GGRNA Home | Help | Advanced search

2024-04-26 15:44:13, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_005241               4835 bp    mRNA    linear   PRI 16-JUN-2013
DEFINITION  Homo sapiens MDS1 and EVI1 complex locus (MECOM), transcript
            variant 2, mRNA.
ACCESSION   NM_005241
VERSION     NM_005241.3  GI:255683381
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 4835)
  AUTHORS   Senyuk,V., Zhang,Y., Liu,Y., Ming,M., Premanand,K., Zhou,L.,
            Chen,P., Chen,J., Rowley,J.D., Nucifora,G. and Qian,Z.
  TITLE     Critical role of miR-9 in myelopoiesis and EVI1-induced
            leukemogenesis
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 110 (14), 5594-5599 (2013)
   PUBMED   23509296
  REMARK    GeneRIF: EVI1 binds to the promoter of miR-9-3, leading to DNA
            hypermethylation of the promoter and repression of miR-9.
REFERENCE   2  (bases 1 to 4835)
  AUTHORS   Hwang,J.Y., Lee,S.H., Go,M.J., Kim,B.J., Kou,I., Ikegawa,S.,
            Guo,Y., Deng,H.W., Raychaudhuri,S., Kim,Y.J., Oh,J.H., Kim,Y.,
            Moon,S., Kim,D.J., Koo,H., Cha,M.J., Lee,M.H., Yun,J.Y., Yoo,H.S.,
            Kang,Y.A., Cho,E.H., Kim,S.W., Oh,K.W., Kang,M.I., Son,H.Y.,
            Kim,S.Y., Kim,G.S., Han,B.G., Cho,Y.S., Cho,M.C., Lee,J.Y. and
            Koh,J.M.
  TITLE     Meta-analysis identifies a MECOM gene as a novel predisposing
            factor of osteoporotic fracture
  JOURNAL   J. Med. Genet. 50 (4), 212-219 (2013)
   PUBMED   23349225
REFERENCE   3  (bases 1 to 4835)
  AUTHORS   Steinleitner,K., Rampetsreiter,P., Koffel,R., Ramanathan,G.,
            Mannhalter,C., Strobl,H. and Wieser,R.
  TITLE     EVI1 and MDS1/EVI1 expression during primary human hematopoietic
            progenitor cell differentiation into various myeloid lineages
  JOURNAL   Anticancer Res. 32 (11), 4883-4889 (2012)
   PUBMED   23155256
  REMARK    GeneRIF: EVI1 is expressed in human hematopoietic progenitor cells,
            but is down-regulated during differentiation
REFERENCE   4  (bases 1 to 4835)
  AUTHORS   Hancock,D.B., Artigas,M.S., Gharib,S.A., Henry,A., Manichaikul,A.,
            Ramasamy,A., Loth,D.W., Imboden,M., Koch,B., McArdle,W.L.,
            Smith,A.V., Smolonska,J., Sood,A., Tang,W., Wilk,J.B., Zhai,G.,
            Zhao,J.H., Aschard,H., Burkart,K.M., Curjuric,I., Eijgelsheim,M.,
            Elliott,P., Gu,X., Harris,T.B., Janson,C., Homuth,G., Hysi,P.G.,
            Liu,J.Z., Loehr,L.R., Lohman,K., Loos,R.J., Manning,A.K.,
            Marciante,K.D., Obeidat,M., Postma,D.S., Aldrich,M.C.,
            Brusselle,G.G., Chen,T.H., Eiriksdottir,G., Franceschini,N.,
            Heinrich,J., Rotter,J.I., Wijmenga,C., Williams,O.D., Bentley,A.R.,
            Hofman,A., Laurie,C.C., Lumley,T., Morrison,A.C., Joubert,B.R.,
            Rivadeneira,F., Couper,D.J., Kritchevsky,S.B., Liu,Y., Wjst,M.,
            Wain,L.V., Vonk,J.M., Uitterlinden,A.G., Rochat,T., Rich,S.S.,
            Psaty,B.M., O'Connor,G.T., North,K.E., Mirel,D.B., Meibohm,B.,
            Launer,L.J., Khaw,K.T., Hartikainen,A.L., Hammond,C.J., Glaser,S.,
            Marchini,J., Kraft,P., Wareham,N.J., Volzke,H., Stricker,B.H.,
            Spector,T.D., Probst-Hensch,N.M., Jarvis,D., Jarvelin,M.R.,
            Heckbert,S.R., Gudnason,V., Boezen,H.M., Barr,R.G., Cassano,P.A.,
            Strachan,D.P., Fornage,M., Hall,I.P., Dupuis,J., Tobin,M.D. and
            London,S.J.
