GGRNA Home | Help | Advanced search

2025-07-13 16:11:18, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_004849               3244 bp    mRNA    linear   PRI 15-JUL-2013
DEFINITION  Homo sapiens autophagy related 5 (ATG5), mRNA.
ACCESSION   NM_004849
VERSION     NM_004849.2  GI:92859692
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3244)
  AUTHORS   Chen,D., Zhu,C., Wang,X., Feng,X., Pang,S., Huang,W., Hawley,R.G.
            and Yan,B.
  TITLE     A novel and functional variant within the ATG5 gene promoter in
            sporadic Parkinson's disease
  JOURNAL   Neurosci. Lett. 538, 49-53 (2013)
   PUBMED   23384565
  REMARK    GeneRIF: the variant identified in PD patient may change ATG5
            protein levels and alter autophagy activities, contributing to
            Parkinson's disease onset as a risk factor.
REFERENCE   2  (bases 1 to 3244)
  AUTHORS   Yang,W., Tang,H., Zhang,Y., Tang,X., Zhang,J., Sun,L., Yang,J.,
            Cui,Y., Zhang,L., Hirankarn,N., Cheng,H., Pan,H.F., Gao,J.,
            Lee,T.L., Sheng,Y., Lau,C.S., Li,Y., Chan,T.M., Yin,X., Ying,D.,
            Lu,Q., Leung,A.M., Zuo,X., Chen,X., Tong,K.L., Zhou,F., Diao,Q.,
            Tse,N.K., Xie,H., Mok,C.C., Hao,F., Wong,S.N., Shi,B., Lee,K.W.,
            Hui,Y., Ho,M.H., Liang,B., Lee,P.P., Cui,H., Guo,Q., Chung,B.H.,
            Pu,X., Liu,Q., Zhang,X., Zhang,C., Chong,C.Y., Fang,H., Wong,R.W.,
            Sun,Y., Mok,M.Y., Li,X.P., Avihingsanon,Y., Zhai,Z.,
            Rianthavorn,P., Deekajorndej,T., Suphapeetiporn,K., Gao,F.,
            Shotelersuk,V., Kang,X., Ying,S.K., Zhang,L., Wong,W.H., Zhu,D.,
            Fung,S.K., Zeng,F., Lai,W.M., Wong,C.M., Ng,I.O.,
            Garcia-Barcelo,M.M., Cherny,S.S., Shen,N., Tam,P.K., Sham,P.C.,
            Ye,D.Q., Yang,S., Zhang,X. and Lau,Y.L.
  TITLE     Meta-analysis followed by replication identifies loci in or near
            CDKN1B, TET3, CD80, DRAM1, and ARID5B as associated with systemic
            lupus erythematosus in Asians
  JOURNAL   Am. J. Hum. Genet. 92 (1), 41-51 (2013)
   PUBMED   23273568
REFERENCE   3  (bases 1 to 3244)
  AUTHORS   Otomo,C., Metlagel,Z., Takaesu,G. and Otomo,T.
  TITLE     Structure of the human ATG12 ATG5 conjugate required for LC3
            lipidation in autophagy
  JOURNAL   Nat. Struct. Mol. Biol. 20 (1), 59-66 (2013)
   PUBMED   23202584
  REMARK    GeneRIF: study to identify role of conjugation between ATG12 and
            ATG5 in LC3 lipidation; structural and mutational analyses of
            ATG12~ATG5-ATG16N revealed the conjugation generates a patch across
            ATG12 and ATG5 required for E3 activity
REFERENCE   4  (bases 1 to 3244)
  AUTHORS   Cho,D.H., Jo,Y.K., Kim,S.C., Park,I.J. and Kim,J.C.
  TITLE     Down-regulated expression of ATG5 in colorectal cancer
  JOURNAL   Anticancer Res. 32 (9), 4091-4096 (2012)
   PUBMED   22993366
  REMARK    GeneRIF: Immunohistochemical analysis of colorectal cancer tissues
            indicated that increased ATG5 expression is associated with
            lymphovascular invasion.
REFERENCE   5  (bases 1 to 3244)
  AUTHORS   Zekri,A.R., Hassan,Z.K., Bahnassy,A.A., Sherif,G.M., ELdahshan,D.,
            Abouelhoda,M., Ali,A. and Hafez,M.M.
  TITLE     Molecular prognostic profile of Egyptian HCC cases infected with
            hepatitis C virus
  JOURNAL   Asian Pac. J. Cancer Prev. 13 (11), 5433-5438 (2012)
   PUBMED   23317196
  REMARK    GeneRIF: ATG-5 down-regulation is associated with hepatocellular
            carcinoma infected with hepatitis C virus.
