GGRNA Home | Help | Advanced search

2024-04-26 01:15:54, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_004540               5006 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens neural cell adhesion molecule 2 (NCAM2), mRNA.
ACCESSION   NM_004540
VERSION     NM_004540.3  GI:316659209
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 5006)
  AUTHORS   Fox,C.S., Liu,Y., White,C.C., Feitosa,M., Smith,A.V.,
            Heard-Costa,N., Lohman,K., Johnson,A.D., Foster,M.C.,
            Greenawalt,D.M., Griffin,P., Ding,J., Newman,A.B., Tylavsky,F.,
            Miljkovic,I., Kritchevsky,S.B., Launer,L., Garcia,M.,
            Eiriksdottir,G., Carr,J.J., Gudnason,V., Harris,T.B., Cupples,L.A.
            and Borecki,I.B.
  CONSRTM   GIANT Consortium; MAGIC Consortium; GLGC Consortium
  TITLE     Genome-wide association for abdominal subcutaneous and visceral
            adipose reveals a novel locus for visceral fat in women
  JOURNAL   PLoS Genet. 8 (5), E1002695 (2012)
   PUBMED   22589738
REFERENCE   2  (bases 1 to 5006)
  AUTHORS   Takahashi,S., Kato,K., Nakamura,K., Nakano,R., Kubota,K. and
            Hamada,H.
  TITLE     Neural cell adhesion molecule 2 as a target molecule for prostate
            and breast cancer gene therapy
  JOURNAL   Cancer Sci. 102 (4), 808-814 (2011)
   PUBMED   21214674
  REMARK    GeneRIF: High NCAM2 is associated with increased 5-Fluorouracil
            sensitivity in prostate and breast cancer.
REFERENCE   3  (bases 1 to 5006)
  AUTHORS   Kulahin,N., Kristensen,O., Rasmussen,K.K., Olsen,L., Rydberg,P.,
            Vestergaard,B., Kastrup,J.S., Berezin,V., Bock,E., Walmod,P.S. and
            Gajhede,M.
  TITLE     Structural model and trans-interaction of the entire ectodomain of
            the olfactory cell adhesion molecule
  JOURNAL   Structure 19 (2), 203-211 (2011)
   PUBMED   21300289
  REMARK    GeneRIF: A complete structural model of the entire ectodomain of
            human NCAM2 has been assembled from crystal structures of six
            recombinant proteins corresponding to different regions of the
            ectodomain.
REFERENCE   4  (bases 1 to 5006)
  AUTHORS   Wang,K., Li,W.D., Zhang,C.K., Wang,Z., Glessner,J.T., Grant,S.F.,
            Zhao,H., Hakonarson,H. and Price,R.A.
  TITLE     A genome-wide association study on obesity and obesity-related
            traits
  JOURNAL   PLoS ONE 6 (4), E18939 (2011)
   PUBMED   21552555
  REMARK    Erratum:[PLoS One. 2012;7(2). doi:
            10.1371/annotation/a34ee94e-3e6a-48bd-a19e-398a4bb88580]
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 5006)
  AUTHORS   Han,M.R., Schellenberg,G.D. and Wang,L.S.
  CONSRTM   Alzheimer's Disease Neuroimaging Initiative
  TITLE     Genome-wide association reveals genetic effects on human Abeta42
            and tau protein levels in cerebrospinal fluids: a case control
            study
  JOURNAL   BMC Neurol 10, 90 (2010)
   PUBMED   20932310
  REMARK    GeneRIF: Observational study and genome-wide association study of
            gene-disease association. (HuGE Navigator)
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 5006)
  AUTHORS   Rasmussen,K.K., Kulahin,N., Kristensen,O., Poulsen,J.C.,
            Sigurskjold,B.W., Kastrup,J.S., Berezin,V., Bock,E., Walmod,P.S.
            and Gajhede,M.
