2024-04-20 10:35:56, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_005204 3013 bp mRNA linear PRI 24-JUN-2013 DEFINITION Homo sapiens mitogen-activated protein kinase kinase kinase 8 (MAP3K8), transcript variant 1, mRNA. ACCESSION NM_005204 VERSION NM_005204.3 GI:346644791 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 3013) AUTHORS Gkirtzimanaki,K., Gkouskou,K.K., Oleksiewicz,U., Nikolaidis,G., Vyrla,D., Liontos,M., Pelekanou,V., Kanellis,D.C., Evangelou,K., Stathopoulos,E.N., Field,J.K., Tsichlis,P.N., Gorgoulis,V., Liloglou,T. and Eliopoulos,A.G. TITLE TPL2 kinase is a suppressor of lung carcinogenesis JOURNAL Proc. Natl. Acad. Sci. U.S.A. 110 (16), E1470-E1479 (2013) PUBMED 23533274 REMARK GeneRIF: TPL2 was found to antagonize oncogene-induced cell transformation and survival through a pathway involving p53 downstream of cJun N-terminal kinase (JNK) and be required for optimal p53 response to genotoxic stress. REFERENCE 2 (bases 1 to 3013) AUTHORS Tunca,B., Tezcan,G., Cecener,G., Egeli,U., Zorluoglu,A., Yilmazlar,T., Ak,S., Yerci,O., Ozturk,E., Umut,G. and Evrensel,T. TITLE Overexpression of CK20, MAP3K8 and EIF5A correlates with poor prognosis in early-onset colorectal cancer patients JOURNAL J. Cancer Res. Clin. Oncol. 139 (4), 691-702 (2013) PUBMED 23322277 REMARK GeneRIF: Overexpression of MAP3K8 is associated with early-onset colorectal cancer. REFERENCE 3 (bases 1 to 3013) AUTHORS Kim,G., Khanal,P., Lim,S.C., Yun,H.J., Ahn,S.G., Ki,S.H. and Choi,H.S. TITLE Interleukin-17 induces AP-1 activity and cellular transformation via upregulation of tumor progression locus 2 activity JOURNAL Carcinogenesis 34 (2), 341-350 (2013) PUBMED 23125217 REMARK GeneRIF: High TPL2 expression is associated with tumor progression. REFERENCE 4 (bases 1 to 3013) AUTHORS Jostins,L., Ripke,S., Weersma,R.K., Duerr,R.H., McGovern,D.P., Hui,K.Y., Lee,J.C., Schumm,L.P., Sharma,Y., Anderson,C.A., Essers,J., Mitrovic,M., Ning,K., Cleynen,I., Theatre,E., Spain,S.L., Raychaudhuri,S., Goyette,P., Wei,Z., Abraham,C., Achkar,J.P., Ahmad,T., Amininejad,L., Ananthakrishnan,A.N., Andersen,V., Andrews,J.M., Baidoo,L., Balschun,T., Bampton,P.A., Bitton,A., Boucher,G., Brand,S., Buning,C., Cohain,A., Cichon,S., D'Amato,M., De Jong,D., Devaney,K.L., Dubinsky,M., Edwards,C., Ellinghaus,D., Ferguson,L.R., Franchimont,D., Fransen,K., Gearry,R., Georges,M., Gieger,C., Glas,J., Haritunians,T., Hart,A., Hawkey,C., Hedl,M., Hu,X., Karlsen,T.H., Kupcinskas,L., Kugathasan,S., Latiano,A., Laukens,D., Lawrance,I.C., Lees,C.W., Louis,E., Mahy,G., Mansfield,J., Morgan,A.R., Mowat,C., Newman,W., Palmieri,O., Ponsioen,C.Y., Potocnik,U., Prescott,N.J., Regueiro,M., Rotter,J.I., Russell,R.K., Sanderson,J.D., Sans,M., Satsangi,J., Schreiber,S., Simms,L.A., Sventoraityte,J., Targan,S.R., Taylor,K.D., Tremelling,M., Verspaget,H.W., De Vos,M., Wijmenga,C., Wilson,D.C., Winkelmann,J., Xavier,R.J., Zeissig,S., Zhang,B., Zhang,C.K., Zhao,H., Silverberg,M.S., Annese,V., Hakonarson,H., Brant,S.R., Radford-Smith,G., Mathew,C.G., Rioux,J.D., Schadt,E.E., Daly,M.J., Franke,A., Parkes,M., Vermeire,S., Barrett,J.C. and Cho,J.H. CONSRTM International IBD Genetics Consortium (IIBDGC) TITLE Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease JOURNAL Nature 491 (7422), 119-124 (2012) PUBMED 23128233 REFERENCE 5 (bases 1 to 3013) AUTHORS Ballester,A., Tobena,R., Lisbona,C., Calvo,V. and Alemany,S. TITLE Cot kinase regulation of IL-2 production in Jurkat T cells JOURNAL J. Immunol. 