Home |
Help |
Advanced search
2024-04-24 22:04:55, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_004938 5942 bp mRNA linear PRI 08-JUL-2013
DEFINITION Homo sapiens death-associated protein kinase 1 (DAPK1), mRNA.
ACCESSION NM_004938
VERSION NM_004938.2 GI:89363046
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 5942)
AUTHORS Wu,B., Yao,H., Wang,S. and Xu,R.
TITLE DAPK1 modulates a curcumin-induced G2/M arrest and apoptosis by
regulating STAT3, NF-kappaB, and caspase-3 activation
JOURNAL Biochem. Biophys. Res. Commun. 434 (1), 75-80 (2013)
PUBMED 23545262
REMARK GeneRIF: Knockdown of DAPK1 attenuates curcumin-induced inhibition
of STAT3 and NF-kappaB. Moreover, DAPK1 suppression diminishes
curcumin-induced caspase-3 activation.
REFERENCE 2 (bases 1 to 5942)
AUTHORS Bialik,S. and Kimchi,A.
TITLE Biochemical and functional characterization of the ROC domain of
DAPK establishes a new paradigm of GTP regulation in ROCO proteins
JOURNAL Biochem. Soc. Trans. 40 (5), 1052-1057 (2012)
PUBMED 22988864
REMARK GeneRIF: The GTP binding regulates DAPK catalytic activity in a
novel manner by enhancing autophosphorylation on inhibitory Ser308,
thereby promoting the kinase 'off' state.
Review article
REFERENCE 3 (bases 1 to 5942)
AUTHORS Kennedy,R.B., Ovsyannikova,I.G., Pankratz,V.S., Haralambieva,I.H.,
Vierkant,R.A. and Poland,G.A.
TITLE Genome-wide analysis of polymorphisms associated with cytokine
responses in smallpox vaccine recipients
JOURNAL Hum. Genet. 131 (9), 1403-1421 (2012)
PUBMED 22610502
REFERENCE 4 (bases 1 to 5942)
AUTHORS Arisawa,T., Tahara,T., Tsutsumi,M. and Shibata,T.
TITLE Influence of IL17A polymorphisms on the aberrant methylation of
DAPK and CDH1 in non-cancerous gastric mucosa
JOURNAL BMC Med. Genet. 13, 59 (2012)
PUBMED 22827846
REMARK GeneRIF: In the -197 A allele carrier with *1249 CC homozygote of
IL17A, the methylation of DAPK and CDH1 increased gradually, but
more rapidly, with age.
Publication Status: Online-Only
REFERENCE 5 (bases 1 to 5942)
AUTHORS Tedde,A., Piaceri,I., Bagnoli,S., Lucenteforte,E., Piacentini,S.,
Sorbi,S. and Nacmias,B.
TITLE DAPK1 is associated with FTD and not with Alzheimer's disease
JOURNAL J. Alzheimers Dis. 32 (1), 13-17 (2012)
PUBMED 22785394
REMARK GeneRIF: We showed a positive association between rs4878104 and
frontotemporal dementia , suggesting a possible implication of the
DAPK1 genetic variant in the susceptibility to frontotemporal
dementia
REFERENCE 6 (bases 1 to 5942)
AUTHORS Shohat,G., Spivak-Kroizman,T., Cohen,O., Bialik,S., Shani,G.,
Berrisi,H., Eisenstein,M. and Kimchi,A.
TITLE The pro-apoptotic function of death-associated protein kinase is
controlled by a unique inhibitory autophosphorylation-based
mechanism
JOURNAL J. Biol. Chem. 276 (50), 47460-47467 (2001)
PUBMED 11579085
REFERENCE 7 (bases 1 to 5942)
AUTHORS Jin,Y., Blue,E.K., Dixon,S., Hou,L., Wysolmerski,R.B. and
Gallagher,P.J.
TITLE Identification of a new form of death-associated protein kinase
that promotes cell survival
JOURNAL J. Biol. Chem. 276 (43), 39667-39678 (2001)
PUBMED 11485996
REFERENCE 8 (bases 1 to 5942)
AUTHORS Inbal,B., Shani,G., Cohen,O., Kissil,J.L. and Kimchi,A.
TITLE Death-associated protein kinase-related protein 1, a novel
serine/threonine kinase involved in apoptosis
JOURNAL Mol. Cell. Biol. 20 (3), 1044-1054 (2000)
PUBMED 10629061
REFERENCE 9 (bases 1 to 5942)
AUTHORS Feinstein,E., Druck,T., Kastury,K., Berissi,H., Goodart,S.A.,
Overhauser,J., Kimchi,A. and Huebner,K.
TITLE Assignment of DAP1 and DAPK--genes that positively mediate
programmed cell death triggered by IFN-gamma--to chromosome regions
5p12.2 and 9q34.1, respectively
JOURNAL Genomics 29 (1), 305-307 (1995)
PUBMED 8530096
REFERENCE 10 (bases 1 to 5942)
AUTHORS Deiss,L.P., Feinstein,E., Berissi,H., Cohen,O. and Kimchi,A.
TITLE Identification of a novel serine/threonine kinase and a novel 15-kD
protein as potential mediators of the gamma interferon-induced cell
death
JOURNAL Genes Dev. 9 (1), 15-30 (1995)
PUBMED 7828849
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from DA887235.1, AB208871.1,
AL160279.21 and AA846231.1.
This sequence is a reference standard in the RefSeqGene project.
On Mar 10, 2006 this sequence version replaced gi:4826683.