  TITLE     Crystal structure of the Ig1 domain of the neural cell adhesion
            molecule NCAM2 displays domain swapping
  JOURNAL   J. Mol. Biol. 382 (5), 1113-1120 (2008)
   PUBMED   18706912
  REMARK    GeneRIF: In the crystal structure, two Ig domains interact by
            domain swapping, as the two N-terminal beta-strands are
            interchanged.
REFERENCE   7  (bases 1 to 5006)
  AUTHORS   Schmitt-Ulms,G., Hansen,K., Liu,J., Cowdrey,C., Yang,J.,
            DeArmond,S.J., Cohen,F.E., Prusiner,S.B. and Baldwin,M.A.
  TITLE     Time-controlled transcardiac perfusion cross-linking for the study
            of protein interactions in complex tissues
  JOURNAL   Nat. Biotechnol. 22 (6), 724-731 (2004)
   PUBMED   15146195
REFERENCE   8  (bases 1 to 5006)
  AUTHORS   Zhang,H., Li,X.J., Martin,D.B. and Aebersold,R.
  TITLE     Identification and quantification of N-linked glycoproteins using
            hydrazide chemistry, stable isotope labeling and mass spectrometry
  JOURNAL   Nat. Biotechnol. 21 (6), 660-666 (2003)
   PUBMED   12754519
REFERENCE   9  (bases 1 to 5006)
  AUTHORS   Alenius,M. and Bohm,S.
  TITLE     Differential function of RNCAM isoforms in precise target selection
            of olfactory sensory neurons
  JOURNAL   Development 130 (5), 917-927 (2003)
   PUBMED   12538518
REFERENCE   10 (bases 1 to 5006)
  AUTHORS   Paoloni-Giacobino,A., Chen,H. and Antonarakis,S.E.
  TITLE     Cloning of a novel human neural cell adhesion molecule gene (NCAM2)
            that maps to chromosome region 21q21 and is potentially involved in
            Down syndrome
  JOURNAL   Genomics 43 (1), 43-51 (1997)
   PUBMED   9226371
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BC052946.1, AP001115.1 and
            AI207079.1.
            On Jan 4, 2011 this sequence version replaced gi:33519480.
            
            Summary: The protein encoded by this gene belongs to the
            immunoglobulin superfamily. It is a type I membrane protein and may
            function in selective fasciculation and zone-to-zone projection of
            the primary olfactory axons. [provided by RefSeq, Jul 2008].
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC052946.1, BC036088.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025082, ERS025084 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-3580              BC052946.1         1-3580
            3581-4688           AP001115.1         6201-7308
            4689-5006           AI207079.1         1-318               c
FEATURES             Location/Qualifiers
     source          1..5006
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="21"
                     /map="21q21.1"
     gene            1..5006
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /note="neural cell adhesion molecule 2"
                     /db_xref="GeneID:4685"
                     /db_xref="HGNC:7657"
                     /db_xref="HPRD:03619"
                     /db_xref="MIM:602040"
     exon            1..304
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /inference="alignment:Splign:1.39.8"
     variation       53
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374091153"
     misc_feature    67..69
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /note="upstream in-frame stop codon"
     variation       82
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367957001"
     variation       233
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371712887"
     variation       240
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201169186"
     CDS             250..2763
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /note="NCAM-2; N-CAM-2"
                     /codon_start=1
                     /product="neural cell adhesion molecule 2 precursor"
                     /protein_id="NP_004531.2"
                     /db_xref="GI:33519481"
                     /db_xref="CCDS:CCDS42910.1"
                     /db_xref="GeneID:4685"
                     /db_xref="HGNC:7657"
                     /db_xref="HPRD:03619"
                     /db_xref="MIM:602040"
                     /translation="
MSLLLSFYLLGLLVSSGQALLQVTISLSKVELSVGESKFFTCTAIGEPESIDWYNPQGEKIISTQRVVVQKEGVRSRLTIYNANIEDAGIYRCQATDAKGQTQEATVVLEIYQKLTFREVVSPQEFKQGEDAEVVCRVSSSPAPAVSWLYHNEEVTTISDNRFAMLANNNLQILNINKSDEGIYRCEGRVEARGEIDFRDIIVIVNVPPAISMPQKSFNATAERGEEMTFSCRASGSPEPAISWFRNGKLIEENEKYILKGSNTELTVRNIINSDGGPYVCRATNKAGEDEKQAFLQVFVQPHIIQLKNETTYENGQVTLVCDAEGEPIPEITWKRAVDGFTFTEGDKSLDGRIEVKGQHGSSSLHIKDVKLSDSGRYDCEAASRIGGHQKSMYLDIEYAPKFISNQTIYYSWEGNPINISCDVKSNPPASIHWRRDKLVLPAKNTTNLKTYSTGRKMILEIAPTSDNDFGRYNCTATNHIGTRFQEYILALADVPSSPYGVKIIELSQTTAKVSFNKPDSHGGVPIHHYQVDVKEVASEIWKIVRSHGVQTMVVLNNLEPNTTYEIRVAAVNGKGQGDYSKIEIFQTLPVREPSPPSIHGQPSSGKSFKLSITKQDDGGAPILEYIVKYRSKDKEDQWLEKKVQGNKDHIILEHLQWTMGYEVQITAANRLGYSEPTVYEFSMPPKPNIIKDTLFNGLGLGAVIGLGVAALLLILVVTDVSCFFIRQCGLLMCITRRMCGKKSGSSGKSKELEEGKAAYLKDGSKEPIVEMRTEDERVTNHEDGSPVNEPNETTPLTEPEKLPLKEEDGKEALNPETIEIKVSNDIIQSKEDDSKA
"
     sig_peptide     250..306
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     mat_peptide     307..2760
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /product="Neural cell adhesion molecule 2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O15394.2)"
     misc_feature    310..585
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /note="First immunoglobulin (Ig)-like domain of neural