159 (4), 1613-1618 (1997) PUBMED 9257820 REFERENCE 6 (bases 1 to 3013) AUTHORS Salmeron,A., Ahmad,T.B., Carlile,G.W., Pappin,D., Narsimhan,R.P. and Ley,S.C. TITLE Activation of MEK-1 and SEK-1 by Tpl-2 proto-oncoprotein, a novel MAP kinase kinase kinase JOURNAL EMBO J. 15 (4), 817-826 (1996) PUBMED 8631303 REFERENCE 7 (bases 1 to 3013) AUTHORS Aoki,M., Hamada,F., Sugimoto,T., Sumida,S., Akiyama,T. and Toyoshima,K. TITLE The human cot proto-oncogene encodes two protein serine/threonine kinases with different transforming activities by alternative initiation of translation JOURNAL J. Biol. Chem. 268 (30), 22723-22732 (1993) PUBMED 8226782 REFERENCE 8 (bases 1 to 3013) AUTHORS Chan,A.M., Chedid,M., McGovern,E.S., Popescu,N.C., Miki,T. and Aaronson,S.A. TITLE Expression cDNA cloning of a serine kinase transforming gene JOURNAL Oncogene 8 (5), 1329-1333 (1993) PUBMED 8479752 REFERENCE 9 (bases 1 to 3013) AUTHORS Aoki,M., Akiyama,T., Miyoshi,J. and Toyoshima,K. TITLE Identification and characterization of protein products of the cot oncogene with serine kinase activity JOURNAL Oncogene 6 (9), 1515-1519 (1991) PUBMED 1833717 REFERENCE 10 (bases 1 to 3013) AUTHORS Miyoshi,J., Higashi,T., Mukai,H., Ohuchi,T. and Kakunaga,T. TITLE Structure and transforming potential of the human cot oncogene encoding a putative protein kinase JOURNAL Mol. Cell. Biol. 11 (8), 4088-4096 (1991) PUBMED 2072910 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DB271664.1, DA308072.1, BC104833.1, AL161651.13 and AA156603.1. This sequence is a reference standard in the RefSeqGene project. On Sep 14, 2011 this sequence version replaced gi:22035597. Summary: This gene is an oncogene that encodes a member of the serine/threonine protein kinase family. The encoded protein localizes to the cytoplasm and can activate both the MAP kinase and JNK kinase pathways. This protein was shown to activate IkappaB kinases, and thus induce the nuclear production of NF-kappaB. This protein was also found to promote the production of TNF-alpha and IL-2 during T lymphocyte activation. This gene may also utilize a downstream in-frame translation start codon, and thus produce an isoform containing a shorter N-terminus. The shorter isoform has been shown to display weaker transforming activity. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011]. Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: D14497.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025083, ERS025084 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-26 DB271664.1 1-26 27-374 DA308072.1 1-348 375-2163 BC104833.1 1-1789 2164-2597 AL161651.13 143575-144008 2598-3013 AA156603.1 3-418 c FEATURES Location/Qualifiers source 1..3013 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="10" /map="10p11.23" gene 1..3013 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /note="mitogen-activated protein kinase kinase kinase 8" /db_xref="GeneID:1326" /db_xref="HGNC:6860" /db_xref="HPRD:01863" /db_xref="MIM:191195" exon 1..358 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /inference="alignment:Splign:1.39.8" variation 77 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="g" /db_xref="dbSNP:8176952" variation 164 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="c" /db_xref="dbSNP:8176953" variation 168 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="g" /db_xref="dbSNP:8176954" variation 214 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:372356298" variation 278 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="g" /db_xref="dbSNP:369075210" variation 352 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="g" /db_xref="dbSNP:1269691" exon 359..589 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /inference="alignment:Splign:1.39.8" variation 374 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:375770295" variation 412 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="g" /replace="t" /db_xref="dbSNP:143510730" variation 434 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="g" /db_xref="dbSNP:182932469" variation 457 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="g" /db_xref="dbSNP:3751450" variation 458 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="g" /db_xref="dbSNP:8176962" variation 473 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:142989322" variation 542 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="g" /replace="t" /db_xref="dbSNP:1126481" misc_feature 586..588 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /note="upstream