Home |
Help |
Advanced search
2024-04-24 17:26:00, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_005018 2115 bp mRNA linear PRI 01-JUL-2013
DEFINITION Homo sapiens programmed cell death 1 (PDCD1), mRNA.
ACCESSION NM_005018
VERSION NM_005018.2 GI:167857791
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2115)
AUTHORS Cheng,X., Veverka,V., Radhakrishnan,A., Waters,L.C., Muskett,F.W.,
Morgan,S.H., Huo,J., Yu,C., Evans,E.J., Leslie,A.J., Griffiths,M.,
Stubberfield,C., Griffin,R., Henry,A.J., Jansson,A., Ladbury,J.E.,
Ikemizu,S., Carr,M.D. and Davis,S.J.
TITLE Structure and interactions of the human programmed cell death 1
receptor
JOURNAL J. Biol. Chem. 288 (17), 11771-11785 (2013)
PUBMED 23417675
REMARK GeneRIF: These findings provide a rigorous structural and
biophysical framework for interpreting the important functions of
PD-1 and reveal that potent inhibitory signaling can be initiated
by weakly interacting receptors.
REFERENCE 2 (bases 1 to 2115)
AUTHORS Takahashi,H., Tomita,N., Sakata,S., Tsuyama,N., Hashimoto,C.,
Ohshima,R., Matsuura,S., Ogawa,K., Yamamoto,W., Kameda,Y.,
Enaka,M., Inayama,Y., Kasahara,M., Takekawa,Y., Onoda,N.,
Motomura,S., Ishigatsubo,Y. and Takeuchi,K.
TITLE Prognostic significance of programmed cell death-1-positive cells
in follicular lymphoma patients may alter in the rituximab era
JOURNAL Eur. J. Haematol. 90 (4), 286-290 (2013)
PUBMED 23331211
REMARK GeneRIF: PD-1 positivity was significantly higher in male
follicular lymphoma patients and patients with high beta-2
microglobulin
REFERENCE 3 (bases 1 to 2115)
AUTHORS Kataoka,T.R., Fujimoto,M., Moriyoshi,K., Koyanagi,I., Ueshima,C.,
Kono,F., Tsuruyama,T., Okayama,Y., Ra,C. and Haga,H.
TITLE PD-1 regulates the growth of human mastocytosis cells
JOURNAL Allergol Int 62 (1), 99-104 (2013)
PUBMED 23267208
REMARK GeneRIF: PD-1 could be a marker for human cutaneous mastocytosis
and regulate the growth of human PD-1-positive mastocytosis cells.
REFERENCE 4 (bases 1 to 2115)
AUTHORS Myklebust,J.H., Irish,J.M., Brody,J., Czerwinski,D.K., Houot,R.,
Kohrt,H.E., Timmerman,J., Said,J., Green,M.R., Delabie,J.,
Kolstad,A., Alizadeh,A.A. and Levy,R.
TITLE High PD-1 expression and suppressed cytokine signaling distinguish
T cells infiltrating follicular lymphoma tumors from peripheral T
cells
JOURNAL Blood 121 (8), 1367-1376 (2013)
PUBMED 23297127
REMARK GeneRIF: Disruption of the microenvironment and in vitro culture of
follicular lymphoma tumor infiltrating T cells could restore
cytokine signaling in the PD-1(hi) subset.
REFERENCE 5 (bases 1 to 2115)
AUTHORS Palmer,B.E., Neff,C.P., Lecureux,J., Ehler,A., Dsouza,M.,
Remling-Mulder,L., Korman,A.J., Fontenot,A.P. and Akkina,R.
TITLE In vivo blockade of the PD-1 receptor suppresses HIV-1 viral loads
and improves CD4+ T cell levels in humanized mice
JOURNAL J. Immunol. 190 (1), 211-219 (2013)
PUBMED 23209326
REMARK GeneRIF: Blockade of the PD-1 pathway reduces human
immunodeficiency virus (HIV)-1 viral loads.
REFERENCE 6 (bases 1 to 2115)
AUTHORS Iwai,Y., Okazaki,T., Nishimura,H., Kawasaki,A., Yagita,H. and
Honjo,T.