                     cell adhesion molecule NCAM-2; Region: Ig1_NCAM-2;
                     cd05866"
                     /db_xref="CDD:143274"
     misc_feature    313..582
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    order(355..357,361..366)
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:143274"
     misc_feature    595..828
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    631..816
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /note="Immunoglobulin C-2 Type; Region: IGc2; smart00408"
                     /db_xref="CDD:197706"
     misc_feature    871..1152
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    892..1143
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    1147..1440
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /note="Fifth immunoglobulin (Ig)-like domain of Neural
                     Cell Adhesion Molecule NCAM-2 (also known as OCAM/mamFas
                     II and RNCAM); Region: Ig5_NCAM-2; cd05870"
                     /db_xref="CDD:143278"
     misc_feature    1501..1698
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    1735..2013
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(1735..1737,1930..1932,1975..1977)
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(1978..1983,1987..1992)
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    2029..2283
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(2029..2031,2221..2223,2266..2268)
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(2269..2274,2278..2283)
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    2341..2403
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O15394.2);
                     transmembrane region"
     variation       261
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368840931"
     variation       267
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201622691"
     variation       272
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192751071"
     variation       297
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116546079"
     exon            305..379
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /inference="alignment:Splign:1.39.8"
     variation       313
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200376885"
     variation       332
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373572347"
     exon            380..586
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /inference="alignment:Splign:1.39.8"
     variation       451
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368265311"
     variation       454
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371967791"
     variation       487
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190353867"
     variation       495
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182642680"
     variation       502
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199788139"
     variation       510
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375059644"
     variation       524
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370033455"
     variation       549
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:199783337"
     variation       562
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373062950"
     exon            587..730
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /inference="alignment:Splign:1.39.8"
     variation       612
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377268529"
     variation       645
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369453911"
     variation       659
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188667430"
     variation       667
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200645709"
     variation       698
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377546997"
     variation       700
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370615799"
     variation       721
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373022329"
     exon            731..868
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /inference="alignment:Splign:1.39.8"
     variation       748
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374401078"
     variation       753
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145537614"
     variation       787
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371793861"
     variation       795
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376209656"
     variation       796
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185885193"
     exon            869..986
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /inference="alignment:Splign:1.39.8"
     variation       873
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200660519"
     variation       874
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375644333"
     variation       924
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200071466"
     variation       929
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369385488"
     variation       969
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372783673"
     exon            987..1147
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /inference="alignment:Splign:1.39.8"
     variation       1017
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201388906"
     variation       1022
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201863336"
