2024-04-26 15:44:13, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_005241 4835 bp mRNA linear PRI 16-JUN-2013 DEFINITION Homo sapiens MDS1 and EVI1 complex locus (MECOM), transcript variant 2, mRNA. ACCESSION NM_005241 VERSION NM_005241.3 GI:255683381 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 4835) AUTHORS Senyuk,V., Zhang,Y., Liu,Y., Ming,M., Premanand,K., Zhou,L., Chen,P., Chen,J., Rowley,J.D., Nucifora,G. and Qian,Z. TITLE Critical role of miR-9 in myelopoiesis and EVI1-induced leukemogenesis JOURNAL Proc. Natl. Acad. Sci. U.S.A. 110 (14), 5594-5599 (2013) PUBMED 23509296 REMARK GeneRIF: EVI1 binds to the promoter of miR-9-3, leading to DNA hypermethylation of the promoter and repression of miR-9. REFERENCE 2 (bases 1 to 4835) AUTHORS Hwang,J.Y., Lee,S.H., Go,M.J., Kim,B.J., Kou,I., Ikegawa,S., Guo,Y., Deng,H.W., Raychaudhuri,S., Kim,Y.J., Oh,J.H., Kim,Y., Moon,S., Kim,D.J., Koo,H., Cha,M.J., Lee,M.H., Yun,J.Y., Yoo,H.S., Kang,Y.A., Cho,E.H., Kim,S.W., Oh,K.W., Kang,M.I., Son,H.Y., Kim,S.Y., Kim,G.S., Han,B.G., Cho,Y.S., Cho,M.C., Lee,J.Y. and Koh,J.M. TITLE Meta-analysis identifies a MECOM gene as a novel predisposing factor of osteoporotic fracture JOURNAL J. Med. Genet. 50 (4), 212-219 (2013) PUBMED 23349225 REFERENCE 3 (bases 1 to 4835) AUTHORS Steinleitner,K., Rampetsreiter,P., Koffel,R., Ramanathan,G., Mannhalter,C., Strobl,H. and Wieser,R. TITLE EVI1 and MDS1/EVI1 expression during primary human hematopoietic progenitor cell differentiation into various myeloid lineages JOURNAL Anticancer Res. 32 (11), 4883-4889 (2012) PUBMED 23155256 REMARK GeneRIF: EVI1 is expressed in human hematopoietic progenitor cells, but is down-regulated during differentiation REFERENCE 4 (bases 1 to 4835) AUTHORS Hancock,D.B., Artigas,M.S., Gharib,S.A., Henry,A., Manichaikul,A., Ramasamy,A., Loth,D.W., Imboden,M., Koch,B., McArdle,W.L., Smith,A.V., Smolonska,J., Sood,A., Tang,W., Wilk,J.B., Zhai,G., Zhao,J.H., Aschard,H., Burkart,K.M., Curjuric,I., Eijgelsheim,M., Elliott,P., Gu,X., Harris,T.B., Janson,C., Homuth,G., Hysi,P.G., Liu,J.Z., Loehr,L.R., Lohman,K., Loos,R.J., Manning,A.K., Marciante,K.D., Obeidat,M., Postma,D.S., Aldrich,M.C., Brusselle,G.G., Chen,T.H., Eiriksdottir,G., Franceschini,N., Heinrich,J., Rotter,J.I., Wijmenga,C., Williams,O.D., Bentley,A.R., Hofman,A., Laurie,C.C., Lumley,T., Morrison,A.C., Joubert,B.R., Rivadeneira,F., Couper,D.J., Kritchevsky,S.B., Liu,Y., Wjst,M., Wain,L.V., Vonk,J.M., Uitterlinden,A.G., Rochat,T., Rich,S.S., Psaty,B.M., O'Connor,G.T., North,K.E., Mirel,D.B., Meibohm,B., Launer,L.J., Khaw,K.T., Hartikainen,A.L., Hammond,C.J., Glaser,S., Marchini,J., Kraft,P., Wareham,N.J., Volzke,H., Stricker,B.H., Spector,T.D., Probst-Hensch,N.M., Jarvis,D., Jarvelin,M.R., Heckbert,S.R., Gudnason,V., Boezen,H.M., Barr,R.G., Cassano,P.A., Strachan,D.P., Fornage,M., Hall,I.P., Dupuis,J., Tobin,M.D. and London,S.J. TITLE Genome-wide joint meta-analysis of SNP and SNP-by-smoking interaction identifies novel loci for pulmonary function JOURNAL PLoS Genet. 8 (12), E1003098 (2012) PUBMED 23284291 REFERENCE 5 (bases 1 to 4835) AUTHORS Haas,K., Kundi,M., Sperr,W.R., Esterbauer,H., Ludwig,W.D., Ratei,R., Koller,E., Gruener,H., Sauerland,C., Fonatsch,C., Valent,P. and Wieser,R. TITLE Expression and prognostic significance of different mRNA 5'-end variants of the oncogene EVI1 in 266 patients with de novo AML: EVI1 and MDS1/EVI1 overexpression both predict short remission duration JOURNAL Genes Chromosomes Cancer 47 (4), 288-298 (2008) PUBMED 18181178 REMARK GeneRIF: EVI1 and MDS1/EVI1 overexpression is associated