TITLE Microanatomical localization of PD-1 in human tonsils
JOURNAL Immunol. Lett. 83 (3), 215-220 (2002)
PUBMED 12095712
REMARK GeneRIF: PD-1 may play an important role in germinal center
reactions
REFERENCE 7 (bases 1 to 2115)
AUTHORS Finger,L.R., Pu,J., Wasserman,R., Vibhakar,R., Louie,E.,
Hardy,R.R., Burrows,P.D. and Billips,L.G.
TITLE The human PD-1 gene: complete cDNA, genomic organization, and
developmentally regulated expression in B cell progenitors
JOURNAL Gene 197 (1-2), 177-187 (1997)
PUBMED 9332365
REMARK Erratum:[Gene 1997 Dec 12;203(2):253]
REFERENCE 8 (bases 1 to 2115)
AUTHORS Vibhakar,R., Juan,G., Traganos,F., Darzynkiewicz,Z. and Finger,L.R.
TITLE Activation-induced expression of human programmed death-1 gene in
T-lymphocytes
JOURNAL Exp. Cell Res. 232 (1), 25-28 (1997)
PUBMED 9141617
REFERENCE 9 (bases 1 to 2115)
AUTHORS Shinohara,T., Taniwaki,M., Ishida,Y., Kawaichi,M. and Honjo,T.
TITLE Structure and chromosomal localization of the human PD-1 gene
(PDCD1)
JOURNAL Genomics 23 (3), 704-706 (1994)
PUBMED 7851902
REFERENCE 10 (bases 1 to 2115)
AUTHORS Ishida,Y., Agata,Y., Shibahara,K. and Honjo,T.
TITLE Induced expression of PD-1, a novel member of the immunoglobulin
gene superfamily, upon programmed cell death
JOURNAL EMBO J. 11 (11), 3887-3895 (1992)
PUBMED 1396582
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from U64863.1, AY238517.1,
CR988122.1 and AI928135.1.
This sequence is a reference standard in the RefSeqGene project.
On Feb 14, 2008 this sequence version replaced gi:4826889.
Summary: This gene encodes a cell surface membrane protein of the
immunoglobulin superfamily. This protein is expressed in
pro-B-cells and is thought to play a role in their differentiation.
In mice, expression of this gene is induced in the thymus when
anti-CD3 antibodies are injected and large numbers of thymocytes
undergo apoptosis. Mice deficient for this gene bred on a BALB/c
background developed dilated cardiomyopathy and died from
congestive heart failure. These studies suggest that this gene
product may also be important in T cell function and contribute to
the prevention of autoimmune diseases. [provided by RefSeq, Jul
2008].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: U64863.1, BC074740.2 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025084, ERS025086 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: full length.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-68 U64863.1 1-68
69-935 AY238517.1 1-867
936-1549 U64863.1 936-1549
1550-1644 U64863.1 1551-1645
1645-2011 CR988122.1 113-479
2012-2107 U64863.1 2011-2106
2108-2115 AI928135.1 1-8 c
FEATURES Location/Qualifiers
source 1..2115
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="2"
/map="2q37.3"
gene 1..2115
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/note="programmed cell death 1"
/db_xref="GeneID:5133"
/db_xref="HGNC:8760"
/db_xref="MIM:600244"
exon 1..144
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/inference="alignment:Splign:1.39.8"
STS 4..1544
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/db_xref="UniSTS:482776"
STS 19..985
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/db_xref="UniSTS:480687"
STS 23..970
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/db_xref="UniSTS:481888"
variation 67
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:55970948"
CDS 69..935
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/note="programmed cell death protein 1; protein PD-1"
/codon_start=1
/product="programmed cell death protein 1 precursor"
/protein_id="NP_005009.2"
/db_xref="GI:167857792"
/db_xref="CCDS:CCDS33428.1"
/db_xref="GeneID:5133"
/db_xref="HGNC:8760"
/db_xref="MIM:600244"
/translation="
MQIPQAPWPVVWAVLQLGWRPGWFLDSPDRPWNPPTFSPALLVVTEGDNATFTCSFSNTSESFVLNWYRMSPSNQTDKLAAFPEDRSQPGQDCRFRVTQLPNGRDFHMSVVRARRNDSGTYLCGAISLAPKAQIKESLRAELRVTERRAEVPTAHPSPSPRPAGQFQTLVVGVVGGLLGSLVLLVWVLAVICSRAARGTIGARRTGQPLKEDPSAVPVFSVDYGELDFQWREKTPEPPVPCVPEQTEYATIVFPSGMGTSSPARRGSADGPRSAQPLRPEDGHCSWPL
"
sig_peptide 69..128
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
mat_peptide 129..932
