Home |
Help |
Advanced search
2024-05-02 06:50:22, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_004817 4725 bp mRNA linear PRI 07-JUL-2013
DEFINITION Homo sapiens tight junction protein 2 (TJP2), transcript variant 1,
mRNA.
ACCESSION NM_004817
VERSION NM_004817.3 GI:282165795
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 4725)
AUTHORS Verhoeven VJ, Hysi PG, Wojciechowski R, Fan Q, Guggenheim JA, Hohn
R, MacGregor S, Hewitt AW, Nag A, Cheng CY, Yonova-Doing E, Zhou X,
Ikram MK, Buitendijk GH, McMahon G, Kemp JP, Pourcain BS, Simpson
CL, Makela KM, Lehtimaki T, Kahonen M, Paterson AD, Hosseini SM,
Wong HS, Xu L, Jonas JB, Parssinen O, Wedenoja J, Yip SP, Ho DW,
Pang CP, Chen LJ, Burdon KP, Craig JE, Klein BE, Klein R, Haller T,
Metspalu A, Khor CC, Tai ES, Aung T, Vithana E, Tay WT, Barathi VA,
Chen P, Li R, Liao J, Zheng Y, Ong RT, Doring A, Evans DM, Timpson
NJ, Verkerk AJ, Meitinger T, Raitakari O, Hawthorne F, Spector TD,
Karssen LC, Pirastu M, Murgia F, Ang W, Mishra A, Montgomery GW,
Pennell CE, Cumberland PM, Cotlarciuc I, Mitchell P, Wang JJ,
Schache M, Janmahasathian S, Igo RP Jr, Lass JH, Chew E, Iyengar
SK, Gorgels TG, Rudan I, Hayward C, Wright AF, Polasek O, Vatavuk
Z, Wilson JF, Fleck B, Zeller T, Mirshahi A, Muller C, Uitterlinden
AG, Rivadeneira F, Vingerling JR, Hofman A, Oostra BA, Amin N,
Bergen AA, Teo YY, Rahi JS, Vitart V, Williams C, Baird PN, Wong
TY, Oexle K, Pfeiffer N, Mackey DA, Young TL, van Duijn CM, Saw SM,
Bailey-Wilson JE, Stambolian D, Klaver CC and Hammond CJ.
CONSRTM Consortium for Refractive Error and Myopia (CREAM); Diabetes
Control and Complications Trial/Epidemiology of Diabetes
Interventions and Complications (DCCT/EDIC) Research Group;
Wellcome Trust Case Control Consortium 2 (WTCCC2); Fuchs' Genetics
Multi-Center Study Group
TITLE Genome-wide meta-analyses of multiancestry cohorts identify
multiple new susceptibility loci for refractive error and myopia
JOURNAL Nat. Genet. 45 (3), 314-318 (2013)
PUBMED 23396134
REFERENCE 2 (bases 1 to 4725)
AUTHORS Gonzalez-Mariscal,L., Bautista,P., Lechuga,S. and Quiros,M.
TITLE ZO-2, a tight junction scaffold protein involved in the regulation
of cell proliferation and apoptosis
JOURNAL Ann. N. Y. Acad. Sci. 1257, 133-141 (2012)
PUBMED 22671599
REMARK GeneRIF: ZO-2 inhibits the Wnt signaling pathway, reduces cell
proliferation, and promotes apoptosis; its absence, mutation, or
overexpression is present in various human diseases, including
deafness and cancer.
Review article
REFERENCE 3 (bases 1 to 4725)
AUTHORS Oka,T., Schmitt,A.P. and Sudol,M.
TITLE Opposing roles of angiomotin-like-1 and zona occludens-2 on
pro-apoptotic function of YAP
JOURNAL Oncogene 31 (1), 128-134 (2012)
PUBMED 21685940
REMARK GeneRIF: AmotL1 and ZO-2 are two candidates that could be harnessed
to control the oncogenic function of YAP.
REFERENCE 4 (bases 1 to 4725)
AUTHORS Foster,M.C., Yang,Q., Hwang,S.J., Hoffmann,U. and Fox,C.S.
TITLE Heritability and genome-wide association analysis of renal sinus
fat accumulation in the Framingham Heart Study
JOURNAL BMC Med. Genet. 12, 148 (2011)
PUBMED 22044751
REMARK Publication Status: Online-Only
REFERENCE 5 (bases 1 to 4725)
AUTHORS Walsh,T., Pierce,S.B., Lenz,D.R., Brownstein,Z.,
Dagan-Rosenfeld,O., Shahin,H., Roeb,W., McCarthy,S., Nord,A.S.,
Gordon,C.R., Ben-Neriah,Z., Sebat,J., Kanaan,M., Lee,M.K.,
Frydman,M., King,M.C. and Avraham,K.B.