Summary: Death-associated protein kinase 1 is a positive mediator
of gamma-interferon induced programmed cell death. DAPK1 encodes a
structurally unique 160-kD calmodulin dependent serine-threonine
kinase that carries 8 ankyrin repeats and 2 putative P-loop
consensus sites. It is a tumor suppressor candidate. [provided by
RefSeq, Jul 2008].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AK295119.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025081, ERS025082 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-437 DA887235.1 4-440
438-4411 AB208871.1 201-4174
4412-5918 AL160279.21 67283-68789
5919-5942 AA846231.1 1-24 c
FEATURES Location/Qualifiers
source 1..5942
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="9"
/map="9q21.33"
gene 1..5942
/gene="DAPK1"
/gene_synonym="DAPK"
/note="death-associated protein kinase 1"
/db_xref="GeneID:1612"
/db_xref="HGNC:2674"
/db_xref="MIM:600831"
exon 1..267
/gene="DAPK1"
/gene_synonym="DAPK"
/inference="alignment:Splign:1.39.8"
variation 34
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="c"
/db_xref="dbSNP:370041930"
variation 125
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:36228007"
variation 138
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:2302791"
variation 154
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="g"
/db_xref="dbSNP:377011195"
variation 186
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:17515986"
exon 268..437
/gene="DAPK1"
/gene_synonym="DAPK"
/inference="alignment:Splign:1.39.8"
variation 295
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:377045692"
variation 333
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="g"
/db_xref="dbSNP:376427274"
variation 346
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="g"
/db_xref="dbSNP:370887788"
variation 360
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:36228013"
misc_feature 364..366
/gene="DAPK1"
/gene_synonym="DAPK"
/note="upstream in-frame stop codon"
CDS 376..4668
/gene="DAPK1"
/gene_synonym="DAPK"
/EC_number="2.7.11.1"
/note="DAP kinase 1"
/codon_start=1
/product="death-associated protein kinase 1"
/protein_id="NP_004929.2"
/db_xref="GI:89363047"
/db_xref="CCDS:CCDS43842.1"
/db_xref="GeneID:1612"
/db_xref="HGNC:2674"
/db_xref="MIM:600831"
/translation="
MTVFRQENVDDYYDTGEELGSGQFAVVKKCREKSTGLQYAAKFIKKRRTKSSRRGVSREDIEREVSILKEIQHPNVITLHEVYENKTDVILILELVAGGELFDFLAEKESLTEEEATEFLKQILNGVYYLHSLQIAHFDLKPENIMLLDRNVPKPRIKIIDFGLAHKIDFGNEFKNIFGTPEFVAPEIVNYEPLGLEADMWSIGVITYILLSGASPFLGDTKQETLANVSAVNYEFEDEYFSNTSALAKDFIRRLLVKDPKKRMTIQDSLQHPWIKPKDTQQALSRKASAVNMEKFKKFAARKKWKQSVRLISLCQRLSRSFLSRSNMSVARSDDTLDEEDSFVMKAIIHAINDDNVPGLQHLLGSLSNYDVNQPNKHGTPPLLIAAGCGNIQILQLLIKRGSRIDVQDKGGSNAVYWAARHGHVDTLKFLSENKCPLDVKDKSGEMALHVAARYGHADVAQLLCSFGSNPNIQDKEEETPLHCAAWHGYYSVAKALCEAGCNVNIKNREGETPLLTASARGYHDIVECLAEHGADLNACDKDGHIALHLAVRRCQMEVIKTLLSQGCFVDYQDRHGNTPLHVACKDGNMPIVVALCEANCNLDISNKYGRTPLHLAANNGILDVVRYLCLMGASVEALTTDGKTAEDLARSEQHEHVAGLLARLRKDTHRGLFIQQLRPTQNLQPRIKLKLFGHSGSGKTTLVESLKCGLLRSFFRRRRPRLSSTNSSRFPPSPLASKPTVSVSINNLYPGCENVSVRSRSMMFEPGLTKGMLEVFVAPTHHPHCSADDQSTKAIDIQNAYLNGVGDFSVWEFSGNPVYFCCYDYFAANDPTSIHVVVFSLEEPYEIQLNQVIFWLSFLKSLVPVEEPIAFGGKLKNPLQVVLVATHADIMNVPRPAGGEFGYDKDTSLLKEIRNRFGNDLHISNKLFVLDAGASGSKDMKVLRNHLQEIRSQIVSVCPPMTHLCEKIISTLPSWRKLNGPNQLMSLQQFVYDVQDQLNPLASEEDLRRIAQQLHSTGEINIMQSETVQDVLLLDPRWLCTNVLGKLLSVETPRALHHYRGRYTVEDIQRLVPDSDVEELLQILDAMDICARDLSSGTMVDVPALIKTDNLHRSWADEEDEVMVYGGVRIVPVEHLTPFPCGIFHKVQVNLCRWIHQQSTEGDADIRLWVNGCKLANRGAELLVLLVNHGQGIEVQVRGLETEKIKCCLLLDSVCSTIENVMATTLPGLLTVKHYLSPQQLREHHEPVMIYQPRDFFRAQTLKETSLTNTMGGYKESFSSIMCFGCHDVYSQASLGMDIHASDLNLLTRRKLSRLLDPPDPLGKDWCLLAMNLGLPDLVAKYNTSNGAPKDFLPSPLHALLREWTTYPESTVGTLMSKLRELGRRDAADFLLKASSVFKINLDGNGQEAYASSCNSGTSYNSISSVVSR
"
misc_feature 412..1200
/gene="DAPK1"
/gene_synonym="DAPK"
/note="Serine/Threonine protein kinases, catalytic domain;
Region: S_TKc; smart00220"
/db_xref="CDD:197582"
misc_feature 412..1197
/gene="DAPK1"
/gene_synonym="DAPK"
/note="Protein Kinases, catalytic domain; Region:
PKc_like; cl09925"
/db_xref="CDD:213116"
misc_feature order(430..444,454..456,493..495,499..501,604..606,
652..663,673..675,679..681,790..792,796..798,802..807,
814..816,856..858,865..867,910..921)
/gene="DAPK1"
/gene_synonym="DAPK"
/note="active site"
/db_xref="CDD:173623"
misc_feature order(430..444,454..456,493..495,499..501,604..606,
652..663,673..675,790..792,796..798,802..807,814..816,
856..858)
/gene="DAPK1"
/gene_synonym="DAPK"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:173623"
misc_feature order(442..444,673..675,679..681,790..792,796..798,
802..804,865..867,910..921)
/gene="DAPK1"
/gene_synonym="DAPK"
/note="substrate binding site [chemical binding]; other
site"
/db_xref="CDD:173623"
misc_feature order(853..870,910..921)
/gene="DAPK1"
/gene_synonym="DAPK"
/note="activation loop (A-loop); other site"
/db_xref="CDD:173623"
misc_feature 1174..1377
/gene="DAPK1"
/gene_synonym="DAPK"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P53355.6);
Region: Calmodulin-binding"
misc_feature 1240..1242
/gene="DAPK1"
/gene_synonym="DAPK"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by RPS6KA1 and RPS6KA3; propagated
from UniProtKB/Swiss-Prot (P53355.6); phosphorylation
site"
misc_feature 1249..1278
/gene="DAPK1"
/gene_synonym="DAPK"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (P53355.6);
Region: Autoinhibitory domain (By similarity)"
misc_feature 1297..1299
/gene="DAPK1"
/gene_synonym="DAPK"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by autocatalysis; propagated from
UniProtKB/Swiss-Prot (P53355.6); phosphorylation site"
misc_feature 1297..1299
/gene="DAPK1"
/gene_synonym="DAPK"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/citation=[6]
/db_xref="HPRD:02902"
misc_feature 1372..1374
/gene="DAPK1"
/gene_synonym="DAPK"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P53355.6); phosphorylation site"
misc_feature 1414..1572
/gene="DAPK1"
