" /db_xref="UniSTS:55408" STS 3226..3334 /gene="GPR37" /gene_synonym="EDNRBL; hET(B)R-LP; PAELR" /standard_name="HSC24E072" /db_xref="UniSTS:82516" polyA_signal 3333..3338 /gene="GPR37" /gene_synonym="EDNRBL; hET(B)R-LP; PAELR" polyA_site 3356 /gene="GPR37" /gene_synonym="EDNRBL; hET(B)R-LP; PAELR" polyA_signal 3389..3394 /gene="GPR37" /gene_synonym="EDNRBL; hET(B)R-LP; PAELR" polyA_site 3419 /gene="GPR37" /gene_synonym="EDNRBL; hET(B)R-LP; PAELR" STS 3708..3790 /gene="GPR37" /gene_synonym="EDNRBL; hET(B)R-LP; PAELR" /standard_name="RH93211" /db_xref="UniSTS:84115" ORIGIN
ttagtgagtggtgaaccaccaggggatcccgtctccccacaaaccagtatctctccgaggaggaggcgaaggagtgggaggaggcaacgagccgagagtcgagcttcgcgggcgcgcgcagcggctggagcgcgggggcgaggccgggccacctccccttcccggccgcgcactgcctggcccgcggcggttccaggcaccacccttcccgtccgggctgagcccgctgtggcagtgactagctcccgcggctagcggcactgtccaccgacgagcggcgccctcttctcccccttctccccacgatttccttctctgcggcggcacgccgtccagcagcctgcttcgccccgtcgtcaactttgagctggaggagaagcaactttggcagtggccgcggggttggaatcccgcttctcctcggcagcagtaggctcgcaagtcgctggggttaggtggggcaagagtttcgccggcgcatcagcgctgcttcggactgtttgcaacgtgtttccagcgagctgggagcggggttgtgactgcgagtcgtctgggggagggggacttgtttttcttttcctctagagacctcggcttgcaactggatcaaacgctgtcgaaaggatgtaaataggcagagcaactgttaccaagaaggccaccacccccacccaaaggcagtgaggagtgtggggcttcgtctgggctcccccgagtctcaacagtaatcaacagtcaggtgttgattgcaacttttcaaggtcagccaccgggagtagcctattccctctaggaaccttggagggcataccttgctgggactcaacttggctgagaaatgcacaagatgccaaaggaggaaggattatagggggcgtgtgtgtgacccccaagaccgatcttccgctatcaccctaatctccggttccccgctacccgggcgggggtgagtatgtgacatgtgcctaactctcagcagcaacttcggcagcaggtgtcgatcctaactaagcaggagctgcggctgccgggtgtgccctcaccaagccatgcgagccccgggcgcgcttctcgcccgcatgtcgcggctactgcttctgctactgctcaaggtgtctgcctcttctgccctcggggtcgcccctgcgtccagaaacgaaacttgtctgggggagagctgtgcacctacagtgatccagcgccgcggcagggacgcctggggaccgggaaattctgcaagagacgttctgcgagcccgagcacccagggaggagcagggggcagcgtttcttgcgggaccctcctgggacctgccggcggccccgggccgtgacccggctgcaggcagaggggcggaggcgtcggcagccggacccccgggacctccaaccaggccacctggcccctggaggtggaaaggtgctcggggtcaggagccttctgaaactttggggagagggaaccccacggccctccagctcttccttcagatctcagaggaggaagagaagggtcccagaggcgctggcatttccgggcgtagccaggagcagagtgtgaagacagtccccggagccagcgatcttttttactggccaaggagagccgggaaactccagggttcccaccacaagcccctgtccaagacggccaatggactggcggggcacgaagggtggacaattgcactcccgggccgggcgctggcccagaatggatccttgggtgaaggaatccatgagcctgggggtccccgccggggaaacagcacgaaccggcgtgtgagactgaagaaccccttctacccgctgacccaggagtcctatggagcctacgcggtcatgtgtctgtccgtggtgatcttcgggaccggcatcattggcaacctggcggtgatgtgcatcgtgtgccacaactactacatgcggagcatctccaactccctcttggccaacctggccttctgggactttctcatcatcttcttctgccttccgctggtcatcttccacgagctgaccaagaagtggctgctggaggacttctcctgcaagatcgtgccctatatagaggtcgcttctctgggagtcaccactttcaccttatgtgctctgtgcatagaccgcttccgtgctgccaccaacgtacagatgtactacgaaatgatcgaaaactgttcctcaacaactgccaaacttgctgttatatgggtgggagctctattgttagcacttccagaagttgttctccgccagctgagcaaggaggatttggggtttagtggccgagctccggcagaaaggtgcattattaagatctctcctgatttaccagacaccatctatgttctagccctcacctacgacagtgcgagactgtggtggtattttggctgttacttttgtttgcccacgcttttcaccatcacctgctctctagtgactgcgaggaaaatccgcaaagcagagaaagcctgtacccgagggaataaacggcagattcaactagagagtcagatgaactgtacagtagtggcactgaccattttatatggattttgcattattcctgaaaatatctgcaacattgttactgcctacatggctacaggggtttcacagcagacaatggacctccttaatatcatcagccagttccttttgttctttaagtcctgtgtcaccccagtcctccttttctgtctctgcaaacccttcagtcgggccttcatggagtgctgctgctgttgctgtgaggaatgcattcagaagtcttcaacggtgaccagtgatgacaatgacaacgagtacaccacggaactcgaactctcgcctttcagtaccatacgccgtgaaatgtccacttttgcttctgtcggaactcattgctgaaggacagtacttggttgggtcagatttatttgtttgattttcatatcccgtgaaagtttttaattcatatttttccttatagggaaaaatgcaaaaaagaaacaataaagaaagaaatattaactactgtagaactgattttacaaattaatatttgtgctttgaaaaaaagtttctatttagttatttaagaagaatgagaaggccaatagttttagattattttatctggtatggtgctaatattttatttgaaaaaagttactgcaacttaacttaaaattgctaacgttttttcttcttttaaaaatacaattattgtatattgattatagcaatgtgattttgtaggttattttatatttgagttgtgattgaaagtatgttgtatatggtattgtgagatgatttgtacttggaagcattcacaaagtagcaccaaataaattacactttattctttaatgtcattgtcaatctacttttaaccaatattcaataaatcttctaattgccttaaagatacaattactggttctatgcacaatttaaaaccggccttactgttttataacgtattttcttttaaggcaggtaatcattatgttataaagaagtttttctaatagcagtattttatatgcatgattcataaaactatgttgtatgttaaaacaaagctgtatttttaatattcaggtatagatgtcaaattacttctgaatacttataaaatatgaataaatagcagagtaggaagaaagtttcttttttaaaaaattcacctctgaactagcacatagagctacagattttcccttggggaattatgggcagaatcaagaattttaaaatgcagttgtcatctgatttcctctgaacactgacctttgaagctttgtgaatcctacgtaaagcactctg
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:2861 -> Molecular function: GO:0004930 [G-protein coupled receptor activity] evidence: IEA GeneID:2861 -> Biological process: GO:0007186 [G-protein coupled receptor signaling pathway] evidence: TAS GeneID:2861 -> Cellular component: GO:0005789 [endoplasmic reticulum membrane] evidence: IEA GeneID:2861 -> Cellular component: GO:0005887 [integral to plasma membrane] evidence: TAS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.