Home |
Help |
Advanced search
2024-04-20 12:10:35, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_004574 1858 bp mRNA linear PRI 15-JUL-2013
DEFINITION Homo sapiens septin 4 (SEPT4), transcript variant 1, mRNA.
ACCESSION NM_004574
VERSION NM_004574.3 GI:311201830
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1858)
AUTHORS Kim,J.B., Kim,S.Y., Kim,B.M., Lee,H., Kim,I., Yun,J., Jo,Y., Oh,T.,
Jo,Y., Chae,H.D. and Shin,D.Y.
TITLE Identification of a novel anti-apoptotic E3 ubiquitin ligase that
ubiquitinates antagonists of inhibitor of apoptosis proteins SMAC,
HtrA2, and ARTS
JOURNAL J. Biol. Chem. 288 (17), 12014-12021 (2013)
PUBMED 23479728
REMARK GeneRIF: Identification of a novel anti-apoptotic E3 ubiquitin
ligase that ubiquitinates antagonists of inhibitor of apoptosis
proteins SMAC, HtrA2, and ARTS.
REFERENCE 2 (bases 1 to 1858)
AUTHORS Bongiovanni,L., Pirozzi,F., Guidi,F., Orsini,M., Chiurazzi,P.,
Bassi,P.F. and Racioppi,M.
TITLE Bradeion (SEPT4) as a urinary marker of transitional cell bladder
cancer: a real-time polymerase chain reaction study of gene
expression
JOURNAL J. Urol. 187 (6), 2223-2227 (2012)
PUBMED 22503047
REMARK GeneRIF: Bradeion/SEPT4 transcript levels are significantly
increased in patients with transitional cell bladder cancer.We
hypothesize that Bradeion is directly involved in bladder cancer
pathogenesis with the highest expression at early cancer stages.
REFERENCE 3 (bases 1 to 1858)
AUTHORS Shen,S., Liu,M., Wu,Y., Saiyin,H., Liu,G. and Yu,L.
TITLE Involvement of SEPT4_i1 in hepatocellular carcinoma: SEPT4_i1
regulates susceptibility to apoptosis in hepatocellular carcinoma
cells
JOURNAL Mol. Biol. Rep. 39 (4), 4519-4526 (2012)
PUBMED 21952823
REMARK GeneRIF: these data suggests a tumor suppressor role of SEPT4_i1 in
HCC through regulating hepatocellular carcinoma cell apoptosis.
REFERENCE 4 (bases 1 to 1858)
AUTHORS Liu,W.
TITLE SEPT4 is regulated by the Notch signaling pathway
JOURNAL Mol. Biol. Rep. 39 (4), 4401-4409 (2012)
PUBMED 21938432
REMARK GeneRIF: SEPT4 is a Notch target gene.
REFERENCE 5 (bases 1 to 1858)
AUTHORS Larisch,S.
TITLE The ARTS connection: role of ARTS in apoptosis and cancer
JOURNAL Cell Cycle 3 (8), 1021-1023 (2004)
PUBMED 15254396
REMARK Review article
REFERENCE 6 (bases 1 to 1858)
AUTHORS Tanaka,M., Tanaka,T., Kijima,H., Itoh,J., Matsuda,T., Hori,S. and
Yamamoto,M.
TITLE Characterization of tissue- and cell-type-specific expression of a
novel human septin family gene, Bradeion
JOURNAL Biochem. Biophys. Res. Commun. 286 (3), 547-553 (2001)
PUBMED 11511094
REFERENCE 7 (bases 1 to 1858)
AUTHORS Zieger,B., Tran,H., Hainmann,I., Wunderle,D., Zgaga-Griesz,A.,
Blaser,S. and Ware,J.
TITLE Characterization and expression analysis of two human septin genes,
PNUTL1 and PNUTL2
JOURNAL Gene 261 (2), 197-203 (2000)
PUBMED 11167005
REFERENCE 8 (bases 1 to 1858)
AUTHORS Larisch,S., Yi,Y., Lotan,R., Kerner,H., Eimerl,S., Tony Parks,W.,
Gottfried,Y., Birkey Reffey,S., de Caestecker,M.P., Danielpour,D.,
Book-Melamed,N., Timberg,R., Duckett,C.S., Lechleider,R.J.,
Steller,H., Orly,J., Kim,S.J. and Roberts,A.B.