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/product="programmed cell death protein 1"
misc_feature 192..476
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/note="Immunoglobulin variable domain (IgV); Region: IgV;
cd00099"
/db_xref="CDD:143167"
misc_feature 213..437
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/note="Immunoglobulin V-Type; Region: IGv; smart00406"
/db_xref="CDD:197704"
misc_feature order(234..236,255..257)
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/note="L1 hypervariable region; other site"
/db_xref="CDD:143167"
misc_feature order(255..260,264..266,447..449)
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/note="antigen binding site; other site"
/db_xref="CDD:143167"
misc_feature order(258..260,264..266,270..272,276..278,294..296,
300..302,426..428,432..434,441..443)
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/note="heterodimer interface [polypeptide binding]; other
site"
/db_xref="CDD:143167"
misc_feature 381..383
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/note="L2 hypervariable region; other site"
/db_xref="CDD:143167"
misc_feature order(447..449,474..476)
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/note="L3 hypervariable region; other site"
/db_xref="CDD:143167"
misc_feature 579..641
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q15116.3);
transmembrane region"
exon 145..504
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/inference="alignment:Splign:1.39.8"
variation 151
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:56234260"
variation 173
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="c"
/replace="g"
/db_xref="dbSNP:41444844"
variation 233
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:55993679"
variation 265
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="a"
/replace="c"
/db_xref="dbSNP:28615468"
variation 317
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:55804130"
variation 374
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:55637807"
variation 375
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:56124337"
variation 409
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:55679128"
variation 464
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:41400345"
exon 505..660
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/inference="alignment:Splign:1.39.8"
variation 600
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:55667829"
exon 661..695
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/inference="alignment:Splign:1.39.8"
exon 696..2112
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/inference="alignment:Splign:1.39.8"
STS 711..836
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/standard_name="RH71365"
/db_xref="UniSTS:48877"
variation 712
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2227982"
variation 872
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2227981"
variation 1061
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace=""
/replace="g"
/db_xref="dbSNP:56111033"
variation 1134
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:6749527"
variation 1267..1269
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace=""
/replace="tgc"
/db_xref="dbSNP:56029561"
variation 1269..1270
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace=""
/replace="tgc"
/db_xref="dbSNP:56346736"
variation 1274
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:55844488"
variation 1290
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:41476248"
variation 1294
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:6605259"
variation 1314
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:41492945"
variation 1373
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:55721013"
variation 1391
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:55869797"
variation 1396
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:41414450"
variation 1397
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:6605260"
variation 1405
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:55824589"
STS 1485..2110