TITLE Genomic duplication and overexpression of TJP2/ZO-2 leads to
altered expression of apoptosis genes in progressive nonsyndromic
hearing loss DFNA51
JOURNAL Am. J. Hum. Genet. 87 (1), 101-109 (2010)
PUBMED 20602916
REMARK GeneRIF: TJP2- and GSK-3beta-mediated increased susceptibility to
apoptosis of cells of the inner ear is the mechanism for
adult-onset hearing loss in this kindred and may serve as one model
for age-related hearing loss in the general population.
REFERENCE 6 (bases 1 to 4725)
AUTHORS Chlenski,A., Ketels,K.V., Tsao,M.S., Talamonti,M.S., Anderson,M.R.,
Oyasu,R. and Scarpelli,D.G.
TITLE Tight junction protein ZO-2 is differentially expressed in normal
pancreatic ducts compared to human pancreatic adenocarcinoma
JOURNAL Int. J. Cancer 82 (1), 137-144 (1999)
PUBMED 10360833
REFERENCE 7 (bases 1 to 4725)
AUTHORS Itoh,M., Morita,K. and Tsukita,S.
TITLE Characterization of ZO-2 as a MAGUK family member associated with
tight as well as adherens junctions with a binding affinity to
occludin and alpha catenin
JOURNAL J. Biol. Chem. 274 (9), 5981-5986 (1999)
PUBMED 10026224
REFERENCE 8 (bases 1 to 4725)
AUTHORS Denker,B.M. and Nigam,S.K.
TITLE Molecular structure and assembly of the tight junction
JOURNAL Am. J. Physiol. 274 (1 PT 2), F1-F9 (1998)
PUBMED 9458817
REMARK Review article
REFERENCE 9 (bases 1 to 4725)
AUTHORS Beatch,M., Jesaitis,L.A., Gallin,W.J., Goodenough,D.A. and
Stevenson,B.R.
TITLE The tight junction protein ZO-2 contains three PDZ
(PSD-95/Discs-Large/ZO-1) domains and an alternatively spliced
region
JOURNAL J. Biol. Chem. 271 (42), 25723-25726 (1996)
PUBMED 8824195
REFERENCE 10 (bases 1 to 4725)
AUTHORS Duclos,F., Rodius,F., Wrogemann,K., Mandel,J.L. and Koenig,M.
TITLE The Friedreich ataxia region: characterization of two novel genes
and reduction of the critical region to 300 kb
JOURNAL Hum. Mol. Genet. 3 (6), 909-914 (1994)
PUBMED 7951235
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from DB090695.1, L27476.1,
BC027592.1 and AL358113.21.
This sequence is a reference standard in the RefSeqGene project.
On Dec 29, 2009 this sequence version replaced gi:42518069.
Summary: This gene encodes a zonula occluden that is a member of
the membrane-associated guanylate kinase homolog family. The
encoded protein functions as a component of the tight junction
barrier in epithelial and endothelial cells and is necessary for
proper assembly of tight junctions. Mutations in this gene have
been identified in patients with hypercholanemia, and genomic
duplication of a 270 kb region including this gene causes autosomal
dominant deafness-51. Alternatively spliced transcripts encoding
multiple isoforms have been observed for this gene. [provided by
RefSeq, Nov 2011].
Transcript Variant: This variant (1) encodes isoform (1).