with acute myeloid leukemia REFERENCE 6 (bases 1 to 4835) AUTHORS Aytekin,M., Vinatzer,U., Musteanu,M., Raynaud,S. and Wieser,R. TITLE Regulation of the expression of the oncogene EVI1 through the use of alternative mRNA 5'-ends JOURNAL Gene 356, 160-168 (2005) PUBMED 16014322 REMARK GeneRIF: The general expression patterns of the EVI1 5'-end variants in a panel of 20 human tissues were similar, while pronounced differences were noted in response to all-trans retinoic acid. REFERENCE 7 (bases 1 to 4835) AUTHORS Mochizuki,N., Shimizu,S., Nagasawa,T., Tanaka,H., Taniwaki,M., Yokota,J. and Morishita,K. TITLE A novel gene, MEL1, mapped to 1p36.3 is highly homologous to the MDS1/EVI1 gene and is transcriptionally activated in t(1;3)(p36;q21)-positive leukemia cells JOURNAL Blood 96 (9), 3209-3214 (2000) PUBMED 11050005 REFERENCE 8 (bases 1 to 4835) AUTHORS Nucifora,G., Begy,C.R., Kobayashi,H., Roulston,D., Claxton,D., Pedersen-Bjergaard,J., Parganas,E., Ihle,J.N. and Rowley,J.D. TITLE Consistent intergenic splicing and production of multiple transcripts between AML1 at 21q22 and unrelated genes at 3q26 in (3;21)(q26;q22) translocations JOURNAL Proc. Natl. Acad. Sci. U.S.A. 91 (9), 4004-4008 (1994) PUBMED 8171026 REFERENCE 9 (bases 1 to 4835) AUTHORS Mitani,K., Ogawa,S., Tanaka,T., Miyoshi,H., Kurokawa,M., Mano,H., Yazaki,Y., Ohki,M. and Hirai,H. TITLE Generation of the AML1-EVI-1 fusion gene in the t(3;21)(q26;q22) causes blastic crisis in chronic myelocytic leukemia JOURNAL EMBO J. 13 (3), 504-510 (1994) PUBMED 8313895 REFERENCE 10 (bases 1 to 4835) AUTHORS Morishita,K., Parganas,E., Douglass,E.C. and Ihle,J.N. TITLE Unique expression of the human Evi-1 gene in an endometrial carcinoma cell line: sequence of cDNAs and structure of alternatively spliced transcripts JOURNAL Oncogene 5 (7), 963-971 (1990) PUBMED 2115646 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AC078985.14, X54989.1, BC130520.1, BX647613.1 and AA043944.1. On Aug 8, 2009 this sequence version replaced gi:157364942. Summary: The protein encoded by this gene is a transcriptional regulator and oncoprotein that may be involved in hematopoiesis, apoptosis, development, and cell differentiation and proliferation. The encoded protein can interact with CTBP1, SMAD3, CREBBP, KAT2B, MAPK8, and MAPK9. This gene can undergo translocation with the AML1 gene, resulting in overexpression of this gene and the onset of leukemia. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]. Transcript Variant: This variant (2, also known as EVI1_1c) lacks a portion of the 5' UTR and 5' coding region, initiates translation at a downstream start codon, and uses an alternate in-frame splice site in the central coding region, compared to variant 1. The encoded isoform (b) is shorter at the N-terminus compared to isoform a. Variants 2, 3, and 7 all encode the same isoform. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: X54989.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support ERS025081, ERS025082 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-23 AC078985.14 119980-120002 c 24-1048 X54989.1 22-1046 1049-2099 BC130520.1 1088-2138 2100-2654 X54989.1 2098-2652 2655-2655 AC078985.14 68842-68842 c 2656-2893 X54989.1 2654-2891 2894-3047 BC130520.1 2933-3086 3048-3572 X54989.1 3046-3570 3573-4827 BX647613.1 4210-5464 4828-4835 AA043944.1 3-10 c FEATURES Location/Qualifiers source 1..4835 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="3" /map="3q26.2" gene 1..4835 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /note="MDS1 and EVI1 complex