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/standard_name="PDCD1_1679"
/db_xref="UniSTS:462388"
variation 1555
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="a"
/replace="t"
/db_xref="dbSNP:41465046"
variation 1698
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:41428445"
variation 1747
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:55676463"
variation 1800
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="c"
/replace="g"
/db_xref="dbSNP:56364125"
variation 1824
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:10204525"
variation 1853
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:56015708"
variation 1883
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="c"
/replace="t"
/db_xref="dbSNP:55704165"
variation 1891
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="a"
/replace="c"
/db_xref="dbSNP:55942126"
variation 1920
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
/replace="a"
/replace="g"
/db_xref="dbSNP:41379345"
polyA_signal 2088..2093
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
polyA_site 2112
/gene="PDCD1"
/gene_synonym="CD279; hPD-1; hPD-l; PD-1; PD1; SLEB2"
ORIGIN
agtttcccttccgctcacctccgcctgagcagtggagaaggcggcactctggtggggctgctccaggcatgcagatcccacaggcgccctggccagtcgtctgggcggtgctacaactgggctggcggccaggatggttcttagactccccagacaggccctggaacccccccaccttctccccagccctgctcgtggtgaccgaaggggacaacgccaccttcacctgcagcttctccaacacatcggagagcttcgtgctaaactggtaccgcatgagccccagcaaccagacggacaagctggccgccttccccgaggaccgcagccagcccggccaggactgccgcttccgtgtcacacaactgcccaacgggcgtgacttccacatgagcgtggtcagggcccggcgcaatgacagcggcacctacctctgtggggccatctccctggcccccaaggcgcagatcaaagagagcctgcgggcagagctcagggtgacagagagaagggcagaagtgcccacagcccaccccagcccctcacccaggccagccggccagttccaaaccctggtggttggtgtcgtgggcggcctgctgggcagcctggtgctgctagtctgggtcctggccgtcatctgctcccgggccgcacgagggacaataggagccaggcgcaccggccagcccctgaaggaggacccctcagccgtgcctgtgttctctgtggactatggggagctggatttccagtggcgagagaagaccccggagccccccgtgccctgtgtccctgagcagacggagtatgccaccattgtctttcctagcggaatgggcacctcatcccccgcccgcaggggctcagctgacggccctcggagtgcccagccactgaggcctgaggatggacactgctcttggcccctctgaccggcttccttggccaccagtgttctgcagaccctccaccatgagcccgggtcagcgcatttcctcaggagaagcaggcagggtgcaggccattgcaggccgtccaggggctgagctgcctgggggcgaccggggctccagcctgcacctgcaccaggcacagccccaccacaggactcatgtctcaatgcccacagtgagcccaggcagcaggtgtcaccgtcccctacagggagggccagatgcagtcactgcttcaggtcctgccagcacagagctgcctgcgtccagctccctgaatctctgctgctgctgctgctgctgctgctgctgcctgcggcccggggctgaaggcgccgtggccctgcctgacgccccggagcctcctgcctgaacttgggggctggttggagatggccttggagcagccaaggtgcccctggcagtggcatcccgaaacgccctggacgcagggcccaagactgggcacaggagtgggaggtacatggggctggggactccccaggagttatctgctccctgcaggcctagagaagtttcagggaaggtcagaagagctcctggctgtggtgggcagggcaggaaacccctccacctttacacatgcccaggcagcacctcaggccctttgtggggcagggaagctgaggcagtaagcgggcaggcagagctggaggcctttcaggcccagccagcactctggcctcctgccgccgcattccaccccagcccctcacaccactcgggagagggacatcctacggtcccaaggtcaggagggcagggctggggttgactcaggcccctcccagctgtggccacctgggtgttgggagggcagaagtgcaggcacctagggccccccatgtgcccaccctgggagctctccttggaacccattcctgaaattatttaaaggggttggccgggctcccaccagggcctgggtgggaaggtacaggcgttcccccggggcctagtacccccgccgtggcctatccactcctcacatccacacactgcacccccactcctggggcagggccaccagcatccaggcggccagcaggcacctgagtggctgggacaagggatcccccttccctgtggttctattatattataattataattaaatatgagagcatgctaaggaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:5133 -> Molecular function: GO:0004871 [signal transducer activity] evidence: TAS
GeneID:5133 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:5133 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA
GeneID:5133 -> Biological process: GO:0006959 [humoral immune response] evidence: TAS
GeneID:5133 -> Biological process: GO:0007165 [signal transduction] evidence: TAS
GeneID:5133 -> Biological process: GO:0007275 [multicellular organismal development] evidence: TAS
GeneID:5133 -> Biological process: GO:0031295 [T cell costimulation] evidence: TAS
GeneID:5133 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS
GeneID:5133 -> Cellular component: GO:0009897 [external side of plasma membrane] evidence: IEA
GeneID:5133 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.