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BC027592.1, L27476.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025081, ERS025082 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-138 DB090695.1 1-138
139-239 DB090695.1 140-240
240-1549 L27476.1 1-1310
1550-2093 BC027592.1 1441-1984
2094-2094 AL358113.21 70261-70261
2095-2669 BC027592.1 1986-2560
2670-2670 AL358113.21 74504-74504
2671-4291 BC027592.1 2562-4182
4292-4725 AL358113.21 90493-90926
FEATURES Location/Qualifiers
source 1..4725
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="9"
/map="9q13-q21"
gene 1..4725
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/note="tight junction protein 2"
/db_xref="GeneID:9414"
/db_xref="HGNC:11828"
/db_xref="HPRD:06369"
/db_xref="MIM:607709"
exon 1..378
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/inference="alignment:Splign:1.39.8"
variation 102
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="g"
/replace="t"
/db_xref="dbSNP:13285753"
variation 112
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="g"
/db_xref="dbSNP:140590693"
variation 134
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:62567129"
variation 186
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:13301644"
variation 196
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="g"
/replace="t"
/db_xref="dbSNP:373951893"
misc_feature 253..255
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/note="upstream in-frame stop codon"
variation 293
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:147729271"
variation 303
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="g"
/replace="t"
/db_xref="dbSNP:199557806"
variation 311
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:374829462"
variation 316
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201523518"
CDS 319..3891
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/note="isoform 1 is encoded by transcript variant 1;
Friedreich ataxia region gene X104 (tight junction protein
ZO-2); zona occludens 2; zonula occludens protein 2"
/codon_start=1
/product="tight junction protein ZO-2 isoform 1"
/protein_id="NP_004808.2"
/db_xref="GI:42518070"
/db_xref="CCDS:CCDS6627.1"
/db_xref="GeneID:9414"
/db_xref="HGNC:11828"
/db_xref="HPRD:06369"
/db_xref="MIM:607709"
/translation="
MPVRGDRGFPPRRELSGWLRAPGMEELIWEQYTVTLQKDSKRGFGIAVSGGRDNPHFENGETSIVISDVLPGGPADGLLQENDRVVMVNGTPMEDVLHSFAVQQLRKSGKVAAIVVKRPRKVQVAALQASPPLDQDDRAFEVMDEFDGRSFRSGYSERSRLNSHGGRSRSWEDSPERGRPHERARSRERDLSRDRSRGRSLERGLDQDHARTRDRSRGRSLERGLDHDFGPSRDRDRDRSRGRSIDQDYERAYHRAYDPDYERAYSPEYRRGARHDARSRGPRSRSREHPHSRSPSPEPRGRPGPIGVLLMKSRANEEYGLRLGSQIFVKEMTRTGLATKDGNLHEGDIILKINGTVTENMSLTDARKLIEKSRGKLQLVVLRDSQQTLINIPSLNDSDSEIEDISEIESNRSFSPEERRHQYSDYDYHSSSEKLKERPSSREDTPSRLSRMGATPTPFKSTGDIAGTVVPETNKEPRYQEDPPAPQPKAAPRTFLRPSPEDEAIYGPNTKMVRFKKGDSVGLRLAGGNDVGIFVAGIQEGTSAEQEGLQEGDQILKVNTQDFRGLVREDAVLYLLEIPKGEMVTILAQSRADVYRDILACGRGDSFFIRSHFECEKETPQSLAFTRGEVFRVVDTLYDGKLGNWLAVRIGNELEKGLIPNKSRAEQMASVQNAQRDNAGDRADFWRMRGQRSGVKKNLRKSREDLTAVVSVSTKFPAYERVLLREAGFKRPVVLFGPIADIAMEKLANELPDWFQTAKTEPKDAGSEKSTGVVRLNTVRQIIEQDKHALLDVTPKAVDLLNYTQWFPIVIFFNPDSRQGVKTMRQRLNPTSNKSSRKLFDQANKLKKTCAHLFTATINLNSANDSWFGSLKDTIQHQQGEAVWVSEGKMEGMDDDPEDRMSYLTAMGADYLSCDSRLISDFEDTDGEGGAYTDNELDEPAEEPLVSSITRSSEPVQHEESIRKPSPEPRAQMRRAASSDQLRDNSPPPAFKPEPPKAKTQNKEESYDFSKSYEYKSNPSAVAGNETPGASTKGYPPPVAAKPTFGRSILKPSTPIPPQEGEEVGESSEEQDNAPKSVLGKVKIFEKMDHKARLQRMQELQEAQNARIEIAQKHPDIYAVPIKTHKPDPGTPQHTSSRPPEPQKAPSRPYQDTRGSYGSDAEEEEYRQQLSEHSKRGYYGQSARYRDTEL
"
misc_feature 412..669
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/note="PDZ domain found in a variety of Eumetazoan
signaling molecules, often in tandem arrangements. May be
responsible for specific protein-protein interactions, as
most PDZ domains bind C-terminal polypeptides, and binding
to internal (non-C-terminal)...; Region: PDZ_signaling;
cd00992"
/db_xref="CDD:29049"
misc_feature order(445..456,460..462,619..624,631..636)
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/note="protein binding site [polypeptide binding]; other
site"
/db_xref="CDD:29049"
misc_feature 706..708
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9UDY2.2); phosphorylation site"
misc_feature 706..708
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 775..777
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9UDY2.2); phosphorylation site"
misc_feature 820..822
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9UDY2.2); phosphorylation site"
misc_feature 820..822
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 826..828
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9UDY2.2); phosphorylation site"
misc_feature 826..828
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 838..840
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9UDY2.2); phosphorylation site"
misc_feature 838..840
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 892..894
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 916..918
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9UDY2.2); phosphorylation site"
misc_feature 976..978
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9UDY2.2); phosphorylation site"
misc_feature 1048..1050
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9UDY2.2); phosphorylation site"
misc_feature 1048..1050
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1099..1101
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1114..1116
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9UDY2.2); phosphorylation site"
misc_feature 1114..1116
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1114..1116
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1204..1206
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1240..1464
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/note="PDZ domain found in a variety of Eumetazoan
signaling molecules, often in tandem arrangements. May be
responsible for specific protein-protein interactions, as
most PDZ domains bind C-terminal polypeptides, and binding
to internal (non-C-terminal)...; Region: PDZ_signaling;
cd00992"
/db_xref="CDD:29049"
misc_feature order(1270..1281,1285..1287,1414..1419,1426..1431)
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/note="protein binding site [polypeptide binding]; other
site"
/db_xref="CDD:29049"
misc_feature 1498..1500
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1510..1512
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1516..1518
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9UDY2.2); phosphorylation site"
misc_feature 1516..1518