locus" /db_xref="GeneID:2122" /db_xref="HGNC:3498" /db_xref="MIM:165215" exon 1..80 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" misc_feature 75..77 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /note="upstream in-frame stop codon" exon 81..215 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" exon 216..318 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" CDS 270..3425 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /note="isoform b is encoded by transcript variant 2; MDS1 and EVI1 complex locus protein EVI1; MDS1 and EVI1 complex locus protein MDS1; oncogene EVI1; myelodysplasia syndrome-associated protein 1; zinc finger protein Evi1; AML1-EVI-1 fusion protein; ecotropic virus integration site 1 protein homolog" /codon_start=1 /product="MDS1 and EVI1 complex locus protein EVI1 isoform b" /protein_id="NP_005232.2" /db_xref="GI:157364943" /db_xref="CCDS:CCDS3205.1" /db_xref="GeneID:2122" /db_xref="HGNC:3498" /db_xref="MIM:165215" /translation="
MKSEDYPHETMAPDIHEERQYRCEDCDQLFESKAELADHQKFPCSTPHSAFSMVEEDFQQKLESENDLQEIHTIQECKECDQVFPDLQSLEKHMLSHTEEREYKCDQCPKAFNWKSNLIRHQMSHDSGKHYECENCAKVFTDPSNLQRHIRSQHVGARAHACPECGKTFATSSGLKQHKHIHSSVKPFICEVCHKSYTQFSNLCRHKRMHADCRTQIKCKDCGQMFSTTSSLNKHRRFCEGKNHFAAGGFFGQGISLPGTPAMDKTSMVNMSHANPGLADYFGANRHPAGLTFPTAPGFSFSFPGLFPSGLYHRPPLIPASSPVKGLSSTEQTNKSQSPLMTHPQILPATQDILKALSKHPSVGDNKPVELQPERSSEERPFEKISDQSESSDLDDVSTPSGSDLETTSGSDLESDIESDKEKFKENGKMFKDKVSPLQNLASINNKKEYSNHSIFSPSLEEQTAVSGAVNDSIKAIASIAEKYFGSTGLVGLQDKKVGALPYPSMFPLPFFPAFSQSMYPFPDRDLRSLPLKMEPQSPGEVKKLQKGSSESPFDLTTKRKDEKPLTPVPSKPPVTPATSQDQPLDLSMGSRSRASGTKLTEPRKNHVFGGKKGSNVESRPASDGSLQHARPTPFFMDPIYRVEKRKLTDPLEALKEKYLRPSPGFLFHPQFQLPDQRTWMSAIENMAEKLESFSALKPEASELLQSVPSMFNFRAPPNALPENLLRKGKERYTCRYCGKIFPRSANLTRHLRTHTGEQPYRCKYCDRSFSISSNLQRHVRNIHNKEKPFKCHLCDRCFGQQTNLDRHLKKHENGNMSGTATSSPHSELESTGAILDDKEDAYFTEIRNFIGNSNHGSQSPRNVEERMNGSHFKDEKALVTSQNSDLLDDEEVEDEVLLDEEDEDNDITGKTGKEPVTSNLHEGNPEDDYEETSALEMSCKTSPVRYKEEEYKSGLSALDHIRHFTDSLKMRKMEDNQYSEAELSSFSTSHVPEELKQPLHRKSKSQAYAMMLSLSDKESLHSTSHSSSNVWHSMARAAAESSAIQSISHV
" misc_feature 270..1025 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q03112.2); Region: Interaction with MAPK9, SMAD3 and probably SUV39H1" misc_feature 534..608 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /note="Zinc-finger double domain; Region: zf-H2C2_2; pfam13465" /db_xref="CDD:205643" misc_feature 579..644 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /note="Zinc finger, C2H2 type; Region: zf-C2H2; cl15478" /db_xref="CDD:210117" misc_feature 702..782 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /note="Zinc-finger double domain; Region: zf-H2C2_2; pfam13465" /db_xref="CDD:205643" misc_feature 834..899 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /note="Zinc finger, C2H2 type; Region: zf-C2H2; cl15478" /db_xref="CDD:210117" misc_feature 921..986 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /note="Zinc finger, C2H2 type; Region: zf-C2H2; cl15478" /db_xref="CDD:210117" misc_feature 1530..1571 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q03112.2); Region: Nuclear localization signal (Potential)" misc_feature 1926..1940 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q03112.2); Region: CTBP-binding motif 1 (By similarity)" misc_feature 2019..2033 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q03112.2); Region: CTBP-binding motif 2 (By similarity)" misc_feature 2469..2534 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /note="Zinc finger, C2H2 type; Region: zf-C2H2; cl15478" /db_xref="CDD:210117" misc_feature 2508..2582 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /note="Zinc-finger