TITLE A novel mitochondrial septin-like protein, ARTS, mediates apoptosis
dependent on its P-loop motif
JOURNAL Nat. Cell Biol. 2 (12), 915-921 (2000)
PUBMED 11146656
REFERENCE 9 (bases 1 to 1858)
AUTHORS Paavola,P., Horelli-Kuitunen,N., Palotie,A. and Peltonen,L.
TITLE Characterization of a novel gene, PNUTL2, on human chromosome
17q22-q23 and its exclusion as the Meckel syndrome gene
JOURNAL Genomics 55 (1), 122-125 (1999)
PUBMED 9889007
REFERENCE 10 (bases 1 to 1858)
AUTHORS Xie,H., Surka,M., Howard,J. and Trimble,W.S.
TITLE Characterization of the mammalian septin H5: distinct patterns of
cytoskeletal and membrane association from other septin proteins
JOURNAL Cell Motil. Cytoskeleton 43 (1), 52-62 (1999)
PUBMED 10340703
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from DA076433.1, AF073312.1 and
AK294094.1.
On Nov 5, 2010 this sequence version replaced gi:17986250.
Summary: This gene is a member of the septin family of nucleotide
binding proteins, originally described in yeast as cell division
cycle regulatory proteins. Septins are highly conserved in yeast,
Drosophila, and mouse, and appear to regulate cytoskeletal
organization. Disruption of septin function disturbs cytokinesis
and results in large multinucleate or polyploid cells. This gene is
highly expressed in brain and heart. Alternatively spliced
transcript variants encoding different isoforms have been described
for this gene. One of the isoforms (known as ARTS) is distinct; it
is localized to the mitochondria, and has a role in apoptosis and
cancer. [provided by RefSeq, Nov 2010].
Transcript Variant: This variant (1) differs in the 5' UTR and
coding region and initiates translation at an alternate start
codon, compared to variant 7. It encodes isoform 1 (also known as
PNUTL2a, H5, SEPT4_i1, bradeion beta, hcdcrel2a) which contains a
distinct N-terminus and is shorter, compared to isoform 5.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AB008753.1, AF073312.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
##RefSeq-Attributes-START##
gene product(s) localized to mito. :: reported by MitoCarta
##RefSeq-Attributes-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-558 DA076433.1 1-558
559-1851 AF073312.1 440-1732
1852-1858 AK294094.1 1705-1711
FEATURES Location/Qualifiers
source 1..1858
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="17"
/map="17q22"
gene 1..1858
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
/note="septin 4"
/db_xref="GeneID:5414"
/db_xref="HGNC:9165"
/db_xref="HPRD:04738"
/db_xref="MIM:603696"
exon 1..303
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
/inference="alignment:Splign:1.39.8"
CDS 244..1680
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
/note="isoform 1 is encoded by transcript variant 1;
septin-M; cell division control-related protein 2;
cerebral protein 7; CE5B3 beta; bradeion beta; brain
protein H5; peanut-like protein 2; apoptosis-related
protein in the TGF-beta signaling pathway"
/codon_start=1
/product="septin-4 isoform 1"
/protein_id="NP_004565.1"
/db_xref="GI:4758942"
/db_xref="CCDS:CCDS11610.1"
/db_xref="GeneID:5414"
/db_xref="HGNC:9165"
/db_xref="HPRD:04738"
/db_xref="MIM:603696"
/translation="
MDRSLGWQGNSVPEDRTEAGIKRFLEDTTDDGELSKFVKDFSGNASCHPPEAKTWASRPQVPEPRPQAPDLYDDDLEFRPPSRPQSSDNQQYFCAPAPLSPSARPRSPWGKLDPYDSSEDDKEYVGFATLPNQVHRKSVKKGFDFTLMVAGESGLGKSTLVNSLFLTDLYRDRKLLGAEERIMQTVEITKHAVDIEEKGVRLRLTIVDTPGFGDAVNNTECWKPVAEYIDQQFEQYFRDESGLNRKNIQDNRVHCCLYFISPFGHGLRPLDVEFMKALHQRVNIVPILAKADTLTPPEVDHKKRKIREEIEHFGIKIYQFPDCDSDEDEDFKLQDQALKESIPFAVIGSNTVVEARGRRVRGRLYPWGIVEVENPGHCDFVKLRTMLVRTHMQDLKDVTRETHYENYRAQCIQSMTRLVVKERNRNKLTRESGTDFPIPAVPPGTDPETEKLIREKDEELRRMQEMLHKIQKQMKENY