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1534..1536
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1546..1548
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1555..1557
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1585..1587
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1588..1590
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1600..1602
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1606..1608
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9UDY2.2); phosphorylation site"
misc_feature 1612..1614
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1636..1638
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1639..1641
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1651..1653
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1681..1683
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine; propagated from
UniProtKB/Swiss-Prot (Q9UDY2.2); phosphorylation site"
misc_feature 1846..2085
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/note="PDZ domain found in a variety of Eumetazoan
signaling molecules, often in tandem arrangements. May be
responsible for specific protein-protein interactions, as
most PDZ domains bind C-terminal polypeptides, and binding
to internal (non-C-terminal)...; Region: PDZ_signaling;
cd00992"
/db_xref="CDD:29049"
misc_feature order(1876..1887,1891..1893,2029..2034,2041..2046)
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/note="protein binding site [polypeptide binding]; other
site"
/db_xref="CDD:29049"
misc_feature 2128..2316
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/note="Src homology 3 domain of the Tight junction
protein, Zonula occludens protein 2; Region: SH3_ZO-2;
cd12027"
/db_xref="CDD:212960"
misc_feature order(2155..2157,2161..2163,2170..2172,2182..2184,
2245..2250,2296..2298,2302..2307)
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/note="peptide ligand binding site [polypeptide binding];
other site"
/db_xref="CDD:212960"
misc_feature 2416..2955
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/note="Guanylate kinase homologues; Region: GuKc;
smart00072"
/db_xref="CDD:197501"
misc_feature 2422..2424
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9UDY2.2); phosphorylation site"
misc_feature 2626..2628
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 2629..2631
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 3076..3078
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9UDY2.2); phosphorylation site"
misc_feature 3091..3093
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine; propagated from
UniProtKB/Swiss-Prot (Q9UDY2.2); phosphorylation site"
misc_feature 3115..3117
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine; propagated from
UniProtKB/Swiss-Prot (Q9UDY2.2); phosphorylation site"
misc_feature 3214..3216
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9UDY2.2); phosphorylation site"
misc_feature 3214..3216
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 3250..3252
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9UDY2.2); phosphorylation site"
misc_feature 3250..3252
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 3253..3255
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 3274..3276
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9UDY2.2); phosphorylation site"
misc_feature 3274..3276
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 3517..3519
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9UDY2.2); phosphorylation site"
misc_feature 3520..3522
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9UDY2.2); phosphorylation site"
misc_feature 3670..3672
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 3709..3711
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine; propagated from
UniProtKB/Swiss-Prot (Q9UDY2.2); phosphorylation site"
misc_feature 3757..3759
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9UDY2.2); phosphorylation site"
misc_feature 3784..3786
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 3787..3789
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 3793..3795
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9UDY2.2); phosphorylation site"
misc_feature 3793..3795
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 3829..3831
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 3838..3840
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 3880..3888
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q9UDY2.2);
Region: Interaction with SCRIB"
variation 323
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:369175124"
variation 341
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="g"
/db_xref="dbSNP:373291069"
variation 350
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="g"
/db_xref="dbSNP:145066365"
variation 355
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:141127141"
variation 373
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:377762494"
exon 379..432
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/inference="alignment:Splign:1.39.8"
variation 386
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:187570733"
variation 397
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="g"
/db_xref="dbSNP:145628692"
exon 433..557
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/inference="alignment:Splign:1.39.8"
variation 461
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:121918299"
variation 503
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:138241615"
variation 523
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:200422718"
variation 528
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:376932801"
variation 530
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:142847960"
exon 558..660
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/inference="alignment:Splign:1.39.8"
variation 573
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="g"
/db_xref="dbSNP:200346028"
variation 574
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201206163"
variation 591
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="c"
/db_xref="dbSNP:183412157"
variation 615
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:72709079"
variation 652
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:144396411"
exon 661..1270
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/inference="alignment:Splign:1.39.8"
variation 693
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:181450555"
variation 700
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="c"