in-frame stop codon" exon 590..948 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /inference="alignment:Splign:1.39.8" CDS 613..2016 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /EC_number="2.7.11.25" /note="cot (cancer Osaka thyroid) oncogene; Ewing sarcoma transformant; proto-oncogene serine/threoine protein kinase; proto-oncogene c-Cot; tumor progression locus 2" /codon_start=1 /product="mitogen-activated protein kinase kinase kinase 8" /protein_id="NP_005195.2" /db_xref="GI:22035598" /db_xref="CCDS:CCDS7166.1" /db_xref="GeneID:1326" /db_xref="HGNC:6860" /db_xref="HPRD:01863" /db_xref="MIM:191195" /translation="
MEYMSTGSDNKEEIDLLIKHLNVSDVIDIMENLYASEEPAVYEPSLMTMCQDSNQNDERSKSLLLSGQEVPWLSSVRYGTVEDLLAFANHISNTAKHFYGQRPQESGILLNMVITPQNGRYQIDSDVLLIPWKLTYRNIGSDFIPRGAFGKVYLAQDIKTKKRMACKLIPVDQFKPSDVEIQACFRHENIAELYGAVLWGETVHLFMEAGEGGSVLEKLESCGPMREFEIIWVTKHVLKGLDFLHSKKVIHHDIKPSNIVFMSTKAVLVDFGLSVQMTEDVYFPKDLRGTEIYMSPEVILCRGHSTKADIYSLGATLIHMQTGTPPWVKRYPRSAYPSYLYIIHKQAPPLEDIADDCSPGMRELIEASLERNPNHRPRAADLLKHEALNPPREDQPRCQSLDSALLERKRLLSRKELELPENIADSSCTGSTEESEMLKRQRSLYIDLGALAGYFNLVRGPPTLEYG
" misc_feature 700..702 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /note="Region: alternative start codon" misc_feature 850..852 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /experiment="experimental evidence, no additional details recorded" /note="Phosphothreonine; propagated from UniProtKB/Swiss-Prot (P41279.2); phosphorylation site" misc_feature 1039..1767 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /note="Protein Kinases, catalytic domain; Region: PKc_like; cl09925" /db_xref="CDD:213116" misc_feature order(1042..1056,1066..1068,1105..1107,1111..1113, 1183..1185,1231..1242,1252..1254,1258..1260,1369..1371, 1375..1377,1381..1386,1420..1422,1429..1431,1477..1488) /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /note="active site" /db_xref="CDD:173623" misc_feature order(1042..1056,1066..1068,1105..1107,1111..1113, 1183..1185,1231..1242,1252..1254,1369..1371,1375..1377, 1381..1386,1420..1422) /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:173623" misc_feature 1048..1770 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /note="Serine/Threonine protein kinases, catalytic domain; Region: S_TKc; smart00220" /db_xref="CDD:197582" misc_feature order(1054..1056,1252..1254,1258..1260,1369..1371, 1375..1377,1381..1383,1429..1431,1477..1488) /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /note="substrate binding site [chemical binding]; other site" /db_xref="CDD:173623" misc_feature order(1417..1437,1477..1488) /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /note="activation loop (A-loop); other site" /db_xref="CDD:173623" misc_feature 1810..1812 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (P41279.2); phosphorylation site" misc_feature 1810..1812 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:01261" misc_feature 1849..1851 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:01261" misc_feature 1939..1941 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (P41279.2); phosphorylation site" variation 654 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="g" /replace="t" /db_xref="dbSNP:372120772" variation 694 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="g" /db_xref="dbSNP:150579938" variation 706 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="g" /db_xref="dbSNP:139640494" variation 709 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="g" /db_xref="dbSNP:374430565" variation 771 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:77186746" variation 781 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="g" /db_xref="dbSNP:150001848" variation 787 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:117396201" variation 788 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="g" /db_xref="dbSNP:146728212" variation 802 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:377410996" variation 834 