Home |
Help |
Advanced search
2024-04-26 12:54:14, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_004833 1485 bp mRNA linear PRI 15-JUL-2013
DEFINITION Homo sapiens absent in melanoma 2 (AIM2), mRNA.
ACCESSION NM_004833
VERSION NM_004833.1 GI:4757733
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1485)
AUTHORS Jin,T., Perry,A., Smith,P., Jiang,J. and Xiao,T.S.
TITLE Structure of the absent in melanoma 2 (AIM2) pyrin domain provides
insights into the mechanisms of AIM2 autoinhibition and
inflammasome assembly
JOURNAL J. Biol. Chem. 288 (19), 13225-13235 (2013)
PUBMED 23530044
REMARK GeneRIF: Novel structural features of the AIM2 pyrin domain and
insights into the potential mechanisms of domain interactions
important for AIM2 autoinhibition and inflammasome assembly.
REFERENCE 2 (bases 1 to 1485)
AUTHORS de Koning,H.D., Bergboer,J.G., van den Bogaard,E.H., van
Vlijmen-Willems,I.M., Rodijk-Olthuis,D., Simon,A., Zeeuwen,P.L. and
Schalkwijk,J.
TITLE Strong induction of AIM2 expression in human epidermis in acute and
chronic inflammatory skin conditions
JOURNAL Exp. Dermatol. 21 (12), 961-964 (2012)
PUBMED 23171461
REMARK GeneRIF: Our data highlight the dynamics of epidermal AIM2
expression, showing Langerhans cell and melanocyte-restricted
expression in normal epidermis but a pronounced induction in
subpopulations of epidermal keratinocytes under inflammatory
conditions.
REFERENCE 3 (bases 1 to 1485)
AUTHORS Wang,L.J., Hsu,C.W., Chen,C.C., Liang,Y., Chen,L.C., Ojcius,D.M.,
Tsang,N.M., Hsueh,C., Wu,C.C. and Chang,Y.S.
TITLE Interactome-wide analysis identifies end-binding protein 1 as a
crucial component for the speck-like particle formation of
activated absence in melanoma 2 (AIM2) inflammasomes
JOURNAL Mol. Cell Proteomics 11 (11), 1230-1244 (2012)
PUBMED 22869553
REMARK GeneRIF: End binding protein 1 directly interacted with AIM2 and
ASC in vitro and in vivo.
REFERENCE 4 (bases 1 to 1485)
AUTHORS Jin,T., Perry,A., Jiang,J., Smith,P., Curry,J.A., Unterholzner,L.,
Jiang,Z., Horvath,G., Rathinam,V.A., Johnstone,R.W., Hornung,V.,
Latz,E., Bowie,A.G., Fitzgerald,K.A. and Xiao,T.S.
TITLE Structures of the HIN domain:DNA complexes reveal ligand binding
and activation mechanisms of the AIM2 inflammasome and IFI16
receptor
JOURNAL Immunity 36 (4), 561-571 (2012)
PUBMED 22483801
REMARK GeneRIF: crystal structures of their HIN domains in complex with
double-stranded (ds) DNA.
REFERENCE 5 (bases 1 to 1485)
AUTHORS Comuzzie,A.G., Cole,S.A., Laston,S.L., Voruganti,V.S., Haack,K.,
Gibbs,R.A. and Butte,N.F.
TITLE Novel genetic loci identified for the pathophysiology of childhood
obesity in the Hispanic population
JOURNAL PLoS ONE 7 (12), E51954 (2012)
PUBMED 23251661
REFERENCE 6 (bases 1 to 1485)
AUTHORS Liu,G., Yu,J.S., Zeng,G., Yin,D., Xie,D., Black,K.L. and Ying,H.
TITLE AIM-2: a novel tumor antigen is expressed and presented by human
glioma cells
JOURNAL J. Immunother. 27 (3), 220-226 (2004)
PUBMED 15076139
REMARK GeneRIF: AIM-2 antigen is expressed in glioblastoma multiforme
(GBM) in primary cultured cells and established GBM cell lines
REFERENCE 7 (bases 1 to 1485)
AUTHORS Choubey,D., Walter,S., Geng,Y. and Xin,H.
TITLE Cytoplasmic localization of the interferon-inducible protein that
is encoded by the AIM2 (absent in melanoma) gene from the 200-gene
family
JOURNAL FEBS Lett. 474 (1), 38-42 (2000)
PUBMED 10828447
REFERENCE 8 (bases 1 to 1485)
AUTHORS Landolfo,S., Gariglio,M., Gribaudo,G. and Lembo,D.
TITLE The Ifi 200 genes: an emerging family of IFN-inducible genes
JOURNAL Biochimie 80 (8-9), 721-728 (1998)
PUBMED 9865494
REMARK Review article
REFERENCE 9 (bases 1 to 1485)
AUTHORS DeYoung,K.L., Ray,M.E., Su,Y.A., Anzick,S.L., Johnstone,R.W.,
Trapani,J.A., Meltzer,P.S. and Trent,J.M.