  TITLE     Genome-wide joint meta-analysis of SNP and SNP-by-smoking
            interaction identifies novel loci for pulmonary function
  JOURNAL   PLoS Genet. 8 (12), E1003098 (2012)
   PUBMED   23284291
REFERENCE   5  (bases 1 to 4835)
  AUTHORS   Haas,K., Kundi,M., Sperr,W.R., Esterbauer,H., Ludwig,W.D.,
            Ratei,R., Koller,E., Gruener,H., Sauerland,C., Fonatsch,C.,
            Valent,P. and Wieser,R.
  TITLE     Expression and prognostic significance of different mRNA 5'-end
            variants of the oncogene EVI1 in 266 patients with de novo AML:
            EVI1 and MDS1/EVI1 overexpression both predict short remission
            duration
  JOURNAL   Genes Chromosomes Cancer 47 (4), 288-298 (2008)
   PUBMED   18181178
  REMARK    GeneRIF: EVI1 and MDS1/EVI1 overexpression is associated with acute
            myeloid leukemia
REFERENCE   6  (bases 1 to 4835)
  AUTHORS   Aytekin,M., Vinatzer,U., Musteanu,M., Raynaud,S. and Wieser,R.
  TITLE     Regulation of the expression of the oncogene EVI1 through the use
            of alternative mRNA 5'-ends
  JOURNAL   Gene 356, 160-168 (2005)
   PUBMED   16014322
  REMARK    GeneRIF: The general expression patterns of the EVI1 5'-end
            variants in a panel of 20 human tissues were similar, while
            pronounced differences were noted in response to all-trans retinoic
            acid.
REFERENCE   7  (bases 1 to 4835)
  AUTHORS   Mochizuki,N., Shimizu,S., Nagasawa,T., Tanaka,H., Taniwaki,M.,
            Yokota,J. and Morishita,K.
  TITLE     A novel gene, MEL1, mapped to 1p36.3 is highly homologous to the
            MDS1/EVI1 gene and is transcriptionally activated in
            t(1;3)(p36;q21)-positive leukemia cells
  JOURNAL   Blood 96 (9), 3209-3214 (2000)
   PUBMED   11050005
REFERENCE   8  (bases 1 to 4835)
  AUTHORS   Nucifora,G., Begy,C.R., Kobayashi,H., Roulston,D., Claxton,D.,
            Pedersen-Bjergaard,J., Parganas,E., Ihle,J.N. and Rowley,J.D.
  TITLE     Consistent intergenic splicing and production of multiple
            transcripts between AML1 at 21q22 and unrelated genes at 3q26 in
            (3;21)(q26;q22) translocations
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 91 (9), 4004-4008 (1994)
   PUBMED   8171026
REFERENCE   9  (bases 1 to 4835)
  AUTHORS   Mitani,K., Ogawa,S., Tanaka,T., Miyoshi,H., Kurokawa,M., Mano,H.,
            Yazaki,Y., Ohki,M. and Hirai,H.
  TITLE     Generation of the AML1-EVI-1 fusion gene in the t(3;21)(q26;q22)
            causes blastic crisis in chronic myelocytic leukemia
  JOURNAL   EMBO J. 13 (3), 504-510 (1994)
   PUBMED   8313895
REFERENCE   10 (bases 1 to 4835)
  AUTHORS   Morishita,K., Parganas,E., Douglass,E.C. and Ihle,J.N.
  TITLE     Unique expression of the human Evi-1 gene in an endometrial
            carcinoma cell line: sequence of cDNAs and structure of
            alternatively spliced transcripts
  JOURNAL   Oncogene 5 (7), 963-971 (1990)
   PUBMED   2115646
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC078985.14, X54989.1,
            BC130520.1, BX647613.1 and AA043944.1.
            On Aug 8, 2009 this sequence version replaced gi:157364942.
            
            Summary: The protein encoded by this gene is a transcriptional
            regulator and oncoprotein that may be involved in hematopoiesis,
            apoptosis, development, and cell differentiation and proliferation.
            The encoded protein can interact with CTBP1, SMAD3, CREBBP, KAT2B,
            MAPK8, and MAPK9. This gene can undergo translocation with the AML1
            gene, resulting in overexpression of this gene and the onset of
            leukemia. Several transcript variants encoding a few different
            isoforms have been found for this gene. [provided by RefSeq, Mar
            2011].