     variation       1049
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181082007"
     variation       1077
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183863673"
     exon            1148..1293
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /inference="alignment:Splign:1.39.8"
     variation       1210
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371257511"
     variation       1220
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373865162"
     variation       1221
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192323183"
     variation       1234
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371618690"
     variation       1241
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201849934"
     variation       1258
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374986975"
     variation       1288
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35654962"
     exon            1294..1444
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /inference="alignment:Splign:1.39.8"
     variation       1298
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:232518"
     variation       1307
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372471672"
     variation       1312
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201907310"
     variation       1326
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375115280"
     exon            1445..1632
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /inference="alignment:Splign:1.39.8"
     variation       1467
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369013380"
     variation       1497
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201042589"
     variation       1557
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182238995"
     variation       1624
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370667294"
     exon            1633..1729
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /inference="alignment:Splign:1.39.8"
     variation       1640
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:367607910"
     variation       1671
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:986371"
     variation       1707
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201931205"
     exon            1730..1903
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /inference="alignment:Splign:1.39.8"
     variation       1731
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199571975"
     variation       1746
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185457460"
     variation       1747
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201396138"
     variation       1749
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368831351"
     variation       1773
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189917854"
     variation       1783
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375854261"
     variation       1806
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370200278"
     variation       1837
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201558975"
     variation       1855
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373091914"
     variation       1863
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377668299"
     variation       1886
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373557277"
     variation       1891..1892
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35592118"
     exon            1904..2023
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /inference="alignment:Splign:1.39.8"
     variation       1929
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186217734"
     variation       1941
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370058893"
     variation       1944
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190741777"
     variation       1950
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1059062"
     exon            2024..2145
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /inference="alignment:Splign:1.39.8"
     variation       2100
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371587120"
     variation       2143
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199790866"
     variation       2145
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201578279"
     exon            2146..2326
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /inference="alignment:Splign:1.39.8"
     variation       2152
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201923816"
     variation       2199
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371365100"
     variation       2206
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143579715"
     variation       2232
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369824131"
     variation       2307
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373825696"
     exon            2327..2531
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /inference="alignment:Splign:1.39.8"
     variation       2361
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:146260588"
     variation       2366
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370874916"
     variation       2406
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2017705"
     variation       2478
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376916039"
