GGRNA Home | Help | Advanced search

2024-03-30 00:30:40, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_005166               2447 bp    mRNA    linear   PRI 14-MAY-2013
DEFINITION  Homo sapiens amyloid beta (A4) precursor-like protein 1 (APLP1),
            transcript variant 2, mRNA.
ACCESSION   NM_005166
VERSION     NM_005166.3  GI:67782339
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2447)
  AUTHORS   Baumkotter,F., Wagner,K., Eggert,S., Wild,K. and Kins,S.
  TITLE     Structural aspects and physiological consequences of APP/APLP
            trans-dimerization
  JOURNAL   Exp Brain Res 217 (3-4), 389-395 (2012)
   PUBMED   21952790
  REMARK    GeneRIF: [review] APP and its mammalian homologs, amyloid
            precursor-like proteins APLP1 and APLP2, participate under
            physiological conditions via trans-cellular dimerization in
            synaptogenesis.
            Review article
REFERENCE   2  (bases 1 to 2447)
  AUTHORS   Lee,S., Xue,Y., Hu,J., Wang,Y., Liu,X., Demeler,B. and Ha,Y.
  TITLE     The E2 domains of APP and APLP1 share a conserved mode of
            dimerization
  JOURNAL   Biochemistry 50 (24), 5453-5464 (2011)
   PUBMED   21574595
  REMARK    GeneRIF: The 2.1 A resolution electron density map reveals
            phosphate ions that are bound to the protein surface. Mutational
            analysis shows that protein residues interacting with the phosphate
            ions are also involved in heparin binding.
REFERENCE   3  (bases 1 to 2447)
  AUTHORS   Radhakrishnan,K., Krieger,A., Dibue,M., Hescheler,J. and
            Schneider,T.
  TITLE     APLP1 and Rab5A interact with the II-III loop of the voltage-gated
            Ca-channel Ca(v)2.3 and modulate its internalization differently
  JOURNAL   Cell. Physiol. Biochem. 28 (4), 603-612 (2011)
   PUBMED   22178872
  REMARK    GeneRIF: APLP1 binds the II-III loop of the Ca(v)2.3 calcium
            channel and that this binding promotes internalization of the
            channel.
REFERENCE   4  (bases 1 to 2447)
  AUTHORS   Orcholski,M.E., Zhang,Q. and Bredesen,D.E.
  TITLE     Signaling via amyloid precursor-like proteins APLP1 and APLP2
  JOURNAL   J. Alzheimers Dis. 23 (4), 689-699 (2011)
   PUBMED   21178287
  REMARK    GeneRIF: Both APLP1 and APLP2, form transcriptionally active triple
            protein complexes with Mint3 and transcriptional co-activators Taz
            andYap.
REFERENCE   5  (bases 1 to 2447)
  AUTHORS   Yanagida,K., Okochi,M., Tagami,S., Nakayama,T., Kodama,T.S.,
            Nishitomi,K., Jiang,J., Mori,K., Tatsumi,S., Arai,T., Ikeuchi,T.,
            Kasuga,K., Tokuda,T., Kondo,M., Ikeda,M., Deguchi,K., Kazui,H.,
            Tanaka,T., Morihara,T., Hashimoto,R., Kudo,T., Steiner,H.,
            Haass,C., Tsuchiya,K., Akiyama,H., Kuwano,R. and Takeda,M.
  TITLE     The 28-amino acid form of an APLP1-derived Abeta-like peptide is a
            surrogate marker for Abeta42 production in the central nervous
            system
  JOURNAL   EMBO Mol Med 1 (4), 223-235 (2009)
   PUBMED   20049724
  REMARK    GeneRIF: Human cerebrospinal fluid contains three APLP1-derived
            Abeta-like peptides that are generated by beta- and gamma-cleavages
            at a concentration of approximately 4.5 nM.
REFERENCE   6  (bases 1 to 2447)
  AUTHORS   Paliga,K., Peraus,G., Kreger,S., Durrwang,U., Hesse,L.,
            Multhaup,G., Masters,C.L., Beyreuther,K. and Weidemann,A.