/gene_synonym="DAPK"
/note="Ankyrin repeats (many copies); Region: Ank_4;
pfam13637"
/db_xref="CDD:205814"
misc_feature 1492..1866
/gene="DAPK1"
/gene_synonym="DAPK"
/note="ankyrin repeats; ankyrin repeats mediate
protein-protein interactions in very diverse families of
proteins. The number of ANK repeats in a protein can range
from 2 to over 20 (ankyrins, for example). ANK repeats may
occur in combinations with other...; Region: ANK; cd00204"
/db_xref="CDD:29261"
misc_feature 1507..1596
/gene="DAPK1"
/gene_synonym="DAPK"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P53355.6);
Region: ANK 1"
misc_feature 1522..1800
/gene="DAPK1"
/gene_synonym="DAPK"
/note="Ankyrin repeats (3 copies); Region: Ank_2;
pfam12796"
/db_xref="CDD:205076"
misc_feature 1606..1695
/gene="DAPK1"
/gene_synonym="DAPK"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P53355.6);
Region: ANK 2"
misc_feature 1690..2067
/gene="DAPK1"
/gene_synonym="DAPK"
/note="ankyrin repeats; ankyrin repeats mediate
protein-protein interactions in very diverse families of
proteins. The number of ANK repeats in a protein can range
from 2 to over 20 (ankyrins, for example). ANK repeats may
occur in combinations with other...; Region: ANK; cd00204"
/db_xref="CDD:29261"
misc_feature 1705..1794
/gene="DAPK1"
/gene_synonym="DAPK"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P53355.6);
Region: ANK 3"
misc_feature 1720..1998
/gene="DAPK1"
/gene_synonym="DAPK"
/note="Ankyrin repeats (3 copies); Region: Ank_2;
pfam12796"
/db_xref="CDD:205076"
misc_feature 1804..1893
/gene="DAPK1"
/gene_synonym="DAPK"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P53355.6);
Region: ANK 4"
misc_feature 1888..2262
/gene="DAPK1"
/gene_synonym="DAPK"
/note="ankyrin repeats; ankyrin repeats mediate
protein-protein interactions in very diverse families of
proteins. The number of ANK repeats in a protein can range
from 2 to over 20 (ankyrins, for example). ANK repeats may
occur in combinations with other...; Region: ANK; cd00204"
/db_xref="CDD:29261"
misc_feature 1903..1992
/gene="DAPK1"
/gene_synonym="DAPK"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P53355.6);
Region: ANK 5"
misc_feature 1918..2196
/gene="DAPK1"
/gene_synonym="DAPK"
/note="Ankyrin repeats (3 copies); Region: Ank_2;
pfam12796"
/db_xref="CDD:205076"
misc_feature 2002..2091
/gene="DAPK1"
/gene_synonym="DAPK"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P53355.6);
Region: ANK 6"
misc_feature 2101..2190
/gene="DAPK1"
/gene_synonym="DAPK"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P53355.6);
Region: ANK 7"
misc_feature 2116..2379
/gene="DAPK1"
/gene_synonym="DAPK"
/note="Ankyrin repeats (3 copies); Region: Ank_2;
pfam12796"
/db_xref="CDD:205076"
misc_feature 2200..2289
/gene="DAPK1"
/gene_synonym="DAPK"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P53355.6);
Region: ANK 8"
misc_feature 2449..>2496
/gene="DAPK1"
/gene_synonym="DAPK"
/note="P-loop containing Nucleoside Triphosphate
Hydrolases; Region: P-loop_NTPase; cl09099"
/db_xref="CDD:213113"
misc_feature 2455..2478
/gene="DAPK1"
/gene_synonym="DAPK"
/note="G1 box; other site"
/db_xref="CDD:206648"
misc_feature 2461..2481
/gene="DAPK1"
/gene_synonym="DAPK"
/note="GTP/Mg2+ binding site [chemical binding]; other
site"
/db_xref="CDD:206648"
misc_feature 2575..2577
/gene="DAPK1"
/gene_synonym="DAPK"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by MAPK1; propagated from
UniProtKB/Swiss-Prot (P53355.6); phosphorylation site"
misc_feature 2575..2577
/gene="DAPK1"
/gene_synonym="DAPK"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:01496"
misc_feature 2740..>3045
/gene="DAPK1"
/gene_synonym="DAPK"
/note="P-loop containing Nucleoside Triphosphate
Hydrolases; Region: P-loop_NTPase; cl09099"
/db_xref="CDD:213113"
misc_feature 2752..2754
/gene="DAPK1"
/gene_synonym="DAPK"
/note="G2 box; other site"
/db_xref="CDD:206648"
misc_feature 2764..2772
/gene="DAPK1"
/gene_synonym="DAPK"
/note="Switch I region; other site"
/db_xref="CDD:206648"
misc_feature 2812..2823
/gene="DAPK1"
/gene_synonym="DAPK"
/note="G3 box; other site"
/db_xref="CDD:206648"
misc_feature order(2818..2823,2875..2880)
/gene="DAPK1"
/gene_synonym="DAPK"
/note="Switch II region; other site"
/db_xref="CDD:206648"
misc_feature 2998..3087
/gene="DAPK1"
/gene_synonym="DAPK"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P53355.6);
Region: ANK 9"
misc_feature 3034..3045
/gene="DAPK1"
/gene_synonym="DAPK"
/note="G4 box; other site"
/db_xref="CDD:206648"
misc_feature 3859..3963
/gene="DAPK1"
/gene_synonym="DAPK"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P53355.6);
Region: ANK 10"
misc_feature 4297..4554
/gene="DAPK1"
/gene_synonym="DAPK"
/note="Death domain found in death-associated protein
kinase 1; Region: Death_DAPK1; cd08782"
/db_xref="CDD:176760"
variation 408
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:200015695"
variation 420
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="g"
/db_xref="dbSNP:374553824"
exon 438..659
/gene="DAPK1"
/gene_synonym="DAPK"
/inference="alignment:Splign:1.39.8"
variation 489
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:36207428"
variation 494
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:371793443"
variation 495
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:374777068"
variation 500
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="t"
/db_xref="dbSNP:368830486"
variation 515
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:372627035"
variation 522
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="g"
/replace="t"
/db_xref="dbSNP:200192051"
variation 525
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:370639005"
variation 548
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="g"
/replace="t"
/db_xref="dbSNP:375169492"
variation 549
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:200958656"
variation 615