            
            Transcript Variant: This variant (2, also known as EVI1_1c) lacks a
            portion of the 5' UTR and 5' coding region, initiates translation
            at a downstream start codon, and uses an alternate in-frame splice
            site in the central coding region, compared to variant 1. The
            encoded isoform (b) is shorter at the N-terminus compared to
            isoform a. Variants 2, 3, and 7 all encode the same isoform.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: X54989.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-23                AC078985.14        119980-120002       c
            24-1048             X54989.1           22-1046
            1049-2099           BC130520.1         1088-2138
            2100-2654           X54989.1           2098-2652
            2655-2655           AC078985.14        68842-68842         c
            2656-2893           X54989.1           2654-2891
            2894-3047           BC130520.1         2933-3086
            3048-3572           X54989.1           3046-3570
            3573-4827           BX647613.1         4210-5464
            4828-4835           AA043944.1         3-10                c
FEATURES             Location/Qualifiers
     source          1..4835
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="3"
                     /map="3q26.2"
     gene            1..4835
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /note="MDS1 and EVI1 complex locus"
                     /db_xref="GeneID:2122"
                     /db_xref="HGNC:3498"
                     /db_xref="MIM:165215"
     exon            1..80
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    75..77
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /note="upstream in-frame stop codon"
     exon            81..215
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     exon            216..318
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     CDS             270..3425
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /note="isoform b is encoded by transcript variant 2; MDS1
                     and EVI1 complex locus protein EVI1; MDS1 and EVI1 complex
                     locus protein MDS1; oncogene EVI1; myelodysplasia
                     syndrome-associated protein 1; zinc finger protein Evi1;
                     AML1-EVI-1 fusion protein; ecotropic virus integration
                     site 1 protein homolog"
                     /codon_start=1
                     /product="MDS1 and EVI1 complex locus protein EVI1 isoform
                     b"
                     /protein_id="NP_005232.2"
                     /db_xref="GI:157364943"
                     /db_xref="CCDS:CCDS3205.1"
                     /db_xref="GeneID:2122"
                     /db_xref="HGNC:3498"
                     /db_xref="MIM:165215"
                     /translation="
MKSEDYPHETMAPDIHEERQYRCEDCDQLFESKAELADHQKFPCSTPHSAFSMVEEDFQQKLESENDLQEIHTIQECKECDQVFPDLQSLEKHMLSHTEEREYKCDQCPKAFNWKSNLIRHQMSHDSGKHYECENCAKVFTDPSNLQRHIRSQHVGARAHACPECGKTFATSSGLKQHKHIHSSVKPFICEVCHKSYTQFSNLCRHKRMHADCRTQIKCKDCGQMFSTTSSLNKHRRFCEGKNHFAAGGFFGQGISLPGTPAMDKTSMVNMSHANPGLADYFGANRHPAGLTFPTAPGFSFSFPGLFPSGLYHRPPLIPASSPVKGLSSTEQTNKSQSPLMTHPQILPATQDILKALSKHPSVGDNKPVELQPERSSEERPFEKISDQSESSDLDDVSTPSGSDLETTSGSDLESDIESDKEKFKENGKMFKDKVSPLQNLASINNKKEYSNHSIFSPSLEEQTAVSGAVNDSIKAIASIAEKYFGSTGLVGLQDKKVGALPYPSMFPLPFFPAFSQSMYPFPDRDLRSLPLKMEPQSPGEVKKLQKGSSESPFDLTTKRKDEKPLTPVPSKPPVTPATSQDQPLDLSMGSRSRASGTKLTEPRKNHVFGGKKGSNVESRPASDGSLQHARPTPFFMDPIYRVEKRKLTDPLEALKEKYLRPSPGFLFHPQFQLPDQRTWMSAIENMAEKLESFSALKPEASELLQSVPSMFNFRAPPNALPENLLRKGKERYTCRYCGKIFPRSANLTRHLRTHTGEQPYRCKYCDRSFSISSNLQRHVRNIHNKEKPFKCHLCDRCFGQQTNLDRHLKKHENGNMSGTATSSPHSELESTGAILDDKEDAYFTEIRNFIGNSNHGSQSPRNVEERMNGSHFKDEKALVTSQNSDLLDDEEVEDEVLLDEEDEDNDITGKTGKEPVTSNLHEGNPEDDYEETSALEMSCKTSPVRYKEEEYKSGLSALDHIRHFTDSLKMRKMEDNQYSEAELSSFSTSHVPEELKQPLHRKSKSQAYAMMLSLSDKESLHSTSHSSSNVWHSMARAAAESSAIQSISHV
"
     misc_feature    270..1025
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q03112.2);
                     Region: Interaction with MAPK9, SMAD3 and probably
                     SUV39H1"
     misc_feature    534..608