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="c" /db_xref="dbSNP:55962705" variation 840 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="g" /db_xref="dbSNP:370656437" variation 842 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:549474" variation 846 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:1042058" variation 855 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="g" /db_xref="dbSNP:145696701" exon 949..1116 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /inference="alignment:Splign:1.39.8" variation 955 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="g" /db_xref="dbSNP:368515552" variation 987 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:112441933" variation 988 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="g" /db_xref="dbSNP:201540136" variation 996 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="g" /db_xref="dbSNP:375673139" variation 1014 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="g" /db_xref="dbSNP:376205657" variation 1030 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="g" /replace="t" /db_xref="dbSNP:201892819" variation 1048 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:369295837" variation 1049 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="g" /db_xref="dbSNP:143041571" variation 1053 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:200843234" variation 1054 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:3751449" variation 1084 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="t" /db_xref="dbSNP:368789124" variation 1107 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="g" /db_xref="dbSNP:143662794" exon 1117..1378 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /inference="alignment:Splign:1.39.8" variation 1126 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="g" /db_xref="dbSNP:151108315" variation 1169 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="g" /db_xref="dbSNP:373057774" variation 1185 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="g" /db_xref="dbSNP:201649487" variation 1199 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:142650056" variation 1207 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="t" /db_xref="dbSNP:146749791" variation 1242 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:377297760" variation 1253 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:3087944" exon 1379..1485 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /inference="alignment:Splign:1.39.8" variation 1443 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="g" /db_xref="dbSNP:373977741" variation 1445 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="c" /db_xref="dbSNP:139293295" exon 1486..1638 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /inference="alignment:Splign:1.39.8" variation 1503 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="" /replace="g" /db_xref="dbSNP:66989210" variation 1527 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="t" /db_xref="dbSNP:8177062" variation 1560 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="g" /db_xref="dbSNP:114464695" exon 1639..1885 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /inference="alignment:Splign:1.39.8" variation 1668 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:137991584" variation 1740 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:149450278" variation 1741 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:143874924" variation 1750 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="g" /db_xref="dbSNP:368578451" variation 1761 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="g" /db_xref="dbSNP:201275234" variation 1765 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:77316331" variation 1781 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:138733925" variation 1782 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="g" /db_xref="dbSNP:141896473" variation 1787 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="g" /db_xref="dbSNP:371438608" variation 