  TITLE     Human amyloid precursor-like protein 1--cDNA cloning, ectopic
            expression in COS-7 cells and identification of soluble forms in
            the cerebrospinal fluid
  JOURNAL   Eur. J. Biochem. 250 (2), 354-363 (1997)
   PUBMED   9428684
REFERENCE   7  (bases 1 to 2447)
  AUTHORS   Bressler,S.L., Gray,M.D., Sopher,B.L., Hu,Q., Hearn,M.G.,
            Pham,D.G., Dinulos,M.B., Fukuchi,K., Sisodia,S.S., Miller,M.A.,
            Disteche,C.M. and Martin,G.M.
  TITLE     cDNA cloning and chromosome mapping of the human Fe65 gene:
            interaction of the conserved cytoplasmic domains of the human
            beta-amyloid precursor protein and its homologues with the mouse
            Fe65 protein
  JOURNAL   Hum. Mol. Genet. 5 (10), 1589-1598 (1996)
   PUBMED   8894693
REFERENCE   8  (bases 1 to 2447)
  AUTHORS   Kim,T.W., Wu,K., Xu,J.L., McAuliffe,G., Tanzi,R.E., Wasco,W. and
            Black,I.B.
  TITLE     Selective localization of amyloid precursor-like protein 1 in the
            cerebral cortex postsynaptic density
  JOURNAL   Brain Res. Mol. Brain Res. 32 (1), 36-44 (1995)
   PUBMED   7494461
REFERENCE   9  (bases 1 to 2447)
  AUTHORS   Bush,A.I., Pettingell,W.H. Jr., de Paradis,M., Tanzi,R.E. and
            Wasco,W.
  TITLE     The amyloid beta-protein precursor and its mammalian homologues.
            Evidence for a zinc-modulated heparin-binding superfamily
  JOURNAL   J. Biol. Chem. 269 (43), 26618-26621 (1994)
   PUBMED   7929392
REFERENCE   10 (bases 1 to 2447)
  AUTHORS   Wasco,W., Brook,J.D. and Tanzi,R.E.
  TITLE     The amyloid precursor-like protein (APLP) gene maps to the long arm
            of human chromosome 19
  JOURNAL   Genomics 15 (1), 237-239 (1993)
   PUBMED   8432545
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AD000864.1, BC012889.1 and
            BQ219233.1.
            On Jun 15, 2005 this sequence version replaced gi:21361259.
            
            Summary: This gene encodes a member of the highly conserved amyloid
            precursor protein gene family. The encoded protein is a
            membrane-associated glycoprotein that is cleaved by secretases in a
            manner similar to amyloid beta A4 precursor protein cleavage. This
            cleavage liberates an intracellular cytoplasmic fragment that may
            act as a transcriptional activator. The encoded protein may also
            play a role in synaptic maturation during cortical development.
            Alternatively spliced transcript variants encoding different
            isoforms have been described. [provided by RefSeq, Jul 2008].
            
            Transcript Variant: This variant (2) uses an alternate in-frame
            splice site in the coding region, compared to variant 1. It encodes
            isoform 2, which is shorter than isoform 1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC012889.1, U48437.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025082, ERS025088 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-69                AD000864.1         3111-3179
            70-2439             BC012889.1         1-2370
            2440-2447           BQ219233.1         696-703
FEATURES             Location/Qualifiers
     source          1..2447
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="19"
                     /map="19q13.1"
     gene            1..2447
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /note="amyloid beta (A4) precursor-like protein 1"
                     /db_xref="GeneID:333"
                     /db_xref="HGNC:597"
                     /db_xref="HPRD:00102"
                     /db_xref="MIM:104775"
     exon            1..285
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    118..120
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /note="upstream in-frame stop codon"
     CDS             139..2091
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /note="isoform 2 precursor is encoded by transcript
                     variant 2; amyloid-like protein 1; amyloid precursor-like
                     protein 1; APLP-1"
                     /codon_start=1
                     /product="amyloid-like protein 1 isoform 2 precursor"
                     /protein_id="NP_005157.1"
                     /db_xref="GI:4885065"
                     /db_xref="GeneID:333"
                     /db_xref="HGNC:597"
                     /db_xref="HPRD:00102"
                     /db_xref="MIM:104775"
                     /translation="
MGPASPAARGLSRRPGQPPLPLLLPLLLLLLRAQPAIGSLAGGSPGAAEAPGSAQVAGLCGRLTLHRDLRTGRWEPDPQRSRRCLRDPQRVLEYCRQMYPELQIARVEQATQAIPMERWCGGSRSGSCAHPHHQVVPFRCLPGEFVSEALLVPEGCRFLHQERMDQCESSTRRHQEAQEACSSQGLILHGSGMLLPCGSDRFRGVEYVCCPPPGTPDPSGTAVGDPSTRSWPPGSRVEGAEDEEEEESFPQPVDDYFVEPPQAEEEEETVPPPSSHTLAVVGKVTPTPRPTDGVDIYFGMPGEISEHEGFLRAKMDLEERRMRQINEVMREWAMADNQSKNLPKADRQALNEHFQSILQTLEEQVSGERQRLVETHATRVIALINDQRRAALEGFLAALQADPPQAERVLLALRRYLRAEQKEQRHTLRHYQHVAAVDPEKAQQMRFQVHTHLQVIEERVNQSLGLLDQNPHLAQELRPQIQELLHSEHLGPSELEAPAPGGSSEDKGGLQPPDSKDDTPMTLPKGSTEQDAASPEKEKMNPLEQYERKVNASVPRGFPFHSSEIQRDELAPAGTGVSREAVSGLLIMGAGGGSLIVLSMLLLRRKKPYGAISHGVVEVDPMLTLEEQQLRELQRHGYENPTYRFLEERP
"
     sig_peptide     139..252
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     mat_peptide     253..2088
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /product="amyloid-like protein 1 isoform 2"
     misc_feature    301..771
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /note="amyloid A4; Region: A4_EXTRA; smart00006"
                     /db_xref="CDD:128326"
     misc_feature    301..600
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /note="Amyloid A4 N-terminal heparin-binding; Region:
                     APP_N; pfam02177"
                     /db_xref="CDD:190234"
     misc_feature    601..771
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /note="Copper-binding of amyloid precursor, CuBD; Region:
                     APP_Cu_bd; pfam12924"
                     /db_xref="CDD:193397"