/db_xref="dbSNP:41305539"
variation 713
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="g"
/db_xref="dbSNP:141496493"
variation 818
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:374558646"
variation 826
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:368217372"
variation 835
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201708475"
variation 868
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="g"
/replace="t"
/db_xref="dbSNP:372594490"
variation 877
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="g"
/db_xref="dbSNP:201191711"
variation 895
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:200390074"
variation 917
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="g"
/replace="t"
/db_xref="dbSNP:373944275"
variation 962
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201977617"
variation 974
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:371548163"
variation 997
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:373515581"
variation 1016
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:150883816"
variation 1022
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:139402211"
variation 1066
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:144127005"
variation 1100
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:376454579"
variation 1106
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:368849809"
variation 1116
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:372592617"
variation 1130
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:377314831"
variation 1150
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:369572714"
variation 1195
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:189916909"
variation 1205
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:376434139"
variation 1206
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:369376162"
variation 1213
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace=""
/replace="c"
/db_xref="dbSNP:35765595"
variation 1226
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:199641113"
variation 1228
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:375605660"
variation 1229
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:200222645"
variation 1236
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:374523970"
exon 1271..1374
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/inference="alignment:Splign:1.39.8"
variation 1284
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="g"
/replace="t"
/db_xref="dbSNP:199857597"
variation 1290
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="g"
/replace="t"
/db_xref="dbSNP:372333417"
variation 1299
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="c"
/db_xref="dbSNP:147139671"
variation 1303
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:140340673"
variation 1304
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="t"
/db_xref="dbSNP:375470616"
variation 1323
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:140444730"
variation 1353
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:144213955"
exon 1375..1528
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/inference="alignment:Splign:1.39.8"
variation 1381
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="g"
/db_xref="dbSNP:78681604"
variation 1409
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:77321498"
variation 1426
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:142596636"
variation 1443
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:377744473"
variation 1455
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:17062695"
variation 1497
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:141089413"
exon 1529..1637
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/inference="alignment:Splign:1.39.8"
variation 1569
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:199910382"
variation 1576
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:199761505"
variation 1577
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201850095"
variation 1583
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:144928091"
variation 1637
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="g"
/db_xref="dbSNP:201118051"
exon 1638..1771
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/inference="alignment:Splign:1.39.8"
variation 1653
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201454629"
variation 1654
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="c"
/db_xref="dbSNP:141175414"
variation 1655
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:150193775"
variation 1668
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:17062723"
variation 1716
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:368671250"
variation 1729
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:149386335"
variation 1762
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:371970921"
variation 1764
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="c"
/db_xref="dbSNP:2309428"
variation 1766
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:372652662"
exon 1772..1838
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/inference="alignment:Splign:1.39.8"
variation 1791
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="c"
/db_xref="dbSNP:138509345"
variation 1793
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:200531230"
variation 1796
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:41277901"
variation 1807
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:202036469"
variation 1817
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:147315517"
variation 1824
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:139354927"
variation 1834
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:369223517"
exon 1839..1989
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/inference="alignment:Splign:1.39.8"
variation 1860
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:202207638"
variation 1949
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:142684074"
variation 1971
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="t"
/db_xref="dbSNP:201151091"
variation 1974
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:150723764"
variation 1975
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:199766035"
exon 1990..2098
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/inference="alignment:Splign:1.39.8"
variation 2031
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="g"
/db_xref="dbSNP:376280878"