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:36207429"
variation 639
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:373110876"
variation 645
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:376105560"
variation 657
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:372830870"
exon 660..798
/gene="DAPK1"
/gene_synonym="DAPK"
/inference="alignment:Splign:1.39.8"
variation 660
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:201644916"
variation 661
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="g"
/replace="t"
/db_xref="dbSNP:200255856"
variation 716
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:199670912"
variation 720
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:368493768"
variation 741
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:36211019"
variation 753
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="g"
/replace="t"
/db_xref="dbSNP:3898184"
variation 756
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="g"
/replace="t"
/db_xref="dbSNP:3898307"
variation 768
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:55800264"
variation 770
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="g"
/db_xref="dbSNP:367617639"
exon 799..928
/gene="DAPK1"
/gene_synonym="DAPK"
/inference="alignment:Splign:1.39.8"
variation 811
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:201432702"
variation 861
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:56314733"
variation 882
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="g"
/db_xref="dbSNP:369801129"
exon 929..977
/gene="DAPK1"
/gene_synonym="DAPK"
/inference="alignment:Splign:1.39.8"
variation 957
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:36211352"
variation 960..961
/gene="DAPK1"
/gene_synonym="DAPK"
/replace=""
/replace="c"
/db_xref="dbSNP:35364770"
exon 978..1004
/gene="DAPK1"
/gene_synonym="DAPK"
/inference="alignment:Splign:1.39.8"
exon 1005..1157
/gene="DAPK1"
/gene_synonym="DAPK"
/inference="alignment:Splign:1.39.8"
variation 1037
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:376671813"
variation 1054
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:201433003"
variation 1062
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:375173208"
variation 1065
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:375235737"
variation 1073
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:371685332"
exon 1158..1203
/gene="DAPK1"
/gene_synonym="DAPK"
/inference="alignment:Splign:1.39.8"
variation 1166
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="g"
/replace="t"
/db_xref="dbSNP:374914503"
exon 1204..1293
/gene="DAPK1"
/gene_synonym="DAPK"
/inference="alignment:Splign:1.39.8"
variation 1221
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:377546052"
variation 1269
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="g"
/replace="t"
/db_xref="dbSNP:200137928"
exon 1294..1386
/gene="DAPK1"
/gene_synonym="DAPK"
/inference="alignment:Splign:1.39.8"
variation 1296
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:375291251"
variation 1300
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:376057398"
variation 1357
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:370466694"
exon 1387..1506
/gene="DAPK1"
/gene_synonym="DAPK"
/inference="alignment:Splign:1.39.8"
exon 1507..1605
/gene="DAPK1"
/gene_synonym="DAPK"
/inference="alignment:Splign:1.39.8"
variation 1527
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:374473148"
variation 1584
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:17053276"
variation 1587
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="c"
/db_xref="dbSNP:369627206"
variation 1591
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:185766001"
variation 1598
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:373587396"
exon 1606..1704
/gene="DAPK1"
/gene_synonym="DAPK"
/inference="alignment:Splign:1.39.8"
variation 1621
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:12343465"
variation 1650
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:55637131"
variation 1668
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:36213062"
variation 1681
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="g"
/replace="t"
/db_xref="dbSNP:373942313"
variation 1693
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="g"
/db_xref="dbSNP:75637952"
exon 1705..1803
/gene="DAPK1"
/gene_synonym="DAPK"
/inference="alignment:Splign:1.39.8"
variation 1725
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:375721291"
variation 1753
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:200758451"
exon 1804..2001
/gene="DAPK1"
/gene_synonym="DAPK"
/inference="alignment:Splign:1.39.8"
variation 1868
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="g"
/replace="t"
/db_xref="dbSNP:373725255"
variation 1876
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:200488258"
variation 1877
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:375226122"
variation 1884
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:199929327"
variation 1885
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:372895478"
variation 1893
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="g"
/db_xref="dbSNP:375621531"
variation 1900
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:202015930"
variation 1901
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:370217634"
variation 1914
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:201798288"
variation 1933
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="g"
/replace="t"
/db_xref="dbSNP:56284867"
variation 1953
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:376519149"
variation 1969
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:370724837"
variation 1973
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:375380007"
variation 1983
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:3818584"
variation 1994