"
misc_feature 664..1506
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
/note="Septin; Region: Septin; pfam00735"
/db_xref="CDD:201420"
misc_feature 664..1488
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
/note="CDC/Septin GTPase family; Region: CDC_Septin;
cd01850"
/db_xref="CDD:206649"
misc_feature 694..717
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
/note="G1 box; other site"
/db_xref="CDD:206649"
misc_feature order(700..720,865..867,874..876,1108..1113,1117..1119,
1285..1290)
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
/note="GTP/Mg2+ binding site [chemical binding]; other
site"
/db_xref="CDD:206649"
misc_feature 790..816
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
/note="Switch I region; other site"
/db_xref="CDD:206649"
misc_feature 796..798
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
/note="G2 box; other site"
/db_xref="CDD:206649"
misc_feature 865..876
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
/note="G3 box; other site"
/db_xref="CDD:206649"
misc_feature order(871..978,979..1008)
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
/note="Switch II region; other site"
/db_xref="CDD:206649"
misc_feature 1108..1119
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
/note="G4 box; other site"
/db_xref="CDD:206649"
misc_feature 1216..1218
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(O43236.1); phosphorylation site"
misc_feature 1285..1293
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
/note="G5 box; other site"
/db_xref="CDD:206649"
exon 304..600
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
/inference="alignment:Splign:1.39.8"
exon 601..694
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
/inference="alignment:Splign:1.39.8"
exon 695..781
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
/inference="alignment:Splign:1.39.8"
exon 782..905
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
/inference="alignment:Splign:1.39.8"
exon 906..1040
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
/inference="alignment:Splign:1.39.8"
exon 1041..1158
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
/inference="alignment:Splign:1.39.8"
exon 1159..1260
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
/inference="alignment:Splign:1.39.8"
exon 1261..1357
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
/inference="alignment:Splign:1.39.8"
variation 1317
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
/replace="a"
/replace="g"
/db_xref="dbSNP:1057065"
exon 1358..1520
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
/inference="alignment:Splign:1.39.8"
variation 1440
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
/replace="a"
/replace="g"
/db_xref="dbSNP:1057068"
exon 1521..1620
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
/inference="alignment:Splign:1.39.8"
exon 1621..1856
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
/inference="alignment:Splign:1.39.8"
STS 1702..1831
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
/standard_name="SHGC-32067"
/db_xref="UniSTS:3539"
STS 1702..1826
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
/standard_name="WI-15444"
/db_xref="UniSTS:63743"
STS 1708..1791
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
/standard_name="D17S1387E"
/db_xref="UniSTS:56083"
polyA_signal 1823..1828
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
polyA_signal 1833..1838
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
polyA_site 1851
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
polyA_site 1856
/gene="SEPT4"
/gene_synonym="ARTS; BRADEION; CE5B3; H5; hCDCREL-2;