     misc_feature    610..672
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P51693.3);
                     Region: Copper-binding (By similarity)"
     misc_feature    637..639
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="Required for Cu(2+) reduction (By similarity);
                     propagated from UniProtKB/Swiss-Prot (P51693.3); other
                     site"
     misc_feature    748..771
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P51693.3);
                     Region: Zinc-binding"
     misc_feature    988..1542
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /note="E2 domain of amyloid precursor protein; Region:
                     APP_E2; pfam12925"
                     /db_xref="CDD:205150"
     misc_feature    991..1053
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P51693.3);
                     Region: O-glycosylated at three sites"
     misc_feature    1066..1164
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P51693.3);
                     Region: Heparin-binding (By similarity)"
     misc_feature    1147..1149
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="glycosylation site"
                     /citation=[6]
     misc_feature    1366..1461
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P51693.3);
                     Region: Heparin-binding (By similarity)"
     misc_feature    1462..1515
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P51693.3);
                     Region: Collagen-binding (By similarity)"
     misc_feature    1519..1521
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="glycosylation site"
                     /citation=[6]
     misc_feature    1789..1791
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="glycosylation site"
                     /citation=[6]
     misc_feature    1879..1947
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P51693.3);
                     transmembrane region"
     misc_feature    1918..2079
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /note="beta-amyloid precursor protein C-terminus; Region:
                     APP_amyloid; pfam10515"
                     /db_xref="CDD:151071"
     misc_feature    1948..1983
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P51693.3);
                     Region: Basolateral sorting signal (By similarity)"
     misc_feature    1996..2001
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="Cleavage, by caspase-3 (By similarity); propagated
                     from UniProtKB/Swiss-Prot (P51693.3); cleavage site"
     mat_peptide     1999..2088
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /product="C30 (By similarity)"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P51693.3)"
     misc_feature    2032..2085
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P51693.3);
                     Region: Interaction with DAB1 (By similarity)"
     misc_feature    2044..2088
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P51693.3);
                     Region: Interaction with DAB2 (By similarity)"
     misc_feature    2056..2067
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P51693.3);
                     Region: Clathrin-binding (Potential)"
     misc_feature    2056..2067
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P51693.3);
                     Region: NPXY motif, contains endocytosis signal"
     variation       148
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:7249156"
     variation       155
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:11551001"
     variation       176
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11550995"
     variation       193
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:113170155"
     variation       216
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11550997"
     variation       250
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11550999"
     exon            286..429
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /inference="alignment:Splign:1.39.8"
     variation       293
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150327956"
     variation       312
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11550994"
     variation       318
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:184150635"
     variation       327
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368919721"
     variation       354
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:137921081"
     variation       356
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142353985"
     variation       357
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145927014"
     variation       361
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139993081"
     variation       363
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11551003"
     variation       383
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201483792"
     variation       395
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373971997"
     variation       397
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375934057"
     variation       399
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369825983"
     variation       401
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11550996"
     exon            430..562
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /inference="alignment:Splign:1.39.8"
     variation       441
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77209402"
     variation       454
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144561889"
     variation       471
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148450806"
     variation       506
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376121334"
     variation       509
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11550998"
     variation       562
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202136254"
     exon            563..675
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /inference="alignment:Splign:1.39.8"