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:56327474"
exon 2002..2199
/gene="DAPK1"
/gene_synonym="DAPK"
/inference="alignment:Splign:1.39.8"
variation 2004
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="g"
/db_xref="dbSNP:371746705"
variation 2005
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:200262418"
variation 2009
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="t"
/db_xref="dbSNP:138098988"
variation 2066
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="t"
/db_xref="dbSNP:377212180"
variation 2081
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:202159650"
variation 2086
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:199940257"
variation 2091
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:371985981"
variation 2094
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:199637259"
variation 2100
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:376309900"
variation 2104
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:369647209"
variation 2124
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:201506588"
variation 2147
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:36214022"
variation 2151
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:373276227"
variation 2187
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:36214023"
exon 2200..2298
/gene="DAPK1"
/gene_synonym="DAPK"
/inference="alignment:Splign:1.39.8"
variation 2211
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:377278265"
variation 2223
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:199698393"
variation 2225
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:143161576"
variation 2241
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="g"
/db_xref="dbSNP:36215047"
variation 2248
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:117269616"
variation 2255
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:202110666"
variation 2298
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:370262598"
exon 2299..2376
/gene="DAPK1"
/gene_synonym="DAPK"
/inference="alignment:Splign:1.39.8"
variation 2301
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:3750538"
variation 2309
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:199838944"
variation 2346
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:36216399"
variation 2347
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="g"
/replace="t"
/db_xref="dbSNP:55994363"
variation 2372
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:369031259"
exon 2377..2599
/gene="DAPK1"
/gene_synonym="DAPK"
/inference="alignment:Splign:1.39.8"
variation 2382
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:374257586"
variation 2387
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:377550728"
variation 2391
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:36217791"
variation 2435
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="g"
/replace="t"
/db_xref="dbSNP:375984602"
variation 2441
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:185538592"
variation 2469
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:370481138"
variation 2486
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:111297093"
variation 2487
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:375297962"
variation 2490
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:7038638"
variation 2561
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:61730112"
variation 2562
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:199956274"
variation 2588
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:188391159"
exon 2600..2788
/gene="DAPK1"
/gene_synonym="DAPK"
/inference="alignment:Splign:1.39.8"
variation 2676
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:371530974"
variation 2689
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:374989008"
variation 2726
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:199578559"
variation 2735
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:369065084"
variation 2739
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:201590228"
variation 2741
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:371503196"
variation 2766
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="c"
/db_xref="dbSNP:376699283"
exon 2789..2986
/gene="DAPK1"
/gene_synonym="DAPK"
/inference="alignment:Splign:1.39.8"
variation 2857
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="c"
/db_xref="dbSNP:77594522"
variation 2862
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="c"
/db_xref="dbSNP:200646173"
variation 2944
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:369653085"
variation 2947
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:373622506"
variation 2952
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:376600898"
variation 2968
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:370372612"
variation 2971
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="g"
/replace="t"
/db_xref="dbSNP:201282589"
exon 2987..3125
/gene="DAPK1"
/gene_synonym="DAPK"
/inference="alignment:Splign:1.39.8"
variation 2987
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:201550394"
variation 2992
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:368259645"
variation 3009
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:372000773"
variation 3039
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:199931949"
variation 3046
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:374659806"
variation 3054
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="g"
/replace="t"
/db_xref="dbSNP:142092748"
variation 3065
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:368182132"
variation 3102
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:371785798"
exon 3126..3246
/gene="DAPK1"
/gene_synonym="DAPK"
/inference="alignment:Splign:1.39.8"
variation 3152
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:374262081"