hucep-7; MART; PNUTL2; SEP4"
ORIGIN
gagctgtccttggagggtgggagccaagggaaggggaggagaagaggggtggggaaggacattccacaggcttttttggcccctgccagagacagaagggggtcaaagagaaagggaaaggagcaagccaggaagccagacaacaacagcatcaaaacaaggctgtttctgtgtgtgaggaactttgcctgggagataaaattagacctagagctttctgacagggagtctgaagcgtgggacatggaccgttcactgggatggcaagggaattctgtccctgaggacaggactgaagctgggatcaagcgtttcctggaggacaccacggatgatggagaactgagcaagttcgtgaaggatttctcaggaaatgcgagctgccacccaccagaggctaagacctgggcatccaggccccaagtcccggagccaaggccccaggccccggacctctatgatgatgacctggagttcagacccccctcgcggccccagtcctctgacaaccagcagtacttctgtgccccagcccctctcagcccatctgccaggccccgcagcccatggggcaagcttgatccctatgattcctctgaggatgacaaggagtatgtgggctttgcaaccctccccaaccaagtccaccgaaagtccgtgaagaaaggctttgactttaccctcatggtggcaggagagtctggcctgggcaaatccacacttgtcaatagcctcttcctcactgatctgtaccgggaccggaaacttcttggtgctgaagagaggatcatgcaaactgtggagatcactaagcatgcagtggacatagaagagaagggtgtgaggctgcggctcaccattgtggacacaccaggttttggggatgcagtcaacaacacagagtgctggaagcctgtggcagaatacattgatcagcagtttgagcagtatttccgagacgagagtggcctgaaccgaaagaacatccaagacaacagggtgcactgctgcctgtacttcatctcacccttcggccatgggctccggccattggatgttgaattcatgaaggccctgcatcagcgggtcaacatcgtgcctatcctggctaaggcagacacactgacacctcccgaagtggaccacaagaaacgcaaaatccgggaggagattgagcattttggaatcaagatctatcaattcccagactgtgactctgatgaggatgaggacttcaaattgcaggaccaagccctaaaggaaagcatcccatttgcagtaattggcagcaacactgtagtagaggccagagggcggcgagttcggggtcgactctacccctggggcatcgtggaagtggaaaacccagggcactgcgactttgtgaagctgaggacaatgctggtacgtacccacatgcaggacctgaaggatgtgacacgggagacacattatgagaactaccgggcacagtgcatccagagcatgacccgcctggtggtgaaggaacggaatcgcaacaaactgactcgggaaagtggtaccgacttccccatccctgctgtcccaccagggacagatccagaaactgagaagcttatccgagagaaagatgaggagctgcggcggatgcaggagatgctacacaaaatacaaaaacagatgaaggagaactattaactggctttcagccctggatatttaaatctcctcctcttcttcctgtccatgccggcccctcccagcaccagctctgctcaggccccttcagctactgccacttcgccttacatccctgctgactgcccagagactcagaggaaataaagtttaataaatctgtaggtggcttctggaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:5414 -> Molecular function: GO:0003924 [GTPase activity] evidence: TAS
GeneID:5414 -> Molecular function: GO:0005198 [structural molecule activity] evidence: TAS
GeneID:5414 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:5414 -> Molecular function: GO:0005525 [GTP binding] evidence: IEA
GeneID:5414 -> Biological process: GO:0000910 [cytokinesis] evidence: TAS
GeneID:5414 -> Biological process: GO:0006184 [GTP catabolic process] evidence: TAS
GeneID:5414 -> Biological process: GO:0006915 [apoptotic process] evidence: NAS
GeneID:5414 -> Biological process: GO:0007420 [brain development] evidence: IEA
GeneID:5414 -> Biological process: GO:0030382 [sperm mitochondrion organization] evidence: IEA
GeneID:5414 -> Biological process: GO:0031398 [positive regulation of protein ubiquitination] evidence: IDA
GeneID:5414 -> Biological process: GO:0042981 [regulation of apoptotic process] evidence: NAS
GeneID:5414 -> Biological process: GO:0043065 [positive regulation of apoptotic process] evidence: IDA
GeneID:5414 -> Biological process: GO:0048240 [sperm capacitation] evidence: IEA
GeneID:5414 -> Biological process: GO:2001244 [positive regulation of intrinsic apoptotic signaling pathway] evidence: IMP
GeneID:5414 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:5414 -> Cellular component: GO:0005634 [nucleus] evidence: NAS
GeneID:5414 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
GeneID:5414 -> Cellular component: GO:0005739 [mitochondrion] evidence: NAS
GeneID:5414 -> Cellular component: GO:0005856 [cytoskeleton] evidence: IEA
GeneID:5414 -> Cellular component: GO:0031514 [motile cilium] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.