     variation       578
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142596936"
     variation       584
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200445460"
     variation       586
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:11551002"
     variation       589
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373926480"
     variation       608
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375779576"
     variation       618
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369636374"
     variation       652
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374105478"
     variation       656
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370615323"
     variation       661
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11551000"
     exon            676..809
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /inference="alignment:Splign:1.39.8"
     variation       699
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376987069"
     variation       710
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199660121"
     variation       711
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111419351"
     variation       734
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370111912"
     variation       735
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201024631"
     variation       740
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147904649"
     variation       741
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139935642"
     variation       745
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375567499"
     variation       781
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:145389825"
     variation       786
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147667410"
     variation       794
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:142658251"
     variation       803
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200704183"
     exon            810..988
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /inference="alignment:Splign:1.39.8"
     variation       811
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150267124"
     variation       813
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371660334"
     variation       823
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375123845"
     variation       832
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369442773"
     variation       836
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367773519"
     variation       837
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:188024320"
     variation       842
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145848376"
     variation       864
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148987065"
     variation       884
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:79518176"
     variation       887
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371298427"
     variation       917
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376813918"
     variation       921
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369846598"
     variation       945
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200756165"
     variation       948
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112608328"
     variation       952
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372531049"
     variation       958
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369421258"
     variation       969
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:373409117"
     variation       976
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143738110"
     variation       982
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199883121"
     exon            989..1119
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /inference="alignment:Splign:1.39.8"
     variation       1001
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377568407"
     variation       1060
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371008485"
     variation       1064
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11550993"
     variation       1074
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:230261"
     variation       1086
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150106545"
     variation       1097
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183994174"
     exon            1120..1194
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /inference="alignment:Splign:1.39.8"
     variation       1140
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373682820"
     variation       1154
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:144628787"
     variation       1155
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138515969"
     variation       1181
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200932079"
     exon            1195..1353
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /inference="alignment:Splign:1.39.8"
     variation       1205
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376217167"
     variation       1207
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369275539"
     variation       1235
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201351812"
     variation       1236
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200399471"
     variation       1254
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377257982"
     variation       1275
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201787220"
     variation       1304
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141378715"
     variation       1345
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150801773"
     exon            1354..1482
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /inference="alignment:Splign:1.39.8"
     variation       1355
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368817415"