variation 3207
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="g"
/replace="t"
/db_xref="dbSNP:376125470"
variation 3245
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:201983425"
variation 3246
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:373383983"
exon 3247..3435
/gene="DAPK1"
/gene_synonym="DAPK"
/inference="alignment:Splign:1.39.8"
variation 3267
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:376506238"
variation 3291
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:370713535"
variation 3313
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="t"
/db_xref="dbSNP:374406913"
variation 3336
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:368477899"
variation 3342
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="g"
/db_xref="dbSNP:370380903"
variation 3351
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="g"
/replace="t"
/db_xref="dbSNP:149620252"
variation 3358
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:201359193"
variation 3387
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:369691220"
variation 3388
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:367611824"
variation 3403
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:371784492"
variation 3404
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:377225421"
variation 3432
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="c"
/db_xref="dbSNP:368659107"
exon 3436..5938
/gene="DAPK1"
/gene_synonym="DAPK"
/inference="alignment:Splign:1.39.8"
variation 3452
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="g"
/db_xref="dbSNP:199587488"
variation 3468
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:371818389"
variation 3480
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="g"
/db_xref="dbSNP:376214759"
variation 3504
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:36220444"
variation 3505
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:201573412"
variation 3525
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:36220445"
variation 3526
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:368803870"
variation 3538
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:370890284"
variation 3542
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:373945195"
variation 3543
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:193150601"
variation 3556
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:371272256"
variation 3571
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:200178571"
variation 3597
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:377600437"
variation 3601
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:201236005"
variation 3648
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:375370588"
variation 3649
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:199730400"
variation 3682
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:200627640"
variation 3693
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:199954255"
variation 3716
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:375598719"
variation 3730..3732
/gene="DAPK1"
/gene_synonym="DAPK"
/replace=""
/replace="gag"
/db_xref="dbSNP:373208080"
variation 3759
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:116652186"
variation 3852
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="c"
/db_xref="dbSNP:111563187"
variation 3863
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:372546766"
variation 3869
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:201991862"
variation 3876
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:201316069"
variation 3877
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:374924377"
variation 3903
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:369362660"
variation 3918
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:112264335"
variation 3933
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="g"
/db_xref="dbSNP:36220446"
variation 3972
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:3118863"
STS 3981..4190
/gene="DAPK1"
/gene_synonym="DAPK"
/standard_name="DAPK1"
/db_xref="UniSTS:505968"
variation 4016
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:185610007"
variation 4049
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="g"
/db_xref="dbSNP:377542947"
variation 4053
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:202069940"
variation 4062
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="g"
/replace="t"
/db_xref="dbSNP:376368602"
variation 4103
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:373759742"
variation 4120
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:377648883"
variation 4191
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="g"
/replace="t"
/db_xref="dbSNP:56169226"
variation 4193
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="g"
/replace="t"
/db_xref="dbSNP:202163821"
variation 4223
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:375308776"
variation 4230
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:200111269"
variation 4239
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:201377316"
variation 4243
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:202187758"
variation 4251
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:36220448"
variation 4263
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:368955480"
variation 4281
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:79223882"
variation 4303
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:371992448"
variation 4310
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:374150775"
variation 4319
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:368364961"
variation 4332
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:200815823"
variation 4374
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:374997011"
variation 4406
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="c"