TITLE Cloning a novel member of the human interferon-inducible gene
family associated with control of tumorigenicity in a model of
human melanoma
JOURNAL Oncogene 15 (4), 453-457 (1997)
PUBMED 9242382
REFERENCE 10 (bases 1 to 1485)
AUTHORS Ray,M.E., Su,Y.A., Meltzer,P.S. and Trent,J.M.
TITLE Isolation and characterization of genes associated with
chromosome-6 mediated tumor suppression in human malignant melanoma
JOURNAL Oncogene 12 (12), 2527-2533 (1996)
PUBMED 8700511
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AF024714.1.
Summary: AIM2 is a member of the IFI20X /IFI16 family. It plays a
putative role in tumorigenic reversion and may control cell
proliferation. Interferon-gamma induces expression of AIM2.
[provided by RefSeq, Jul 2008].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AF024714.1, BC010940.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025084, ERS025088 [ECO:0000348]
##Evidence-Data-END##
FEATURES Location/Qualifiers
source 1..1485
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="1"
/map="1q22"
gene 1..1485
/gene="AIM2"
/gene_synonym="PYHIN4"
/note="absent in melanoma 2"
/db_xref="GeneID:9447"
/db_xref="HGNC:357"
/db_xref="HPRD:05202"
/db_xref="MIM:604578"
exon 1..225
/gene="AIM2"
/gene_synonym="PYHIN4"
/inference="alignment:Splign:1.39.8"
exon 226..507
/gene="AIM2"
/gene_synonym="PYHIN4"
/inference="alignment:Splign:1.39.8"
misc_feature 228..230
/gene="AIM2"
/gene_synonym="PYHIN4"
/note="upstream in-frame stop codon"
CDS 246..1277
/gene="AIM2"
/gene_synonym="PYHIN4"
/codon_start=1
/product="interferon-inducible protein AIM2"
/protein_id="NP_004824.1"
/db_xref="GI:4757734"
/db_xref="CCDS:CCDS1181.1"
/db_xref="GeneID:9447"
/db_xref="HGNC:357"
/db_xref="HPRD:05202"
/db_xref="MIM:604578"
/translation="
MESKYKEILLLTGLDNITDEELDRFKFFLSDEFNIATGKLHTANRIQVATLMIQNAGAVSAVMKTIRIFQKLNYMLLAKRLQEEKEKVDKQYKSVTKPKPLSQAEMSPAASAAIRNDVAKQRAAPKVSPHVKPEQKQMVAQQESIREGFQKRCLPVMVLKAKKPFTFETQEGKQEMFHATVATEKEFFFVKVFNTLLKDKFIPKRIIIIARYYRHSGFLEVNSASRVLDAESDQKVNVPLNIIRKAGETPKINTLQTQPLGTIVNGLFVVQKVTEKKKNILFDLSDNTGKMEVLGVRNEDTMKCKEGDKVRLTFFTLSKNGEKLQLTSGVHSTIKVIKAKKKT
"
misc_feature 273..491
/gene="AIM2"
/gene_synonym="PYHIN4"
/note="Pyrin: a protein-protein interaction domain;
Region: Pyrin; cd08305"
/db_xref="CDD:176721"
misc_feature 693..1274
/gene="AIM2"
/gene_synonym="PYHIN4"
/note="conserved region found in other
interferon-inducible proteins; Region: IFI20X domain"
misc_feature 693..1199
/gene="AIM2"
/gene_synonym="PYHIN4"
/note="HIN-200/IF120x domain; Region: HIN; pfam02760"
/db_xref="CDD:202378"
variation 459
/gene="AIM2"
/gene_synonym="PYHIN4"
/replace="c"
/replace="t"
/db_xref="dbSNP:35430875"
variation 494
/gene="AIM2"
/gene_synonym="PYHIN4"
/replace="a"
/replace="g"
/db_xref="dbSNP:34479821"
exon 508..641
/gene="AIM2"
/gene_synonym="PYHIN4"
/inference="alignment:Splign:1.39.8"
exon 642..1061
/gene="AIM2"
/gene_synonym="PYHIN4"
/inference="alignment:Splign:1.39.8"
variation 803
/gene="AIM2"
/gene_synonym="PYHIN4"
/replace="a"
/replace="c"
/db_xref="dbSNP:35130877"
variation 995
/gene="AIM2"
/gene_synonym="PYHIN4"
/replace="g"
/replace="t"
/db_xref="dbSNP:34654901"
variation 1040
/gene="AIM2"
/gene_synonym="PYHIN4"
/replace="c"
/replace="t"
/db_xref="dbSNP:34419602"
exon 1062..1250
/gene="AIM2"
/gene_synonym="PYHIN4"
/inference="alignment:Splign:1.39.8"
exon 1251..1484
/gene="AIM2"
/gene_synonym="PYHIN4"
/inference="alignment:Splign:1.39.8"
variation 1291
/gene="AIM2"
/gene_synonym="PYHIN4"
/replace="a"
/replace="g"
/db_xref="dbSNP:1052923"
ORIGIN