1808 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="t" /db_xref="dbSNP:374373740" variation 1812 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:146241749" variation 1834 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="c" /db_xref="dbSNP:200350013" variation 1881 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:139333853" exon 1886..3013 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /inference="alignment:Splign:1.39.8" variation 1892 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:143676953" variation 1893 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="g" /db_xref="dbSNP:150841663" variation 1897 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="g" /db_xref="dbSNP:374109727" variation 1906 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="t" /db_xref="dbSNP:375251313" variation 1908 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:369517029" variation 1909 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="g" /db_xref="dbSNP:145710720" variation 1924 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="c" /db_xref="dbSNP:190610498" variation 1926 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:372877014" variation 1950 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:375876692" variation 1951 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="g" /db_xref="dbSNP:139316352" variation 1956 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:8177034" variation 1959 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:368281659" variation 1970 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="g" /db_xref="dbSNP:372679892" variation 1979 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="g" /db_xref="dbSNP:376945200" variation 2053 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="t" /db_xref="dbSNP:76259773" STS 2068..2273 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /standard_name="SHGC-35244" /db_xref="UniSTS:59219" variation 2146 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="g" /db_xref="dbSNP:3034" variation 2154 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="g" /replace="t" /db_xref="dbSNP:181810063" variation 2155 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:187247240" variation 2331 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="g" /db_xref="dbSNP:191999092" variation 2397 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:182628550" variation 2446..2447 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="" /replace="aa" /db_xref="dbSNP:201417879" variation 2447..2448 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="" /replace="tt" /db_xref="dbSNP:143503665" variation 2447 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="" /replace="tt" /db_xref="dbSNP:8177035" variation 2534 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:186978828" STS 2565..2872 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /standard_name="SHGC-78707" /db_xref="UniSTS:95584" variation 2631..2632 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="" /replace="t" /db_xref="dbSNP:35579124" variation 2646 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="g" /db_xref="dbSNP:3802631" variation 2693 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:190217524" variation 2749 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="t" /db_xref="dbSNP:369084396" variation 2846 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:182807011" variation 2895 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:8177036" variation 2908 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="a" /replace="g" /db_xref="dbSNP:8177037" polyA_signal 2945..2950 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" polyA_site 2969 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" variation 2970 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:8177038" variation 2975 /gene="MAP3K8" /gene_synonym="c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2" /replace="c" /replace="t" /db_xref="dbSNP:8177039" ORIGIN