variation 2094
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:17852440"
exon 2099..2309
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/inference="alignment:Splign:1.39.8"
variation 2108
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:368211022"
variation 2112
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:372476914"
variation 2139
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:375041393"
variation 2175
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="t"
/db_xref="dbSNP:139082742"
variation 2195
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="g"
/db_xref="dbSNP:149911553"
variation 2235
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:12340440"
variation 2277
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:139939884"
variation 2297
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:143383833"
exon 2310..2497
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/inference="alignment:Splign:1.39.8"
variation 2313
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="t"
/db_xref="dbSNP:146741666"
variation 2322
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:34774441"
variation 2338
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:199605381"
variation 2345
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="g"
/db_xref="dbSNP:142254605"
variation 2352
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:373160031"
variation 2358
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:111723895"
variation 2363
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:374930338"
variation 2399
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201366118"
variation 2401
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="g"
/replace="t"
/db_xref="dbSNP:140497048"
variation 2447
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:150440380"
variation 2449
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:35797487"
variation 2455
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:116545275"
variation 2492
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:369608760"
exon 2498..2593
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/inference="alignment:Splign:1.39.8"
variation 2524
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:146818363"
variation 2526
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:201690110"
variation 2527
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:139314808"
variation 2543
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:149439289"
variation 2588
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:189443180"
exon 2594..2673
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/inference="alignment:Splign:1.39.8"
variation 2595
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="c"
/db_xref="dbSNP:144429323"
variation 2597
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:370850127"
variation 2641
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:147994200"
variation 2647
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:373645515"
variation 2652
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:183285809"
variation 2653
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:145368713"
variation 2670
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:17852441"
exon 2674..2884
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/inference="alignment:Splign:1.39.8"
variation 2685
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:75668442"
variation 2702
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:139867659"
variation 2727
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:199666475"
variation 2778
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:112546379"
variation 2784
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1049624"
variation 2794
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="g"
/db_xref="dbSNP:368776405"
variation 2803
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1049625"
variation 2813
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:200527346"
variation 2820
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1049626"
variation 2844
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="c"
/db_xref="dbSNP:1049627"
variation 2872
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:143346845"
exon 2885..2985
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/inference="alignment:Splign:1.39.8"
variation 2954
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:75450131"
variation 2964
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:11788754"
exon 2986..3198
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/inference="alignment:Splign:1.39.8"
variation 2994
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="g"
/replace="t"
/db_xref="dbSNP:377138769"
variation 3009
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:149969431"
variation 3016
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="c"
/db_xref="dbSNP:374830612"
variation 3019
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201976717"
variation 3024
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="g"
/db_xref="dbSNP:145703764"
variation 3033
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2282336"
variation 3038
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:149659876"
variation 3044
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:146761713"
variation 3045
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2095876"
variation 3060
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:370164683"
variation 3069
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:184519036"
variation 3093
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:374453976"
variation 3096
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:140442228"
variation 3108
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="c"
/db_xref="dbSNP:189082774"
variation 3109
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:139276234"
variation 3128
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:28556975"
variation 3137
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:199852211"
variation 3150
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:191634088"
variation 3170
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:368776552"
variation 3171
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:201287214"
variation 3176
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:377218278"
variation 3177
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="g"
/replace="t"