     variation       1356
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139176114"
     variation       1359
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201735866"
     variation       1378
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149513227"
     variation       1381
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200771936"
     variation       1390
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376367676"
     variation       1395
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2228998"
     variation       1420
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3907232"
     variation       1434
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374217287"
     variation       1437
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:149296980"
     variation       1447
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35358477"
     variation       1474
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367756339"
     exon            1483..1582
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /inference="alignment:Splign:1.39.8"
     variation       1488
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145426865"
     variation       1523
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199987390"
     variation       1536
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368465916"
     variation       1571
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200760118"
     variation       1573
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:35586905"
     variation       1582
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372591248"
     exon            1583..1690
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /inference="alignment:Splign:1.39.8"
     variation       1593
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148721665"
     variation       1651
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142258705"
     variation       1671
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373063120"
     exon            1691..1714
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /inference="alignment:Splign:1.39.8"
     variation       1700
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:199626325"
     exon            1715..1785
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /inference="alignment:Splign:1.39.8"
     variation       1718
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374833360"
     variation       1765
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151326608"
     variation       1781
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368942763"
     exon            1786..1848
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /inference="alignment:Splign:1.39.8"
     variation       1803
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140582408"
     STS             1829..1901
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /standard_name="D1S357E"
                     /db_xref="UniSTS:473117"
     exon            1849..1992
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /inference="alignment:Splign:1.39.8"
     variation       1858
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144442676"
     variation       1878
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371465275"
     variation       1884
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2227909"
     variation       1896
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368985958"
     variation       1911
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376643850"
     variation       1916
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140931671"
     variation       1949
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369697025"
     variation       1955
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144655560"
     variation       1965
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138562956"
     variation       1968
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148829251"
     variation       1976
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143425453"
     variation       1983
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374079392"
     variation       1984
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148071646"
     exon            1993..2447
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /inference="alignment:Splign:1.39.8"
     variation       2001
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188827215"
     variation       2002
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141786487"
     variation       2032
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147200750"
     variation       2046
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368214878"
     STS             2070..2255
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /standard_name="RH66352"
                     /db_xref="UniSTS:6834"
     variation       2083
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373885022"
     variation       2092
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138812813"
     variation       2100
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2871778"
     variation       2129..2130
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:142204084"
     variation       2157..2158
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:35497017"
     variation       2181
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376060353"
     STS             2198..2408
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /standard_name="HSC0VF102"
                     /db_xref="UniSTS:53563"
     STS             2214..2413
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /standard_name="SHGC-4198"
                     /db_xref="UniSTS:62626"
     STS             2232..2432
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /standard_name="D19S237E"
                     /db_xref="UniSTS:44617"
     STS             2296..2408
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /standard_name="D19S237E"
                     /db_xref="UniSTS:147416"
     variation       2317..2320
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace=""
                     /replace="attt"
                     /db_xref="dbSNP:143741403"
     variation       2352
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:192826888"
     variation       2372
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:114782076"
     variation       2378
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148319278"
     variation       2394
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1802912"
     polyA_signal    2421..2426
                     /gene="APLP1"
                     /gene_synonym="APLP"
     variation       2438
                     /gene="APLP1"
                     /gene_synonym="APLP"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:113053391"
     polyA_site      2442
                     /gene="APLP1"
                     /gene_synonym="APLP"
     polyA_site      2447
                     /gene="APLP1"
                     /gene_synonym="APLP"
ORIGIN      
ggggcggggctggcggcgccggcgcagcccgggggcggcgggaggaggaggtggcggcggtggcgctgggagctcctgtcaccgctggggccgggccgggcgggagtgcaggggacgtgagggcgcaagggccgggacatggggcccgccagccccgctgctcgcggtctaagtcgccgcccgggccagccgccgctgccgctgctgctgccactattgctgctgcttctgcgcgcgcagcccgccatcgggagcctggccggtgggagccccggcgcggccgaggccccggggtcggcccaggtggctggactatgcgggcgcctaacccttcaccgggacctgcgcaccggccgctgggaaccagacccacagcgctctcgacgctgtctccgggacccgcagcgcgtgctggagtactgcagacagatgtacccggagctgcagattgcacgtgtggagcaggctacgcaggccatccccatggagcgctggtgcgggggttcccggagcggcagctgcgcccacccccaccaccaggttgtgcccttccgctgcctgcctggtgaatttgtgagtgaggccctgctggtgcctgaaggctgccggttcttgcaccaggagcgcatggaccaatgtgagagttcaacccggaggcatcaggaggcacaggaggcctgcagctcccagggcctcatcctgcacggctcgggcatgctcttaccctgtggctcggatcggttccgtggtgtggagtatgtgtgctgtccccctccagggacccccgacccatctgggacagcagttggtgacccctccacccggtcctggcccccggggagcagagtagagggggctgaggacgaggaagaggaggaatccttcccacagccagtagatgattacttcgtggagcctccgcaggctgaagaggaagaggaaacggtcccacccccaagctcccatacacttgcagtggtcggcaaagtcactcccaccccgaggcccacagacggtgtggatatttactttggcatgcctggggaaatcagtgagcacgaggggttcctgagggccaagatggacctggaggagcgtaggatgcgccagattaatgaggtgatgcgtgaatgggccatggcagacaaccagtccaagaacctgcctaaagccgacagacaggccctgaatgagcacttccagtccattctgcagactctggaggagcaggtgtctggtgagcgacagcgcctggtggaaacccacgccacccgcgtcatcgcccttatcaacgaccagcgccgggctgccttggagggcttcctggcagccctgcaggcagatccgcctcaggcggagcgtgtcctgttggccctgcggcgctacctgcgtgcggagcagaaggaacagaggcacacgctgcgccactaccagcatgtggccgccgtggatcccgagaaggcacagcagatgcgcttccaggtgcatacccaccttcaagtgattgaggagagggtgaatcagagcctgggcctgcttgaccagaacccccacctggctcaggagctgcggccccaaatccaggaactcctccactctgaacacctgggtcccagtgaattggaagcccctgcccctgggggcagcagcgaggacaagggtgggctgcagcctccagattccaaggatgacacccccatgacccttccaaaagggtccacagaacaagatgctgcatcccctgagaaagagaagatgaacccgctggaacagtatgagcgaaaggtgaatgcgtctgttccaaggggtttccctttccactcatcggagattcagagggatgagctggcaccagctgggacaggggtgtcccgtgaggctgtgtcgggtctgctgatcatgggagcgggcggaggctccctcatcgtcctctccatgctgctcctgcgcaggaagaagccctacggggctatcagccatggcgtggtggaggtggaccccatgctgaccctggaggagcagcagctccgcgaactgcagcggcacggctatgagaaccccacttaccgcttcctggaggaacgaccctgacccggcccccttcaccccttcagccgagcccagacctcccctcttcctggagccccagaaccccaactcccagcctagggcagcagggagtcttgaagtgatcatttcacacccttttgtgagacggctggaaattcttatttcccctttccaattccaaaattccatccctaagaattcccagatagtcccagcagcctccccacgtggcacctcctcaccttaatttattttttaagtttatttatggctctttaaggtgaccgccaccttggtcctagtgtctattccctggaattcaccctctcatgtttccctactaacatcccaataaagtcctcttccctaccaggcca
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:333 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:333 -> Molecular function: GO:0008201 [heparin binding] evidence: IEA
            GeneID:333 -> Molecular function: GO:0031694 [alpha-2A adrenergic receptor binding] evidence: IPI
            GeneID:333 -> Molecular function: GO:0031695 [alpha-2B adrenergic receptor binding] evidence: IPI
            GeneID:333 -> Molecular function: GO:0031696 [alpha-2C adrenergic receptor binding] evidence: IPI
            GeneID:333 -> Molecular function: GO:0042802 [identical protein binding] evidence: IPI
            GeneID:333 -> Molecular function: GO:0046914 [transition metal ion binding] evidence: IEA
            GeneID:333 -> Biological process: GO:0006378 [mRNA polyadenylation] evidence: IEA
            GeneID:333 -> Biological process: GO:0006417 [regulation of translation] evidence: IEA
            GeneID:333 -> Biological process: GO:0006897 [endocytosis] evidence: IEA
            GeneID:333 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA
            GeneID:333 -> Biological process: GO:0007155 [cell adhesion] evidence: IEA
            GeneID:333 -> Biological process: GO:0007193 [adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway] evidence: IC
            GeneID:333 -> Biological process: GO:0007399 [nervous system development] evidence: TAS
            GeneID:333 -> Biological process: GO:0009887 [organ morphogenesis] evidence: TAS
            GeneID:333 -> Biological process: GO:0030198 [extracellular matrix organization] evidence: IEA
            GeneID:333 -> Biological process: GO:0030818 [negative regulation of cAMP biosynthetic process] evidence: IDA
            GeneID:333 -> Biological process: GO:0030900 [forebrain development] evidence: IEA
            GeneID:333 -> Biological process: GO:0071874 [cellular response to norepinephrine stimulus] evidence: IDA
            GeneID:333 -> Cellular component: GO:0005604 [basement membrane] evidence: TAS
            GeneID:333 -> Cellular component: GO:0005794 [Golgi apparatus] evidence: IEA
            GeneID:333 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
            GeneID:333 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA
            GeneID:333 -> Cellular component: GO:0048471 [perinuclear region of cytoplasm] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.