accctgcaaccgggcagtctctttctgtttacggagagaaaggggaaatggaaaagtcggggaggcggtggctggcgtccgctgcgccgcccctgggcaggctcagacgccgtgagtcaggggcagagcagggcggtctgagcgtgcgggcgacgcgggtctcactcgtccgctccgctctggactgcgcgccacgctctggggtccggcgccctggttcctgcttctgccgctgccgccgccggatcccagtggcccggcgtgctcggctcccacaggcctgcagccagcatcgcaccgaaccttcggggggccgcggctggagcgctcggccggcgtgggagcgccaaggccgcagatgcaatcttcttaccgcgaagaagccaggggaataggtagccacatcttgtttgcagataagaaaggaagctaacgcagtatctgcaaagccaggagtctgactcagtacttttctcactcatgcatacaaagcagctaaaaatgacacagcttatttaccatgcccctgacactgcactgagcactttatgagcttgaactctgttaatcctcacgaccacctcatgagactctccagaaagagcaacagtaatggagtacatgagcactggaagtgacaataaagaagagattgatttattaattaaacatttaaatgtgtctgatgtaatagacattatggaaaatctttatgcaagtgaagagccagcagtttatgaacccagtctaatgaccatgtgtcaagacagtaatcaaaacgatgagcgttctaagtctctgctgcttagtggccaagaggtaccatggttgtcatcagtcagatatggaactgtggaggatttgcttgcttttgcaaaccatatatccaacactgcaaagcatttttatggacaacgaccacaggaatctggaattttattaaacatggtcatcactccccaaaatggacgttaccaaatagattccgatgttctcctgatcccctggaagctgacttacaggaatattggttctgattttattcctcggggcgcctttggaaaggtatacttggcacaagatataaagacgaagaaaagaatggcgtgtaaactgatcccagtagatcaatttaagccatctgatgtggaaatccaggcttgcttccggcacgagaacatcgcagagctgtatggcgcagtcctgtggggtgaaactgtccatctctttatggaagcaggcgagggagggtctgttctggagaaactggagagctgtggaccaatgagagaatttgaaattatttgggtgacaaagcatgttctcaagggacttgattttctacactcaaagaaagtgatccatcatgatattaaacctagcaacattgttttcatgtccacaaaagctgttttggtggattttggcctaagtgttcaaatgaccgaagatgtctattttcctaaggacctccgaggaacagagatttacatgagcccagaggtcatcctgtgcaggggccattcaaccaaagcagacatctacagcctgggggccacgctcatccacatgcagacgggcaccccaccctgggtgaagcgctaccctcgctcagcctatccctcctacctgtacataatccacaagcaagcacctccactggaagacattgcagatgactgcagtccagggatgagagagctgatagaagcttccctggagagaaaccccaatcaccgcccaagagccgcagacctactaaaacatgaggccctgaacccgcccagagaggatcagccacgctgtcagagtctggactctgccctcttggagcgcaagaggctgctgagtaggaaggagctggaacttcctgagaacattgctgattcttcgtgcacaggaagcaccgaggaatctgagatgctcaagaggcaacgctctctctacatcgacctcggcgctctggctggctacttcaatcttgttcggggaccaccaacgcttgaatatggctgaaggatgccatgtttgctctaaattaagacagcattgatctcctggaggctggttctgctgcctctacacaggggccctgtacagtgaatggtgccattttcgaaggagcagtgtgacctcctgtgacccatgaatgtgcctccaagcggccctgtgtgtttgacatgtgaagctatttgatatgcaccaggtctcaaggttctcatttctcaggtgacgtgattctaaggcaggaatttgagagttcacagaaggatcgtgtctgctgactgtttcattcactgtgcactttgctcaaaattttaaaaataccaatcacaaggataatagagtagcctaaaattactattcttggttcttatttaagtatggaatattcattttactcagaatagctgttttgtgtatattggtgtatattatataactctttgagcctttattggtaaattctggtatacattgaattcattataatttgggtgactagaacaacttgaagattgtagcaataagctggactagtgtcctaaaaatggctaactgatgaattagaagccatctgacagcaggccactagtgacagtttcttttgtgttcctatggaaacattttatactgtacatgctatgctgaagacattcaaaacgtgatgttttgaatgtggataaaactgtgtaaaccacataatttttgtacatcccaaaggatgagaatgtgacctttaagaaaaatgaaaacttttgtaaattattgatgattttgtaattcttatgactaaattttcttttaagcatttgtatattaaaatagcatactgtgtatgttttatatcaaatgccttcatgaatctttcatacatatatatatttgtaacattgtaaagtatgtgagtagtcttatgtaaagtatgtttttacattatgcaaataaaacccaatacttttgtccaatgtggttggtcaaatcaactgaataaattcagtattttgcctta
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:1326 -> Molecular function: GO:0000287 [magnesium ion binding] evidence: IEA GeneID:1326 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: TAS GeneID:1326 -> Molecular function: GO:0004709 [MAP kinase kinase kinase activity] evidence: IEA GeneID:1326 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:1326 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA GeneID:1326 -> Biological process: GO:0006468 [protein phosphorylation] evidence: TAS GeneID:1326 -> Biological process: GO:0007049 [cell cycle] evidence: IEA GeneID:1326 -> Biological process: GO:0031295 [T cell costimulation] evidence: TAS GeneID:1326 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA GeneID:1326 -> Cellular component: GO:0005829 [cytosol] evidence: TAS ANNOTATIONS from NCBI Entrez Gene (20130726): NP_005195 -> EC 2.7.11.25
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.