/db_xref="dbSNP:200345598"
variation 4412
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:1056719"
variation 4416
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:55790757"
variation 4418
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="g"
/replace="t"
/db_xref="dbSNP:200514264"
variation 4434
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:373446864"
variation 4452
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:377618349"
variation 4506
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:369644964"
variation 4546
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:1064221"
variation 4589
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="g"
/replace="t"
/db_xref="dbSNP:36220450"
variation 4614
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="g"
/replace="t"
/db_xref="dbSNP:377592455"
variation 4687
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:1064222"
variation 4711
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="g"
/db_xref="dbSNP:1064223"
STS 4726..4846
/gene="DAPK1"
/gene_synonym="DAPK"
/standard_name="D9S2045"
/db_xref="UniSTS:13338"
variation 4894
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:141937394"
variation 5099
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="g"
/replace="t"
/db_xref="dbSNP:1064224"
variation 5157
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:180748569"
variation 5256
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:150673700"
variation 5277
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:3118864"
variation 5358
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:7868357"
variation 5442
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:137979403"
STS 5446..5592
/gene="DAPK1"
/gene_synonym="DAPK"
/standard_name="STS-X76104"
/db_xref="UniSTS:51017"
variation 5472
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:188482285"
variation 5482
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="c"
/db_xref="dbSNP:181966635"
variation 5537
/gene="DAPK1"
/gene_synonym="DAPK"
/replace=""
/replace="a"
/db_xref="dbSNP:374287026"
variation 5599
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="g"
/replace="t"
/db_xref="dbSNP:149494142"
variation 5609
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:13283425"
variation 5643
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:11141950"
STS 5694..5934
/gene="DAPK1"
/gene_synonym="DAPK"
/standard_name="SHGC-2351"
/db_xref="UniSTS:46760"
variation 5724
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="g"
/replace="t"
/db_xref="dbSNP:186933515"
variation 5777
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:145971748"
variation 5810..5811
/gene="DAPK1"
/gene_synonym="DAPK"
/replace=""
/replace="ta"
/db_xref="dbSNP:147884014"
variation 5881
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="a"
/replace="g"
/db_xref="dbSNP:36220453"
variation 5890..5893
/gene="DAPK1"
/gene_synonym="DAPK"
/replace=""
/replace="ttgt"
/db_xref="dbSNP:138901994"
variation 5895
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="c"
/replace="t"
/db_xref="dbSNP:182225558"
variation 5896
/gene="DAPK1"
/gene_synonym="DAPK"
/replace="g"
/replace="t"
/db_xref="dbSNP:36220734"
variation 5897
/gene="DAPK1"
/gene_synonym="DAPK"
/replace=""
/replace="t"
/db_xref="dbSNP:200951613"
variation 5904..5905
/gene="DAPK1"
/gene_synonym="DAPK"
/replace=""
/replace="t"
/db_xref="dbSNP:71968032"
ORIGIN
aaaaggcggcaaggagccgagaggctgcttcggagtgtgaggaggacagccggaccgagccaacgccggggactttgttccctccgcggaggggactcggcaactcgcagcggcagggtctggggccggcgcctgggagggatctgcgccccccactcactccctagctgtgttcccgccgccgccccggctagtctccggcgctggcgcctatggtcggcctccgacagcgctccggagggaccgggggagctcccaggcgcccgggactggagactgatgcatgagggggctacggaggcgcaggagcggtggtgatggtctgggaagcggagctgaagtgccctgggctttggtgaggcgtgacagtttatcatgaccgtgttcaggcaggaaaacgtggatgattactacgacaccggcgaggaacttggcagtggacagtttgcggttgtgaagaaatgccgtgagaaaagcaccggcctccagtatgccgccaaattcatcaagaaaaggaggactaagtccagccggcggggtgtgagccgcgaggacatcgagcgggaggtcagcatcctgaaggagatccagcaccccaatgtcatcaccctgcacgaggtctatgagaacaagacggacgtcatcctgatcttggaactcgttgcaggtggcgagctgtttgacttcttagctgaaaaggaatctttaactgaagaggaagcaactgaatttctcaaacaaattcttaatggtgtttactacctgcactcccttcaaatcgcccactttgatcttaagcctgagaacataatgcttttggatagaaatgtccccaaacctcggatcaagatcattgactttgggttggcccataaaattgactttggaaatgaatttaaaaacatatttgggactccagagtttgtcgctcctgagatagtcaactatgaacctcttggtcttgaggcagatatgtggagtatcggggtaataacctatatcctcctaagtggggcctccccatttcttggagacactaagcaagaaacgttagcaaatgtatccgctgtcaactacgaatttgaggatgaatacttcagtaataccagtgccctagccaaagatttcataagaagacttctggtcaaggatccaaagaagagaatgacaattcaagatagtttgcagcatccctggatcaagcctaaagatacacaacaggcacttagtagaaaagcatcagcagtaaacatggagaaattcaagaagtttgcagcccggaaaaaatggaaacaatccgttcgcttgatatcactgtgccaaagattatccaggtcattcctgtccagaagtaacatgagtgttgccagaagcgatgatactctggatgaggaagactcctttgtgatgaaagccatcatccatgccatcaacgatgacaatgtcccaggcctgcagcaccttctgggctcattatccaactatgatgttaaccaacccaacaagcacgggacacctccattactcattgctgctggctgtgggaatattcaaatactacagttgctcattaaaagaggctcgagaatcgatgtccaggataagggcgggtccaatgccgtctactgggctgctcggcatggccacgtcgataccttgaaatttctcagtgagaacaaatgccctttggatgtgaaagacaagtctggagagatggccctccacgtggcagctcgctatggccatgctgacgtggctcagttactgtgcagcttcggctcaaatcccaatatccaggacaaggaagaagaaacccccctgcactgtgctgcttggcacggctattactctgtggccaaagccctttgtgaagccggctgtaacgtgaacatcaagaaccgagaaggagagacgcccctcctgacagcctctgccaggggctaccacgacatcgtggagtgtctggccgaacatggagccgaccttaatgcttgcgacaaggacggacacattgcccttcatctggctgtaagacggtgtcagatggaggtaatcaagactctcctcagccaagggtgtttcgtcgattatcaagacaggcacggcaatactcccctccatgtggcatgtaaagatggcaacatgcctatcgtggtggccctctgtgaagcaaactgcaatttggacatctccaacaagtatgggcgaacgcctctgcaccttgcggccaacaacggaatcctagacgtggtccggtatctctgtctgatgggagccagcgttgaggcgctgaccacggacggaaagacggcagaagatcttgctagatcggaacagcacgagcacgtagcaggtctccttgcaagacttcgaaaggatacgcaccgaggactcttcatccagcagctccgacccacacagaacctgcagccaagaattaagctcaagctgtttggccactcgggatccgggaaaaccacccttgtagaatctctcaagtgtgggctgctgaggagctttttcagaaggcgtcggcccagactgtcttccaccaactccagcaggttcccaccttcacccctggcttctaagcccacagtctcagtgagcatcaacaacctgtacccaggctgcgagaacgtgagtgtgaggagccgcagcatgatgttcgagccgggtcttaccaaagggatgctggaggtgtttgtggccccgacccaccacccgcactgctcggccgatgaccagtccaccaaggccatcgacatccagaacgcttatttgaatggagttggcgatttcagcgtgtgggagttctctggaaatcctgtgtatttctgctgttatgactattttgctgcaaatgatcccacgtcaatccatgttgttgtctttagtctagaagagccctatgagatccagctgaaccaagtgattttctggctcagtttcctgaagtcccttgtcccagttgaagaacccatagccttcggtggcaagctgaagaacccactccaagttgtcctggtggccacccacgctgacatcatgaatgttcctcgaccggctggaggcgagtttggatatgacaaagacacatcgttgctgaaagagattaggaacaggtttggaaatgatcttcacatttcaaataagctgtttgttctggatgctggggcttctgggtcaaaggacatgaaggtacttcgaaatcatctgcaagaaatacgaagccagattgtttcggtctgtcctcccatgactcacctgtgtgagaaaatcatctccacgctgccttcctggaggaagctcaatggacccaaccagctgatgtcgctgcagcagtttgtgtacgacgtgcaggaccagctgaaccccctggccagcgaggaggacctcaggcgcattgctcagcagctccacagcacaggcgagatcaacatcatgcaaagtgaaacagttcaggacgtgctgctcctggacccccgctggctctgcacaaacgtcctggggaagttgctgtccgtggagaccccacgggcgctgcaccactaccggggccgctacaccgtggaggacatccagcgcctggtgcccgacagcgacgtggaggagctgctgcagatcctcgatgccatggacatctgcgcccgggacctgagcagcgggaccatggtggacgtcccagccctgatcaagacagacaacctgcaccgctcctgggctgatgaggaggacgaggtgatggtgtatggtggcgtgcgcatcgtgcccgtggaacacctcacccccttcccatgtggcatctttcacaaggtccaggtgaacctgtgccggtggatccaccagcaaagcacagagggcgacgcggacatccgcctgtgggtgaatggctgcaagctggccaaccgtggggccgagctgctggtgctgctggtcaaccacggccagggcattgaggtccaggtccgcggcctggagacggagaagatcaagtgctgcctgctgctggactcggtgtgcagcaccattgagaacgtcatggccaccacgctgccagggctcctgaccgtgaagcattacctgagcccccagcagctgcgggagcaccatgagcccgtcatgatctaccagccacgggacttcttccgggcacagactctgaaggaaacctcactgaccaacaccatgggggggtacaaggaaagcttcagcagcatcatgtgcttcgggtgtcacgacgtctactcacaggccagcctcggcatggacatccatgcatcagacctgaacctcctcactcggaggaaactgagtcgcctgctggacccgcccgaccccctggggaaggactggtgccttctcgccatgaacttaggcctccctgacctcgtggcaaagtacaacaccagtaacggggctcccaaggatttcctccccagccccctccacgccctgctgcgggaatggaccacctaccctgagagcacagtgggcaccctcatgtccaaactgagggagctgggtcgccgggatgccgcagactttttgctgaaggcatcctctgtgttcaaaatcaacctggatggcaatggccaggaggcctatgcctcgagctgcaacagcggcacctcttacaattccattagctctgttgtatcccggtgagggcagcctctggcttgggcagggtctgtttggactgcagaagcaagggggtgatgtagcccatccttccctttggagatgctgagggtgtttcttcctgcacccacagccagggggatgccactcctccctccggcttgacctgtttctctgccgctacctccctccccgtctcattccgttgtctgtggatggtcattgcagtttaagagcagaacagatcttttactttggccgcttgaaaagctagtgtacctcctctcagtgttttggactccatctctcatcctccagtaccttgcttcttactgataattttgctggaattcctaacttttcaatgacattttttttaactactatattgattgtcctttaaaaaagaaaagtgcatatttatccaaaatgtgtatttcttatacgcttttctttgttataccatttcctcagcttatctcttttatatttgtaggagaaactcccatgtatggaatcccactgtatgatttataaacagacaatatgtgagtgccttttgcagaagagggtgtgtttgaaatcatcggagtcagccaggagctgtcaccaaggaaacgctacctctctgtcccttgctgtatgctgatcatcgccagaggtgcttcaccctgagttttgttttgtattgttttctgacagtttttctgttttgtttggcaaggaaaggggagaagggaatcctcctccagggtgattttatgatcagtgttgttgctctaggaagacatttttccgtttgcttttgttccaatgtcaatgtgaacgtccacatgaaacctacacactgtcatgcttcatcattccctctcatctcaggtagaaggttgacacagttgtagggttacagagacctatgtaagaattcagaagacccctgactcatcatttgtggcagtcccttataattggtgcatagcagatggtttccacatttagatcctggtttcataacttcctgtacttgaagtctaaaagcagaaaataaaggaagcaagttttcttccatgattttaaattgtgatcgagttttaaattgataggagggaacatgtcctaattcttctgtcctgagaagcatgtaatgttaatgttatatcatatgtatatatatatatgcactatgtatatacatatatattaatactggtatttttacttaatctataaaatgtcgttaaaaagttgtttgtttttttctttttttataaataaactgttgctcgttgcattaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:1612 -> Molecular function: GO:0004672 [protein kinase activity] evidence: IDA
GeneID:1612 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: TAS
GeneID:1612 -> Molecular function: GO:0004683 [calmodulin-dependent protein kinase activity] evidence: IDA
GeneID:1612 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:1612 -> Molecular function: GO:0005516 [calmodulin binding] evidence: IDA
GeneID:1612 -> Molecular function: GO:0005524 [ATP binding] evidence: IDA
GeneID:1612 -> Molecular function: GO:0042802 [identical protein binding] evidence: IPI
GeneID:1612 -> Biological process: GO:0006468 [protein phosphorylation] evidence: IDA
GeneID:1612 -> Biological process: GO:0006468 [protein phosphorylation] evidence: TAS
GeneID:1612 -> Biological process: GO:0006915 [apoptotic process] evidence: IGI
GeneID:1612 -> Biological process: GO:0006915 [apoptotic process] evidence: TAS
GeneID:1612 -> Biological process: GO:0006917 [induction of apoptosis] evidence: IMP
GeneID:1612 -> Biological process: GO:0007243 [intracellular protein kinase cascade] evidence: IDA
GeneID:1612 -> Biological process: GO:0010506 [regulation of autophagy] evidence: TAS
GeneID:1612 -> Biological process: GO:0017148 [negative regulation of translation] evidence: IDA
GeneID:1612 -> Biological process: GO:0042981 [regulation of apoptotic process] evidence: TAS
GeneID:1612 -> Biological process: GO:0043065 [positive regulation of apoptotic process] evidence: TAS
GeneID:1612 -> Biological process: GO:0043066 [negative regulation of apoptotic process] evidence: IEA
GeneID:1612 -> Biological process: GO:0046777 [protein autophosphorylation] evidence: IDA
GeneID:1612 -> Biological process: GO:0046777 [protein autophosphorylation] evidence: TAS
GeneID:1612 -> Biological process: GO:0071346 [cellular response to interferon-gamma] evidence: IDA
GeneID:1612 -> Biological process: GO:0097190 [apoptotic signaling pathway] evidence: IMP
GeneID:1612 -> Biological process: GO:2000310 [regulation of N-methyl-D-aspartate selective glutamate receptor activity] evidence: ISS
GeneID:1612 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
GeneID:1612 -> Cellular component: GO:0015629 [actin cytoskeleton] evidence: IDA
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_004929 -> EC 2.7.11.1
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.