     variation       2490
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199849179"
     variation       2505
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200071566"
     exon            2532..2651
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /inference="alignment:Splign:1.39.8"
     variation       2588
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372189468"
     variation       2613
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376609572"
     exon            2652..5002
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /inference="alignment:Splign:1.39.8"
     variation       2659
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370098612"
     variation       2663
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200849313"
     variation       2690
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372354690"
     variation       2704
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377126033"
     variation       2714
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200269454"
     variation       2724
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141499528"
     variation       2725
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376541267"
     variation       2734
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150466591"
     variation       2748
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372679606"
     variation       2769
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376424506"
     variation       2771
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371111387"
     variation       2777
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374214782"
     variation       2781
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138211870"
     variation       2801
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377288652"
     variation       2813
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149595362"
     STS             2823..3550
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /standard_name="NCAM2"
                     /db_xref="UniSTS:266420"
     variation       3019
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115974435"
     variation       3086..3089
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace=""
                     /replace="tatt"
                     /db_xref="dbSNP:373439061"
     variation       3127
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:76145255"
     variation       3128
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:74455293"
     variation       3129..3130
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:11398016"
     variation       3129
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:75973494"
     variation       3243
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:193230694"
     variation       3269
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144224108"
     variation       3275
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2826892"
     variation       3435
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140004991"
     variation       3439
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:141962625"
     variation       3468
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146019015"
     polyA_signal    3553..3558
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
     variation       3576
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375571711"
     polyA_site      3584
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
     variation       3609..3610
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace=""
                     /replace="at"
                     /db_xref="dbSNP:140516043"
     variation       3881
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:9982042"
     variation       3884
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139994201"
     variation       3921
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114266934"
     variation       3982
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:75567000"
     variation       3996
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17003886"
     variation       4044..4045
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:34336002"
     variation       4045
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:142165520"
     variation       4118
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185301591"
     variation       4156
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:377756584"
     variation       4225
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:188899203"
     variation       4226
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151203363"
     variation       4257
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191895244"
     variation       4391
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75722922"
     variation       4468
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369674790"
     variation       4505
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17807776"
     variation       4516
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2826893"
     variation       4598
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184023496"
     variation       4704
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1059065"
     variation       4714