/db_xref="dbSNP:369972534"
exon 3199..3309
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/inference="alignment:Splign:1.39.8"
variation 3202
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:199704587"
variation 3215
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:374359318"
variation 3217
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="g"
/db_xref="dbSNP:202218094"
variation 3227
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:150494393"
variation 3255
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:138333815"
variation 3261
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="c"
/db_xref="dbSNP:112917902"
variation 3279
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:371617466"
variation 3304
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1130682"
exon 3310..3639
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/inference="alignment:Splign:1.39.8"
variation 3324
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:149445624"
variation 3347
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:41277907"
variation 3381
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:367977493"
variation 3385
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="g"
/replace="t"
/db_xref="dbSNP:201317427"
variation 3386
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:199767035"
variation 3389
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:138564703"
variation 3394
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201202451"
variation 3457
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:148629740"
variation 3458
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="g"
/db_xref="dbSNP:191327525"
variation 3463
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:200145911"
variation 3468
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:141675065"
variation 3478
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:57728054"
variation 3508
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="g"
/replace="t"
/db_xref="dbSNP:199892018"
variation 3543
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:146241989"
variation 3545
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:372741297"
variation 3553
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:375994824"
variation 3554..3555
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace=""
/replace="g"
/db_xref="dbSNP:35985470"
variation 3556
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:200355922"
variation 3575
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="c"
/db_xref="dbSNP:372671140"
variation 3581
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:148466022"
variation 3635
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:141739598"
exon 3640..3725
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/inference="alignment:Splign:1.39.8"
variation 3640
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201835299"
variation 3660
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:61753629"
variation 3689
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:376663560"
variation 3710
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:139636763"
variation 3711
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:374945852"
variation 3715
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:10122717"
exon 3726..4725
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/inference="alignment:Splign:1.39.8"
variation 3733
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="c"
/db_xref="dbSNP:371868714"
variation 3751
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="g"
/db_xref="dbSNP:375244684"
variation 3781
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:200425899"
variation 3793..3794
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace=""
/replace="g"
/replace="ggg"
/db_xref="dbSNP:144624916"
variation 3795
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="g"
/replace="t"
/db_xref="dbSNP:79207032"
variation 3801
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="c"
/db_xref="dbSNP:199597127"
variation 3813
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:111595785"
variation 3817
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:377625722"
variation 3818
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="g"
/replace="t"
/db_xref="dbSNP:370985421"
variation 3846
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:147675640"
variation 3847
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:377241881"
variation 3874
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:112109886"
variation 3875
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:201144827"
variation 3876
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="g"
/replace="t"
/db_xref="dbSNP:145112366"
variation 3880
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:192802385"
variation 3928
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:374233417"
variation 3937
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:11548277"
STS 3963..4062
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/standard_name="D9S1716"
/db_xref="UniSTS:20005"
variation 4043
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:184271014"
variation 4074
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:3812536"
variation 4165
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="g"
/db_xref="dbSNP:368634749"
variation 4240
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:189219524"
variation 4261
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="g"
/db_xref="dbSNP:116341259"
variation 4281
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1804894"
polyA_signal 4283..4288
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
polyA_site 4312
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
variation 4340
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:373505707"
STS 4390..4591
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/standard_name="RH39762"
/db_xref="UniSTS:90538"
STS 4455..4593
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/standard_name="G54053"
/db_xref="UniSTS:109435"
variation 4511
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="t"
/db_xref="dbSNP:4558"
variation 4513
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:370920805"
variation 4524
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:11548278"
variation 4553
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:148680905"
variation 4558
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:376112488"