REFERENCE   6  (bases 1 to 3244)
  AUTHORS   Tanida,I., Tanida-Miyake,E., Ueno,T. and Kominami,E.
  TITLE     The human homolog of Saccharomyces cerevisiae Apg7p is a
            Protein-activating enzyme for multiple substrates including human
            Apg12p, GATE-16, GABARAP, and MAP-LC3
  JOURNAL   J. Biol. Chem. 276 (3), 1701-1706 (2001)
   PUBMED   11096062
REFERENCE   7  (bases 1 to 3244)
  AUTHORS   Schmeiser,K., Armstrong,S., Hammond,E.M. and Grand,R.J.
  TITLE     Assignment of the yeast APG5 human homologue APG5L to chromosome
            band 6q21 by fluorescence in situ hybridisation
  JOURNAL   Cytogenet. Cell Genet. 87 (3-4), 213-214 (1999)
   PUBMED   10702672
REFERENCE   8  (bases 1 to 3244)
  AUTHORS   Mizushima,N., Sugita,H., Yoshimori,T. and Ohsumi,Y.
  TITLE     A new protein conjugation system in human. The counterpart of the
            yeast Apg12p conjugation system essential for autophagy
  JOURNAL   J. Biol. Chem. 273 (51), 33889-33892 (1998)
   PUBMED   9852036
REFERENCE   9  (bases 1 to 3244)
  AUTHORS   Hammond,E.M., Brunet,C.L., Johnson,G.D., Parkhill,J., Milner,A.E.,
            Brady,G., Gregory,C.D. and Grand,R.J.
  TITLE     Homology between a human apoptosis specific protein and the product
            of APG5, a gene involved in autophagy in yeast
  JOURNAL   FEBS Lett. 425 (3), 391-395 (1998)
   PUBMED   9563500
REFERENCE   10 (bases 1 to 3244)
  AUTHORS   Grand,R.J., Milner,A.E., Mustoe,T., Johnson,G.D., Owen,D.,
            Grant,M.L. and Gregory,C.D.
  TITLE     A novel protein expressed in mammalian cells undergoing apoptosis
  JOURNAL   Exp. Cell Res. 218 (2), 439-451 (1995)
   PUBMED   7796880
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            BP297166.1, Y11588.1 and BM831472.1.
            On Apr 19, 2006 this sequence version replaced gi:4757797.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: Y11588.1, AK001899.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-56                BP297166.1         1-56
            57-2452             Y11588.1           30-2425
            2453-2456           BM831472.1         17-20
            2457-3244           Y11588.1           2430-3217
FEATURES             Location/Qualifiers
     source          1..3244
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="6"
                     /map="6q21"
     gene            1..3244
                     /gene="ATG5"
                     /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
                     /note="autophagy related 5"
                     /db_xref="GeneID:9474"
                     /db_xref="HGNC:589"
                     /db_xref="HPRD:16051"
                     /db_xref="MIM:604261"
     exon            1..295
                     /gene="ATG5"
                     /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
                     /inference="alignment:Splign:1.39.8"
     exon            296..461
                     /gene="ATG5"
                     /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    321..323
                     /gene="ATG5"
                     /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
                     /note="upstream in-frame stop codon"
     variation       323
                     /gene="ATG5"
                     /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11541477"
     CDS             354..1181
                     /gene="ATG5"
                     /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
                     /note="apoptosis specific protein; apoptosis-specific
                     protein; ATG5 autophagy related 5 homolog"
                     /codon_start=1
                     /product="autophagy protein 5"
                     /protein_id="NP_004840.1"
                     /db_xref="GI:4757798"
                     /db_xref="CCDS:CCDS5055.1"
                     /db_xref="GeneID:9474"
                     /db_xref="HGNC:589"
                     /db_xref="HPRD:16051"
                     /db_xref="MIM:604261"
                     /translation="
MTDDKDVLRDVWFGRIPTCFTLYQDEITEREAEPYYLLLPRVSYLTLVTDKVKKHFQKVMRQEDISEIWFEYEGTPLKWHYPIGLLFDLLASSSALPWNITVHFKSFPEKDLLHCPSKDAIEAHFMSCMKEADALKHKSQVINEMQKKDHKQLWMGLQNDRFDQFWAINRKLMEYPAEENGFRYIPFRIYQTTTERPFIQKLFRPVAADGQLHTLGDLLKEVCPSAIDPEDGEKKNQVMIHGIEPMLETPLQWLSEHLSYPDNFLHISIIPQPTD
"