tcagccaattagagctccagttgtcactcctacccacactgggcctgggggtgaagggaagtgtttattaggggtacatgtgaagccgtccagaagtgtcagagtctttgtagctttgaaagtcacctaggttatttgggcatgctctcctgagtcctctgctagttaagctctctgaaaagaaggtggcagacccggtttgctgatcgccccagggatcaggaggctgatcccaaagttgtcagatggagagtaaatacaaggagatactcttgctaacaggcctggataacatcactgatgaggaactggataggtttaagttctttctttcagacgagtttaatattgccacaggcaaactacatactgcaaacagaatacaagtagctaccttgatgattcaaaatgctggggcggtgtctgcagtgatgaagaccattcgtatttttcagaagttgaattatatgcttttggcaaaacgtcttcaggaggagaaggagaaagttgataagcaatacaaatcggtaacaaaaccaaagccactaagtcaagctgaaatgagtcctgctgcatctgcagccatcagaaatgatgtcgcaaagcaacgtgctgcaccaaaagtctctcctcatgttaagcctgaacagaaacagatggtggcccagcaggaatctatcagagaagggtttcagaagcgctgtttgccagttatggtactgaaagcaaagaagcccttcacgtttgagacccaagaaggcaagcaggagatgtttcatgctacagtggctacagaaaaggaattcttctttgtaaaagtttttaatacactgctgaaagataaattcattccaaagagaataattataatagcaagatattatcggcacagtggtttcttagaggtaaatagcgcctcacgtgtgttagatgctgaatctgaccaaaaggttaatgtcccgctgaacattatcagaaaagctggtgaaaccccgaagatcaacacgcttcaaactcagccccttggaacaattgtgaatggtttgtttgtagtccagaaggtaacagaaaagaagaaaaacatattatttgacctaagtgacaacactgggaaaatggaagtactgggggttagaaacgaggacacaatgaaatgtaaggaaggagataaggttcgacttacattcttcacactgtcaaaaaatggagaaaaactacagctgacatctggagttcatagcaccataaaggttattaaggccaaaaaaaaaacatagagaagtaaaaaggaccaattcaagccaactggtctaagcagcatttaattgaagaatatgtgatacagcctcttcaatcagattgtaagttacctgaaagctgcagttcacaggctcctctctccaccaaattaggatagaataattgctggataaacaaattcagaatatcaacagatgatcacaataaacatctgtttctcattcc
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:9447 -> Molecular function: GO:0003690 [double-stranded DNA binding] evidence: IDA
GeneID:9447 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:9447 -> Molecular function: GO:0042802 [identical protein binding] evidence: IPI
GeneID:9447 -> Biological process: GO:0002218 [activation of innate immune response] evidence: IDA
GeneID:9447 -> Biological process: GO:0002230 [positive regulation of defense response to virus by host] evidence: ISS
GeneID:9447 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA
GeneID:9447 -> Biological process: GO:0006954 [inflammatory response] evidence: IEA
GeneID:9447 -> Biological process: GO:0006955 [immune response] evidence: TAS
GeneID:9447 -> Biological process: GO:0032088 [negative regulation of NF-kappaB transcription factor activity] evidence: IDA
GeneID:9447 -> Biological process: GO:0032461 [positive regulation of protein oligomerization] evidence: IDA
GeneID:9447 -> Biological process: GO:0032731 [positive regulation of interleukin-1 beta production] evidence: IDA
GeneID:9447 -> Biological process: GO:0033209 [tumor necrosis factor-mediated signaling pathway] evidence: IDA
GeneID:9447 -> Biological process: GO:0035458 [cellular response to interferon-beta] evidence: IEA
GeneID:9447 -> Biological process: GO:0035690 [cellular response to drug] evidence: IDA
GeneID:9447 -> Biological process: GO:0035872 [nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway] evidence: TAS
GeneID:9447 -> Biological process: GO:0045087 [innate immune response] evidence: TAS
GeneID:9447 -> Biological process: GO:0050702 [interleukin-1 beta secretion] evidence: IMP
GeneID:9447 -> Biological process: GO:0050718 [positive regulation of interleukin-1 beta secretion] evidence: IDA
GeneID:9447 -> Biological process: GO:0051092 [positive regulation of NF-kappaB transcription factor activity] evidence: IDA
GeneID:9447 -> Biological process: GO:0070269 [pyroptosis] evidence: IDA
GeneID:9447 -> Biological process: GO:2001056 [positive regulation of cysteine-type endopeptidase activity] evidence: IDA
GeneID:9447 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:9447 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
GeneID:9447 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:9447 -> Cellular component: GO:0005739 [mitochondrion] evidence: IDA
GeneID:9447 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
GeneID:9447 -> Cellular component: GO:0097169 [AIM2 inflammasome complex] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.