variation 4560
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1804896"
STS 4567..4681
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/standard_name="SGC30152"
/db_xref="UniSTS:39540"
variation 4586
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="c"
/replace="g"
/db_xref="dbSNP:11548276"
variation 4620
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1804895"
variation 4627
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
/replace=""
/replace="a"
/db_xref="dbSNP:369196578"
polyA_signal 4693..4698
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
polyA_site 4721
/gene="TJP2"
/gene_synonym="C9DUPq21.11; DFNA51; DUP9q21.11; X104; ZO2"
ORIGIN
gacgcggttcgccgcaggagcctcgaaggcgcggcgccggcgagcccttccccggcaggcgcgtgggtggtagcggccaatttgacagtttcccgggccgggcggccagcgcggaggcgccacgctcgggtcgggggcgggctgacgccgccgccgccgcgggaggagggacaaaggggtgggtccccgcgggtcggcaccccggcggttgggctgcgggtcagagcactgtccggtggtgcccaggaggagtaggagcaggagcagaagcagaagcggggtccggagctgcgcgcctacgcgggacctgtgtccgaaatgccggtgcgaggagaccgcgggtttccaccccggcgggagctgtcaggttggctccgcgccccaggcatggaagagctgatatgggaacagtacactgtgaccctacaaaaggattccaaaagaggatttggaattgcagtgtccggaggcagagacaacccccactttgaaaatggagaaacgtcaattgtcatttctgatgtgctcccgggtgggcctgctgatgggctgctccaagaaaatgacagagtggtcatggtcaatggcacccccatggaggatgtgcttcattcgtttgcagttcagcagctcagaaaaagtgggaaggtcgctgctattgtggtcaagaggccccggaaggtccaggtggccgcacttcaggccagccctcccctggatcaggatgaccgggcttttgaggtgatggacgagtttgatggcagaagtttccggagtggctacagcgagaggagccggctgaacagccatggggggcgcagccgcagctgggaggacagcccggaaagggggcgtccccatgagcgggcccggagccgggagcgggacctcagccgggaccggagccgtggccggagcctggagcggggcctggaccaagaccatgcgcgcacccgagaccgcagccgtggccggagcctggagcggggcctggaccacgactttgggccatcccgggaccgggaccgtgaccgcagccgcggccggagcattgaccaggactacgagcgagcctatcaccgggcctacgacccagactacgagcgggcctacagcccggagtacaggcgcggggcccgccacgatgcccgctctcggggaccccgaagccgcagccgcgagcacccgcactcacggagccccagccccgagcctagggggcggccggggcccatcggggtcctcctgatgaaaagcagagcgaacgaagagtatggtctccggcttgggagtcagatcttcgtaaaggaaatgacccgaacgggtctggcaactaaagatggcaaccttcacgaaggagacataattctcaagatcaatgggactgtaactgagaacatgtctttaacggatgctcgaaaattgatagaaaagtcaagaggaaaactacagctagtggtgttgagagacagccagcagaccctcatcaacatcccgtcattaaatgacagtgactcagaaatagaagatatttcagaaatagagtcaaaccgatcattttctccagaggagagacgtcatcagtattctgattatgattatcattcctcaagtgagaagctgaaggaaaggccaagttccagagaggacacgccgagcagattgtccaggatgggtgcgacacccactccctttaagtccacaggggatattgcaggcacagttgtcccagagaccaacaaggaacccagataccaagaggaccccccagctcctcaaccaaaagcagccccgagaacttttcttcgtcctagtcctgaagatgaagcaatatatggccctaataccaaaatggtaaggttcaagaagggagacagcgtgggcctccggttggctggtggcaatgatgtcgggatatttgttgctggcattcaagaagggacctcggcggagcaggagggccttcaagaaggagaccagattctgaaggtgaacacacaggatttcagaggattagtgcgggaggatgccgttctctacctgttagaaatccctaaaggtgaaatggtgaccattttagctcagagccgagccgatgtgtatagagacatcctggcttgtggcagaggggattcgttttttataagaagccactttgaatgtgagaaggaaactccacagagcctggccttcaccagaggggaggtcttccgagtggtagacacactgtatgacggcaagctgggcaactggctggctgtgaggattgggaacgagttggagaaaggcttaatccccaacaagagcagagctgaacaaatggccagtgttcaaaatgcccagagagacaacgctggggaccgggcagatttctggagaatgcgtggccagaggtctggggtgaagaagaacctgaggaaaagtcgggaagacctcacagctgttgtgtctgtcagcaccaagttcccagcttatgagagggttttgctgcgagaagctggtttcaagagacctgtggtcttattcggccccatagctgatatagcaatggaaaaattggctaatgagttacctgactggtttcaaactgctaaaacggaaccaaaagatgcaggatctgagaaatccactggagtggtccggttaaataccgtgaggcaaattattgaacaggataagcatgcactactggatgtgactccgaaagctgtggacctgttgaattacacccagtggttcccaattgtgatttttttcaacccagactccagacaaggtgtcaaaaccatgagacaaaggttaaatccaacgtccaacaaaagttctcgaaagttatttgatcaagccaacaagcttaaaaaaacgtgtgcacacctttttacagctacaatcaacctaaattcagccaatgatagctggtttggcagcttaaaggacactattcagcatcagcaaggagaagcggtttgggtctctgaaggaaagatggaagggatggatgatgaccccgaagaccgcatgtcctacttaaccgccatgggcgcggactatctgagttgcgacagccgcctcatcagtgactttgaagacacggacggtgaaggaggcgcctacactgacaatgagctggatgagccagccgaggagccgctggtgtcgtccatcacccgctcctcggagccggtgcagcacgaggagagcataaggaaacccagcccagagccacgagctcagatgaggagggctgctagcagcgatcaacttagggacaatagcccgcccccagcattcaagccagagccgcccaaggccaaaacccagaacaaagaagaatcctatgacttctccaaatcctatgaatataagtcaaacccctctgccgttgctggtaatgaaactcctggggcatctaccaaaggttatcctcctcctgttgcagcaaaacctacctttgggcggtctatactgaagccctccactcccatccctcctcaagagggtgaggaggtgggagagagcagtgaggagcaagataatgctcccaaatcagtcctgggcaaagtcaaaatatttgagaagatggatcacaaggccaggttacagagaatgcaggagctccaggaagcacagaatgcaaggatcgaaattgcccagaagcatcctgatatctatgcagttccaatcaaaacgcacaagccagaccctggcacgccccagcacacgagttccagaccccctgagccacagaaagctccttccagaccttatcaggataccagaggaagttatggcagtgatgccgaggaggaggagtaccgccagcagctgtcagaacactccaagcgcggttactatggccagtctgcccgataccgggacacagaattatagatgtctgagcacggactctcccaggcctgcctgcatggcatcagactagccactcctgccaggccgccgggatggttcttctccagttagaatgcaccatggagacgtggtgggactccagctcgtgtgtcctcatggagaacccaggggacagctggtgcaaattcagaactgagggctctgtttgtgggactgggttagaggagtctgtggctttttgttcagaattaagcagaacactgcagtcagatcctgttacttgcttcagtggaccgaaatctgtattctgtttgcgtacttgtaatatgtatattaagaagcaataactatttttcctcattaatagctgccttcaaggactgtttcagtgtgagtcagaatgtgaaaaaggaataaaaaatactgttgggctcaaactaaattcaaagaagtactttattgcaactcttttaagtgccttggatgagaagtgtcttaaattttcttcctttgaagctttaggcagagccataatggactaaaacattttgactaagtttttataccagcttaatagctgtagttttccctgcactgtgtcatcttttcaaggcatttgtctttgtaatattttccataaatttggactgtctatatcataactatacttgatagtttggctataagtgctcaatagcttgaagcccaagaagttggtatcgaaatttgttgtttgtttaaacccaagtgctgcacaaaagcagatacttgaggaaaacactatttccaaaagcacatgtattgacaacagttttataatttaataaaaaggaatacattgcaatccgtaatttt
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:9414 -> Molecular function: GO:0004385 [guanylate kinase activity] evidence: TAS
GeneID:9414 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:9414 -> Biological process: GO:0006915 [apoptotic process] evidence: TAS
GeneID:9414 -> Biological process: GO:0006921 [cellular component disassembly involved in execution phase of apoptosis] evidence: TAS
GeneID:9414 -> Biological process: GO:0035329 [hippo signaling cascade] evidence: TAS
GeneID:9414 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
GeneID:9414 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:9414 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
GeneID:9414 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
GeneID:9414 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS
GeneID:9414 -> Cellular component: GO:0005912 [adherens junction] evidence: IEA
GeneID:9414 -> Cellular component: GO:0005923 [tight junction] evidence: IDA
GeneID:9414 -> Cellular component: GO:0030054 [cell junction] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.