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:205643"
     misc_feature    579..644
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /note="Zinc finger, C2H2 type; Region: zf-C2H2; cl15478"
                     /db_xref="CDD:210117"
     misc_feature    702..782
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:205643"
     misc_feature    834..899
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /note="Zinc finger, C2H2 type; Region: zf-C2H2; cl15478"
                     /db_xref="CDD:210117"
     misc_feature    921..986
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /note="Zinc finger, C2H2 type; Region: zf-C2H2; cl15478"
                     /db_xref="CDD:210117"
     misc_feature    1530..1571
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q03112.2);
                     Region: Nuclear localization signal (Potential)"
     misc_feature    1926..1940
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q03112.2);
                     Region: CTBP-binding motif 1 (By similarity)"
     misc_feature    2019..2033
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q03112.2);
                     Region: CTBP-binding motif 2 (By similarity)"
     misc_feature    2469..2534
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /note="Zinc finger, C2H2 type; Region: zf-C2H2; cl15478"
                     /db_xref="CDD:210117"
     misc_feature    2508..2582
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:205643"
     misc_feature    2592..2666
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:205643"
     misc_feature    2847..2849
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q03112.2); phosphorylation site"
     exon            319..535
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     exon            536..683
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     variation       589
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34896995"
     STS             632..1839
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /standard_name="Evi1"
                     /db_xref="UniSTS:256974"
     STS             632..1098
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /standard_name="Evi1"
                     /db_xref="UniSTS:256973"
     exon            684..837
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     exon            838..2194
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     variation       980
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35594969"
     variation       1023
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199968662"
     STS             1283..2229
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /standard_name="Evi1"
                     /db_xref="UniSTS:506889"
     variation       1902
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2276719"
     exon            2195..2282
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     exon            2283..2309
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     exon            2310..2476
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     variation       2379
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:36043407"
     exon            2477..2554
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     exon            2555..2724
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     variation       2646
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34224062"
     exon            2725..2869
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     exon            2870..3106
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     exon            3107..3290
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     exon            3291..4835
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /inference="alignment:Splign:1.39.8"
     STS             3309..3528
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /standard_name="SHGC-77524"
                     /db_xref="UniSTS:47700"
     STS             3826..4113
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /standard_name="SGC38138"
                     /db_xref="UniSTS:74058"
     variation       4013
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1048601"
     variation       4627