     misc_feature    588..1166
                     /gene="ATG5"
                     /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
                     /note="Autophagy protein Apg5; Region: APG5; pfam04106"
                     /db_xref="CDD:202889"
     exon            462..589
                     /gene="ATG5"
                     /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
                     /inference="alignment:Splign:1.39.8"
     exon            590..668
                     /gene="ATG5"
                     /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
                     /inference="alignment:Splign:1.39.8"
     exon            669..831
                     /gene="ATG5"
                     /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
                     /inference="alignment:Splign:1.39.8"
     STS             729..846
                     /gene="ATG5"
                     /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
                     /standard_name="Atg5"
                     /db_xref="UniSTS:526933"
     variation       738
                     /gene="ATG5"
                     /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34793250"
     variation       797
                     /gene="ATG5"
                     /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34601838"
     exon            832..926
                     /gene="ATG5"
                     /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
                     /inference="alignment:Splign:1.39.8"
     exon            927..1044
                     /gene="ATG5"
                     /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
                     /inference="alignment:Splign:1.39.8"
     exon            1045..3244
                     /gene="ATG5"
                     /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
                     /inference="alignment:Splign:1.39.8"
     STS             1449..1698
                     /gene="ATG5"
                     /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
                     /standard_name="WI-20363"
                     /db_xref="UniSTS:82998"
     STS             1531..1733
                     /gene="ATG5"
                     /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
                     /standard_name="EST6B12"
                     /db_xref="UniSTS:263392"
     variation       1743
                     /gene="ATG5"
                     /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:14503"
     STS             1866..1944
                     /gene="ATG5"
                     /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
                     /standard_name="STS-N94345"
                     /db_xref="UniSTS:69927"
     STS             1877..1961
                     /gene="ATG5"
                     /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
                     /standard_name="RH93335"
                     /db_xref="UniSTS:89477"
     variation       2576
                     /gene="ATG5"
                     /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1044481"
     STS             2992..3139
                     /gene="ATG5"
                     /gene_synonym="APG5; APG5-LIKE; APG5L; ASP; hAPG5"
                     /standard_name="RH78069"
                     /db_xref="UniSTS:52851"
ORIGIN      
gtgacgtcatctccgggcgccgagggtgactggacttgtggtgcgctgccagggctccgcagcgttgccggttgtattcgctggataccagagggcggaagtgcagcagggttcagctccgacctccgcgccggtgctttttgcggctgcgcgggcttcctggagtcctgctaccgcgtccccgcaggacagtgtgtcaggcgggcagcttgccccgccgccccaccggagcgcggaatctgggcgtccccaccagtgcggggagccggaaggaggagccatagcttggagtaggtttggctttggttgaaataagaatttagcctgtatgtactgctttaactcctggaagaatgacagatgacaaagatgtgcttcgagatgtgtggtttggacgaattccaacttgtttcacgctatatcaggatgagataactgaaagggaagcagaaccatactatttgcttttgccaagagtaagttatttgacgttggtaactgacaaagtgaaaaagcactttcagaaggttatgagacaagaagacattagtgagatatggtttgaatatgaaggcacaccactgaaatggcattatccaattggtttgctatttgatcttcttgcatcaagttcagctcttccttggaacatcacagtacattttaagagttttccagaaaaagaccttctgcactgtccatctaaggatgcaattgaagctcattttatgtcatgtatgaaagaagctgatgctttaaaacataaaagtcaagtaatcaatgaaatgcagaaaaaagatcacaagcaactctggatgggattgcaaaatgacagatttgaccagttttgggccatcaatcggaaactcatggaatatcctgcagaagaaaatggatttcgttatatcccctttagaatatatcagacaacgactgaaagacctttcattcagaagctgtttcgtcctgtggctgcagatggacagttgcacacactaggagatctcctcaaagaagtttgtccttctgctattgatcctgaagatggggaaaaaaagaatcaagtgatgattcatggaattgagccaatgttggaaacacctctgcagtggctgagtgaacatctgagctacccggataattttcttcatattagtatcatcccacagccaacagattgaaggatcaactatttgcctgaacagaatcatccttaaatgggatttatcagagcatgtcacccttttgcttcaatcaggtttggtggaggcaacctgaccagaaacacttcgctgctgcaagccagacaggaaaaagattccatgtcagataaggcaactgggctggtcttactttgcatcacctctgctttcctccactgccatcattaaacctcagctgtgacatgaaagacttaccggaccactgaaggtcttctgtaaaatataatgaagctgaaacctttggcctaagaagaaaatggaagtatgtgccactcgatttgtatttctgattaacaaataaacaggggtatttcctaaggtgaccatggttgaactttagctcatgaaagtggaaacattggtttaattttcaagagaattaagaaagtaaaagagaaattctgttatcaataacttgcaagtaattttttgtaaaagattgaattacagtaaacccatctttccttaacgaaaatttcctatgtttacagtctgtctattggtatgcaatcttgtaactttgataatgaacagtgagagatttttaaataaagcctctaaatatgttttgtcatttaataacatacagttttgtcacttttcaagtactttctgactcacatacagtagatcactttttactctgtgttaccattttgactggtcgtcattggcatggggtggatatagggcataggattacttgtctcagaagctgtcatagaatttcttgctgccaattaaaaaacctgtgttctttacacactacacgtataaatattgtaactgttcatctttgttgttttatcactgtaagcctgtcaaatcatagtatcctaagcatctgtaaatgctaattttgcatttttggaaaaacccattccttccaagctagtgtttttcattggctccaggtctaatttttcactgtggtccctggcagccagtcttttgaagtttaaagattacctgtctcttgactgcagtaccttttctttaatttttaccaaaaatatccagaggttactggagttcttattcaatataaggaaagtttgctgcactttattaccaagcctctgggattttaccagtcaaacatatttgtgcattacatttcatttcttgtgagctagctggctgtccatattgaatgttgacccatttgagtacgctaaaaggcttacagtatcagacacgatcatggttttagatcccataataaaaatgaatgtttttcttataaaaaattatacaaatgctgaagtgagattctactattgttcattgcttccttttctttttccttttgcgattttcactgattaatagcacatttcttcacaaaattagataaagttggtcaaagaccagatattctggaatggaaattgtaaagcttaatcaaaaagaatagccagtacagcatacaatctcagaaacttagaagcaagtagaaaataattggttgatgtaaacgaaagtgccattttagtaaaggcaggaaaaaaatagcaatatttgagttatgtaaggataaaaaatccactgacttgtatttttgcacaagaggctggtctgaatatgattgttcacattaagagtgtttattcgtcggttcattttggggattttcccccttgatgttttgacagattgaagtgagctttagtgagcaaaaggatcagaatgcagggaacactaagctgtgatgaagaaagtgtggtaaaaagccagagtagttttatacagacaaaaccagtgtcaggcctttgcagtaggcttgagtgaacttctgatctagatttgaaagtaaattttatgaagacattgcccatttttacttcctcattcattattgtaccagcatcatagctttattactctaatcccaggtaagtcaagcctacaatgccctagaggaagagtaaaaccagaaattcatgctggcttaaataatctatttttgtttcttttcatttgaatatttaaattttatggtttattaaaaaattaaataa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:9474 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:9474 -> Biological process: GO:0000045 [autophagic vacuole assembly] evidence: ISS
            GeneID:9474 -> Biological process: GO:0001974 [blood vessel remodeling] evidence: IEA
            GeneID:9474 -> Biological process: GO:0002739 [regulation of cytokine secretion involved in immune response] evidence: IEA
            GeneID:9474 -> Biological process: GO:0006914 [autophagy] evidence: ISS
            GeneID:9474 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA
            GeneID:9474 -> Biological process: GO:0009620 [response to fungus] evidence: IEA
            GeneID:9474 -> Biological process: GO:0031397 [negative regulation of protein ubiquitination] evidence: IEA
            GeneID:9474 -> Biological process: GO:0032480 [negative regulation of type I interferon production] evidence: TAS
            GeneID:9474 -> Biological process: GO:0042311 [vasodilation] evidence: IEA
            GeneID:9474 -> Biological process: GO:0042493 [response to drug] evidence: IEA
            GeneID:9474 -> Biological process: GO:0043066 [negative regulation of apoptotic process] evidence: IEA
            GeneID:9474 -> Biological process: GO:0043687 [post-translational protein modification] evidence: ISS
            GeneID:9474 -> Biological process: GO:0045087 [innate immune response] evidence: TAS
            GeneID:9474 -> Biological process: GO:0048840 [otolith development] evidence: IEA
            GeneID:9474 -> Biological process: GO:0055015 [ventricular cardiac muscle cell development] evidence: IEA
            GeneID:9474 -> Biological process: GO:0060047 [heart contraction] evidence: IEA
            GeneID:9474 -> Cellular component: GO:0005737 [cytoplasm] evidence: ISS
            GeneID:9474 -> Cellular component: GO:0005776 [autophagic vacuole] evidence: IDA
            GeneID:9474 -> Cellular component: GO:0034045 [pre-autophagosomal structure membrane] evidence: ISS

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.