double domain; Region: zf-H2C2_2; pfam13465" /db_xref="CDD:205643" misc_feature 2592..2666 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /note="Zinc-finger double domain; Region: zf-H2C2_2; pfam13465" /db_xref="CDD:205643" misc_feature 2847..2849 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q03112.2); phosphorylation site" exon 319..535 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" exon 536..683 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" variation 589 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /replace="a" /replace="g" /db_xref="dbSNP:34896995" STS 632..1839 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /standard_name="Evi1" /db_xref="UniSTS:256974" STS 632..1098 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /standard_name="Evi1" /db_xref="UniSTS:256973" exon 684..837 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" exon 838..2194 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" variation 980 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /replace="a" /replace="g" /db_xref="dbSNP:35594969" variation 1023 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /replace="g" /replace="t" /db_xref="dbSNP:199968662" STS 1283..2229 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /standard_name="Evi1" /db_xref="UniSTS:506889" variation 1902 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /replace="c" /replace="t" /db_xref="dbSNP:2276719" exon 2195..2282 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" exon 2283..2309 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" exon 2310..2476 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" variation 2379 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /replace="a" /replace="c" /db_xref="dbSNP:36043407" exon 2477..2554 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" exon 2555..2724 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" variation 2646 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /replace="c" /replace="t" /db_xref="dbSNP:34224062" exon 2725..2869 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" exon 2870..3106 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" exon 3107..3290 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" exon 3291..4835 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /inference="alignment:Splign:1.39.8" STS 3309..3528 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /standard_name="SHGC-77524" /db_xref="UniSTS:47700" STS 3826..4113 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /standard_name="SGC38138" /db_xref="UniSTS:74058" variation 4013 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /replace="c" /replace="t" /db_xref="dbSNP:1048601" variation 4627 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" /replace="g" /replace="t" /db_xref="dbSNP:1048604" polyA_signal 4807..4812 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" polyA_site 4835 /gene="MECOM" /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3" ORIGIN
ccttgccaagtaacagctttgctgtccaacatcgtgtgctgcttcgcgagaaagtcacattcggaccctttggctagattatcttagacgaattttacaatgtgaagttctgcatagatgccagtcaaccagatgttggaagctggctcaagtacattagattcgctggctgttatgatcagcacaaccttgttgcatgccagataaatgatcagatattctatagagtagttgcagacattgcgccgggagaggagcttctgctgttcatgaagagcgaagactatccccatgaaactatggcgccggatatccacgaagaacggcaatatcgctgcgaagactgtgaccagctctttgaatctaaggctgaactagcagatcaccaaaagtttccatgcagtactcctcactcagcattttcaatggttgaagaggactttcagcaaaaactcgaaagcgagaatgatctccaagagatacacacgatccaggagtgtaaggaatgtgaccaagtttttcctgatttgcaaagcctggagaaacacatgctgtcacatactgaagagagggaatacaagtgtgatcagtgtcccaaggcatttaactggaagtccaatttaattcgccaccagatgtcacatgacagtggaaagcactatgaatgtgaaaactgtgccaaggttttcacggaccctagcaaccttcagcggcacattcgctctcagcatgtcggtgcccgggcccatgcatgcccggagtgtggcaaaacgtttgccacttcgtcgggcctcaaacaacacaagcacatccacagcagtgtgaagccctttatctgtgaggtctgccataaatcctatactcagttttcaaacctttgccgtcataagcgcatgcatgctgattgcagaacccaaatcaagtgcaaagactgtggacaaatgttcagcactacgtcttccttaaataaacacaggaggttttgtgagggcaagaaccattttgcggcaggtggattttttggccaaggcatttcacttcctggaaccccagctatggataaaacgtccatggttaatatgagtcatgccaacccgggccttgctgactattttggcgccaataggcatcctgctggtcttacctttccaacagctcctggattttcttttagcttccctggtctgtttccttccggcttgtaccacaggcctcctttgatacctgctagttctcctgttaaaggactatcaagtactgaacagacaaacaaaagtcaaagtcccctcatgacacatcctcagatactgccagctacacaggatattttgaaggcactatctaaacacccatctgtaggggacaataagccagtggagctccagcccgagaggtcctctgaagagaggccctttgagaaaatcagtgaccagtcagagagtagtgaccttgatgatgtcagtacaccaagtggcagtgacctggaaacaacctcgggctctgatctggaaagtgacattgaaagtgataaagagaaatttaaagaaaatggtaaaatgttcaaagacaaagtaagccctcttcagaatctggcttcaataaataataagaaagaatacagcaatcattccattttctcaccatctttagaggagcagactgcggtgtcaggagctgtgaatgattctataaaggctattgcttctattgctgaaaaatactttggttcaacaggactggtggggctgcaagacaaaaaagttggagctttaccttacccttccatgtttcccctcccattttttccagcattctctcaatcaatgtacccatttcctgatagagacttgagatcgttacctttgaaaatggaaccccaatcaccaggtgaagtaaagaaactgcagaagggcagctctgagtccccctttgatctcaccactaagcgaaaggatgagaagcccttgactccagtcccctccaagcctccagtgacacctgccacaagccaagaccagcccctggatctaagtatgggcagtaggagtagagccagtgggacaaagctgactgagcctcgaaaaaaccacgtgtttgggggaaaaaaaggaagcaacgtcgaatcaagacctgcttcagatggttccttgcagcatgcaagacccactcctttctttatggaccctatttacagagtagagaaaagaaaactaactgacccacttgaagctttaaaagagaaatacttgaggccttctccaggattcttgtttcacccacaattccaactgcctgatcagagaacttggatgtcagctattgaaaacatggcagaaaagctagagagcttcagtgccctgaaacctgaggccagtgagctcttacagtcagtgccctctatgttcaacttcagggcgcctcccaatgccctgccagagaaccttctgcggaagggaaaggagcgctatacctgcagatactgtggcaagatttttccaaggtctgcaaacctaacacggcacttgagaacccacacaggagagcagccttacagatgcaaatactgtgacagatcatttagcatatcttctaacttgcaaaggcatgttcgcaacatccacaataaagagaagccatttaagtgtcacttatgtgataggtgttttggtcaacaaaccaatttagacagacacctaaagaaacatgagaatgggaacatgtccggtacagcaacatcgtcgcctcattctgaactggaaagtacaggtgcgattctggatgacaaagaagatgcttacttcacagaaattcgaaatttcattgggaacagcaaccatggcagccaatctcccaggaatgtggaggagagaatgaatggcagtcattttaaagatgaaaaggctttggtgaccagtcaaaattcagacttgctggatgatgaagaagttgaagatgaggtgttgttagatgaggaggatgaagacaatgatattactggaaaaacaggaaaggaaccagtgacaagtaatttacatgaaggaaaccctgaggatgactatgaagaaaccagtgccctggagatgagttgcaagacatccccagtgaggtataaagaggaagaatataaaagtggactttctgctctagatcatataaggcacttcacagatagcctcaaaatgaggaaaatggaagataatcaatattctgaagctgagctgtcttcttttagtacttcccatgtgccagaggaacttaagcagccgttacacagaaagtccaaatcgcaggcatatgctatgatgctgtcactgtctgacaaggagtccctccattctacatcccacagttcttccaacgtgtggcacagtatggccagggctgcggcggaatccagtgctatccagtccataagccacgtatgacgttatcaaggttgaccagagtgggaccaagtccaacagtagcatggctctttcatataggactatttacaagactgctgagcagaatgccttataaacctgcagggtcactcatctaaagtctagtgaccttaaactgaatgatttaaaaaagaaaagaaagaaaaaagaaactatttattctcgatattttgttttgcacagcaaaggcagctgctgacttctggaagatcaatcaatgcgacttaaagtgattcagtgaaaacaaaaaacttggtgggctgaaggcatcttccagtttaccccaccttagggtatgggtgggtgagaagggcagttgagatggcagcattgatatgaatgaacactccatagaaactgaattctcttttgtacaagatcacctgacatgattgggaacagttgcttttaattacagatttaatttttttcttcgttaaagttttatgtaatttaaccctttgaagacagaagtagttggatgaaatgcacagtcaattattatagaaactgataacagggagtacttgttcccccttttgccttcttaagtacattgtttaaaactagggaaaaagggtatgtgtatattgtaaactatggatgttaacactcaaagaggttaagtcagtgaagtaacctattcatcaccagtaccgctgtaccactaataaattgtttgccaaatccttgtaataacatcttaattttagacaatcatgtcactgtttttaatgtttatttttttgtgtgtgttgcgtgtatcatgtatttatttgttggcaaactattgtttgttgattaaaatagcactgttccagtcagccactactttatgacgtctgaggcacacccctttccgaatttcaaggaccaaggtgacccgacctgtgtatgagagtgccaaatggtgtttggcttttcttaacattcctttttgtttgtttgttttgttttccttcttaatgaactaaatacgaatagatgcaacttagtttttgtaatactgaaatcgattcaattgtataaacgattataatttctttcatggaagcatgattcttctgattaaaaactgtactccatattttatgctggttgtctgcaagcttgtgcgatgttatgttcatgttaatcctatttgtaaaatgaagtgttcccaaccttatgttaaaagagagaagtaaataacagactgtattcagttattttgccctttattgaggaaccagatttgttttctttttgtttgtaatctcattttgaaataatcagcaagttgaggtactttcttcaaatgctttgtacaatataaactgttatgcctttcagtgcattactatgggaggagcaactaaaaaataaagacttacaaaaaggagtattttt
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:2122 -> Molecular function: GO:0003677 [DNA binding] evidence: ISS GeneID:2122 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IDA GeneID:2122 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: TAS GeneID:2122 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:2122 -> Molecular function: GO:0042803 [protein homodimerization activity] evidence: IDA GeneID:2122 -> Molecular function: GO:0046872 [metal ion binding] evidence: IEA GeneID:2122 -> Biological process: GO:0001701 [in utero embryonic development] evidence: IEA GeneID:2122 -> Biological process: GO:0001780 [neutrophil homeostasis] evidence: IEA GeneID:2122 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA GeneID:2122 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: TAS GeneID:2122 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA GeneID:2122 -> Biological process: GO:0006954 [inflammatory response] evidence: IEA GeneID:2122 -> Biological process: GO:0009605 [response to external stimulus] evidence: IEA GeneID:2122 -> Biological process: GO:0009617 [response to bacterium] evidence: IEA GeneID:2122 -> Biological process: GO:0009791 [post-embryonic development] evidence: IEA GeneID:2122 -> Biological process: GO:0030154 [cell differentiation] evidence: IEA GeneID:2122 -> Biological process: GO:0030512 [negative regulation of transforming growth factor beta receptor signaling pathway] evidence: IDA GeneID:2122 -> Biological process: GO:0030900 [forebrain development] evidence: IEA GeneID:2122 -> Biological process: GO:0035115 [embryonic forelimb morphogenesis] evidence: IEA GeneID:2122 -> Biological process: GO:0035116 [embryonic hindlimb morphogenesis] evidence: IEA GeneID:2122 -> Biological process: GO:0042127 [regulation of cell proliferation] evidence: IEA GeneID:2122 -> Biological process: GO:0043069 [negative regulation of programmed cell death] evidence: IMP GeneID:2122 -> Biological process: GO:0045892 [negative regulation of transcription, DNA-dependent] evidence: IDA GeneID:2122 -> Biological process: GO:0045893 [positive regulation of transcription, DNA-dependent] evidence: IDA GeneID:2122 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IEA GeneID:2122 -> Biological process: GO:0046329 [negative regulation of JNK cascade] evidence: IMP GeneID:2122 -> Biological process: GO:0051726 [regulation of cell cycle] evidence: IDA GeneID:2122 -> Biological process: GO:0060039 [pericardium development] evidence: IEA GeneID:2122 -> Biological process: GO:0071425 [hematopoietic stem cell proliferation] evidence: ISS GeneID:2122 -> Biological process: GO:0072001 [renal system development] evidence: IEA GeneID:2122 -> Cellular component: GO:0000118 [histone deacetylase complex] evidence: IDA GeneID:2122 -> Cellular component: GO:0005634 [nucleus] evidence: IDA GeneID:2122 -> Cellular component: GO:0016607 [nuclear speck] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.