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1048604"
     polyA_signal    4807..4812
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
     polyA_site      4835
                     /gene="MECOM"
                     /gene_synonym="AML1-EVI-1; EVI1; MDS1; MDS1-EVI1; PRDM3"
ORIGIN      
ccttgccaagtaacagctttgctgtccaacatcgtgtgctgcttcgcgagaaagtcacattcggaccctttggctagattatcttagacgaattttacaatgtgaagttctgcatagatgccagtcaaccagatgttggaagctggctcaagtacattagattcgctggctgttatgatcagcacaaccttgttgcatgccagataaatgatcagatattctatagagtagttgcagacattgcgccgggagaggagcttctgctgttcatgaagagcgaagactatccccatgaaactatggcgccggatatccacgaagaacggcaatatcgctgcgaagactgtgaccagctctttgaatctaaggctgaactagcagatcaccaaaagtttccatgcagtactcctcactcagcattttcaatggttgaagaggactttcagcaaaaactcgaaagcgagaatgatctccaagagatacacacgatccaggagtgtaaggaatgtgaccaagtttttcctgatttgcaaagcctggagaaacacatgctgtcacatactgaagagagggaatacaagtgtgatcagtgtcccaaggcatttaactggaagtccaatttaattcgccaccagatgtcacatgacagtggaaagcactatgaatgtgaaaactgtgccaaggttttcacggaccctagcaaccttcagcggcacattcgctctcagcatgtcggtgcccgggcccatgcatgcccggagtgtggcaaaacgtttgccacttcgtcgggcctcaaacaacacaagcacatccacagcagtgtgaagccctttatctgtgaggtctgccataaatcctatactcagttttcaaacctttgccgtcataagcgcatgcatgctgattgcagaacccaaatcaagtgcaaagactgtggacaaatgttcagcactacgtcttccttaaataaacacaggaggttttgtgagggcaagaaccattttgcggcaggtggattttttggccaaggcatttcacttcctggaaccccagctatggataaaacgtccatggttaatatgagtcatgccaacccgggccttgctgactattttggcgccaataggcatcctgctggtcttacctttccaacagctcctggattttcttttagcttccctggtctgtttccttccggcttgtaccacaggcctcctttgatacctgctagttctcctgttaaaggactatcaagtactgaacagacaaacaaaagtcaaagtcccctcatgacacatcctcagatactgccagctacacaggatattttgaaggcactatctaaacacccatctgtaggggacaataagccagtggagctccagcccgagaggtcctctgaagagaggccctttgagaaaatcagtgaccagtcagagagtagtgaccttgatgatgtcagtacaccaagtggcagtgacctggaaacaacctcgggctctgatctggaaagtgacattgaaagtgataaagagaaatttaaagaaaatggtaaaatgttcaaagacaaagtaagccctcttcagaatctggcttcaataaataataagaaagaatacagcaatcattccattttctcaccatctttagaggagcagactgcggtgtcaggagctgtgaatgattctataaaggctattgcttctattgctgaaaaatactttggttcaacaggactggtggggctgcaagacaaaaaagttggagctttaccttacccttccatgtttcccctcccattttttccagcattctctcaatcaatgtacccatttcctgatagagacttgagatcgttacctttgaaaatggaaccccaatcaccaggtgaagtaaagaaactgcagaagggcagctctgagtccccctttgatctcaccactaagcgaaaggatgagaagcccttgactccagtcccctccaagcctccagtgacacctgccacaagccaagaccagcccctggatctaagtatgggcagtaggagtagagccagtgggacaaagctgactgagcctcgaaaaaaccacgtgtttgggggaaaaaaaggaagcaacgtcgaatcaagacctgcttcagatggttccttgcagcatgcaagacccactcctttctttatggaccctatttacagagtagagaaaagaaaactaactgacccacttgaagctttaaaagagaaatacttgaggccttctccaggattcttgtttcacccacaattccaactgcctgatcagagaacttggatgtcagctattgaaaacatggcagaaaagctagagagcttcagtgccctgaaacctgaggccagtgagctcttacagtcagtgccctctatgttcaacttcagggcgcctcccaatgccctgccagagaaccttctgcggaagggaaaggagcgctatacctgcagatactgtggcaagatttttccaaggtctgcaaacctaacacggcacttgagaacccacacaggagagcagccttacagatgcaaatactgtgacagatcatttagcatatcttctaacttgcaaaggcatgttcgcaacatccacaataaagagaagccatttaagtgtcacttatgtgataggtgttttggtcaacaaaccaatttagacagacacctaaagaaacatgagaatgggaacatgtccggtacagcaacatcgtcgcctcattctgaactggaaagtacaggtgcgattctggatgacaaagaagatgcttacttcacagaaattcgaaatttcattgggaacagcaaccatggcagccaatctcccaggaatgtggaggagagaatgaatggcagtcattttaaagatgaaaaggctttggtgaccagtcaaaattcagacttgctggatgatgaagaagttgaagatgaggtgttgttagatgaggaggatgaagacaatgatattactggaaaaacaggaaaggaaccagtgacaagtaatttacatgaaggaaaccctgaggatgactatgaagaaaccagtgccctggagatgagttgcaagacatccccagtgaggtataaagaggaagaatataaaagtggactttctgctctagatcatataaggcacttcacagatagcctcaaaatgaggaaaatggaagataatcaatattctgaagctgagctgtcttcttttagtacttcccatgtgccagaggaacttaagcagccgttacacagaaagtccaaatcgcaggcatatgctatgatgctgtcactgtctgacaaggagtccctccattctacatcccacagttcttccaacgtgtggcacagtatggccagggctgcggcggaatccagtgctatccagtccataagccacgtatgacgttatcaaggttgaccagagtgggaccaagtccaacagtagcatggctctttcatataggactatttacaagactgctgagcagaatgccttataaacctgcagggtcactcatctaaagtctagtgaccttaaactgaatgatttaaaaaagaaaagaaagaaaaaagaaactatttattctcgatattttgttttgcacagcaaaggcagctgctgacttctggaagatcaatcaatgcgacttaaagtgattcagtgaaaacaaaaaacttggtgggctgaaggcatcttccagtttaccccaccttagggtatgggtgggtgagaagggcagttgagatggcagcattgatatgaatgaacactccatagaaactgaattctcttttgtacaagatcacctgacatgattgggaacagttgcttttaattacagatttaatttttttcttcgttaaagttttatgtaatttaaccctttgaagacagaagtagttggatgaaatgcacagtcaattattatagaaactgataacagggagtacttgttcccccttttgccttcttaagtacattgtttaaaactagggaaaaagggtatgtgtatattgtaaactatggatgttaacactcaaagaggttaagtcagtgaagtaacctattcatcaccagtaccgctgtaccactaataaattgtttgccaaatccttgtaataacatcttaattttagacaatcatgtcactgtttttaatgtttatttttttgtgtgtgttgcgtgtatcatgtatttatttgttggcaaactattgtttgttgattaaaatagcactgttccagtcagccactactttatgacgtctgaggcacacccctttccgaatttcaaggaccaaggtgacccgacctgtgtatgagagtgccaaatggtgtttggcttttcttaacattcctttttgtttgtttgttttgttttccttcttaatgaactaaatacgaatagatgcaacttagtttttgtaatactgaaatcgattcaattgtataaacgattataatttctttcatggaagcatgattcttctgattaaaaactgtactccatattttatgctggttgtctgcaagcttgtgcgatgttatgttcatgttaatcctatttgtaaaatgaagtgttcccaaccttatgttaaaagagagaagtaaataacagactgtattcagttattttgccctttattgaggaaccagatttgttttctttttgtttgtaatctcattttgaaataatcagcaagttgaggtactttcttcaaatgctttgtacaatataaactgttatgcctttcagtgcattactatgggaggagcaactaaaaaataaagacttacaaaaaggagtattttt
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:2122 -> Molecular function: GO:0003677 [DNA binding] evidence: ISS
            GeneID:2122 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IDA
            GeneID:2122 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: TAS
            GeneID:2122 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:2122 -> Molecular function: GO:0042803 [protein homodimerization activity] evidence: IDA
            GeneID:2122 -> Molecular function: GO:0046872 [metal ion binding] evidence: IEA
            GeneID:2122 -> Biological process: GO:0001701 [in utero embryonic development] evidence: IEA
            GeneID:2122 -> Biological process: GO:0001780 [neutrophil homeostasis] evidence: IEA
            GeneID:2122 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
            GeneID:2122 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: TAS
            GeneID:2122 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA
            GeneID:2122 -> Biological process: GO:0006954 [inflammatory response] evidence: IEA
            GeneID:2122 -> Biological process: GO:0009605 [response to external stimulus] evidence: IEA
            GeneID:2122 -> Biological process: GO:0009617 [response to bacterium] evidence: IEA
            GeneID:2122 -> Biological process: GO:0009791 [post-embryonic development] evidence: IEA
            GeneID:2122 -> Biological process: GO:0030154 [cell differentiation] evidence: IEA
            GeneID:2122 -> Biological process: GO:0030512 [negative regulation of transforming growth factor beta receptor signaling pathway] evidence: IDA
            GeneID:2122 -> Biological process: GO:0030900 [forebrain development] evidence: IEA
            GeneID:2122 -> Biological process: GO:0035115 [embryonic forelimb morphogenesis] evidence: IEA
            GeneID:2122 -> Biological process: GO:0035116 [embryonic hindlimb morphogenesis] evidence: IEA
            GeneID:2122 -> Biological process: GO:0042127 [regulation of cell proliferation] evidence: IEA
            GeneID:2122 -> Biological process: GO:0043069 [negative regulation of programmed cell death] evidence: IMP
            GeneID:2122 -> Biological process: GO:0045892 [negative regulation of transcription, DNA-dependent] evidence: IDA
            GeneID:2122 -> Biological process: GO:0045893 [positive regulation of transcription, DNA-dependent] evidence: IDA
            GeneID:2122 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IEA
            GeneID:2122 -> Biological process: GO:0046329 [negative regulation of JNK cascade] evidence: IMP
            GeneID:2122 -> Biological process: GO:0051726 [regulation of cell cycle] evidence: IDA
            GeneID:2122 -> Biological process: GO:0060039 [pericardium development] evidence: IEA
            GeneID:2122 -> Biological process: GO:0071425 [hematopoietic stem cell proliferation] evidence: ISS
            GeneID:2122 -> Biological process: GO:0072001 [renal system development] evidence: IEA
            GeneID:2122 -> Cellular component: GO:0000118 [histone deacetylase complex] evidence: IDA
            GeneID:2122 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:2122 -> Cellular component: GO:0016607 [nuclear speck] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.