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1136456"
     variation       4719
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1059066"
     variation       4724..4728
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace=""
                     /replace="tttgt"
                     /db_xref="dbSNP:370856648"
     variation       4726
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1059067"
     variation       4731
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1059068"
     variation       4736
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1059069"
     variation       4739
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:373450121"
     variation       4798
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1059070"
     STS             4809..4956
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /standard_name="RH92742"
                     /db_xref="UniSTS:91562"
     variation       4812
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139085311"
     variation       4838
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:372664773"
     variation       4855
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:377438608"
     variation       4967
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188415861"
     polyA_signal    4969..4974
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
     variation       4979
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369919953"
     polyA_site      5002
                     /gene="NCAM2"
                     /gene_synonym="NCAM21"
ORIGIN      
gctgccgccgcggcggccgctgctgctgctgcttctgccgccgctgccgccgccgctgcctggatatagtgcggcaagagcggagcttgcagtcactttgcgaggaggagcgcgcgggctgcgggcggctggggcaccgcgggagcggcggcggcggctctagcagaggcggccggggcagcgaaaggttctctctccagggctggacttaataactttgaaactgtccaccggtgtcacgtcctgaacatgagcctcctcctctccttctacctgctggggttgcttgtcagtagcgggcaagctcttcttcaagtgacaatttcacttagcaaagtagagcttagtgttggagaatctaaattcttcacatgtacagcgattggtgaacctgaaagtatagattggtataatcctcaaggagagaagataatttcaacacagagggtagtagtgcaaaaggaaggtgttaggtcacggttaaccatctacaatgcaaatatagaagatgcagggatatatcgttgtcaagcaacagatgccaaaggacaaacacaagaagctacagtagttttggaaatttaccaaaaactcactttcagagaagtggtatctccacaagaattcaaacaaggagaagatgcagaagtggtttgccgagttagcagttcacctgcacctgctgtcagctggttgtatcataatgaggaagtcaccactatttccgacaatcggttcgctatgttagcaaacaataacctgcagattctcaacatcaataaaagtgatgaaggtatatacagatgtgaaggaagagtggaggccaggggagaaattgacttccgtgatatcattgttattgttaatgtgccgccagcaatctcaatgcctcagaaatcttttaatgccacagcagagagaggagaagaaatgacattttcctgcagggcctcaggctctccagaacccgccatctcctggttcaggaatggcaagctcattgaagaaaatgagaagtacatattgaaagggagcaatacagaactcactgtcaggaacataatcaatagtgatggtggtccttatgtctgcagggccacaaataaggcaggagaagatgaaaagcaagctttcctccaagtctttgtacagcctcacataatacagcttaaaaatgaaactacatatgagaatggtcaagtcacactcgtatgtgatgcggaaggggagcctattccagaaatcacttggaaaagagctgtggatggcttcacgttcactgaaggcgataagagcctggacggccgtatcgaagtcaaagggcagcatggaagctcatcactgcatattaaagatgtgaagttgtcagattcagggagatatgactgtgaagctgcaagcagaattggagggcatcaaaagagcatgtaccttgatattgaatatgcccccaagtttatatcaaaccaaacaatttattactcttgggaaggaaatcctatcaatataagttgtgatgtgaaatcgaatccaccagcatcaattcactggagaagagataaattagtcttacctgctaaaaacacgaccaatttaaagacttatagtacaggaagaaagatgatattagagattgcacctacatctgacaatgactttggacgctataattgcacagccactaatcatataggaacaagatttcaagaatatattcttgctttggctgacgtgccatccagtccctatggagtgaagatcatagagctgtcgcagaccacggccaaggtttccttcaacaaaccggactcccatggaggtgtacctattcatcactatcaggtggatgtcaaagaagtagcgtcagaaatctggaaaattgtacgctcccatggagttcaaacaatggttgttttgaacaacctggaaccaaatacaacttatgaaatcagggttgcagctgtaaatggaaagggacaaggagactacagtaaaatagaaatcttccaaacattaccagttcgtgaaccaagtcctccatccatacatggacagccaagcagtggaaagagctttaaactcagcatcaccaaacaggacgatggaggggcccctattttggaatacattgtgaaatatagaagtaaagataaggaagaccaatggctagagaaaaaagtgcaaggaaataaagaccacatcattttggagcatctccagtggaccatggggtatgaagttcagattacagctgccaatagattgggatattctgaaccgacagtttatgaattcagcatgccaccaaagcccaacattattaaagacacgctgtttaatggtcttgggcttggagcagtaattggcctgggagttgctgcactgctgctaattcttgtggtaacagacgtcagctgcttctttattcggcaatgtgggttgctgatgtgcatcactaggagaatgtgtggaaagaaaagtggctccagtggcaaaagtaaagaactcgaagaaggaaaagctgcatacctgaaagatggatcaaaagaaccaatagtggagatgagaacagaggatgaaagagttactaatcacgaagatgggagcccagtaaatgagccaaatgaaaccacaccactgacagaacctgaaaaattgcctttaaaggaagaagatgggaaagaagctctaaatccagaaactatagaaattaaagtttctaacgacatcattcaatcaaaagaagacgacagcaaagcataacaacaatattacaggggcttgaacaacactacgaagagtatttggattgcgtgaccctatgaccaaaactattccattgaccttaatttcttgggaaacttctagcttggaatagcttgtacacatatacatatgatcaaatactcctgcccatgatccattcccttttgttattgttgttgttgttgctgttgttgttaattttgttaagaatttcaatatcaagactgactggcaccaacactttggtattcaatttgattctatgactgaagtactggaatttattatgtggctaaagtgctctatttattaagaactatatttaataccaccaacaaatataggggttaaggaaaaaaaacgtgagctacatgtgtaagaaggccctgcatgtgtatgagtcctattctgggcaaatagattcttaaagtggctttcaacttcaagatgaaggagcttaataatggttactcattttatcaggggaatttcagggaacgtaggcgtcaaagagccagttatctttagcagatattaaaaattgaaaactttggagaactcatttcaagttatgattcagtgcattttcaacattgatttttgatagactgaagtgccagatcaaaattgttacccatttgaaagaatattagttgtatataaaattagattagaaagactttctaaatctctatctctttatatatgtcctattcattcacaatggattatacaaaaaaaagtgtattgcaagtgaaataatattgatttctgccctcagcttcaaataaagtaaattgaaatgggaacaatatcaatatggtgtcttgatatatttataaatatgtgattatcatttatttttaaaataatttatcaaaaaacaagtctttagtgttcaaatacttcaaatcatatcctcagatatatttttagcccatggttttatataatctttaagaactaattttaccactgttataggttcaccattaaatataattggctaataaaaattttaaggttgactaaattaagaagaaattatttaacattttaatgtgccataaaagagtaaatgataaataattaaatgccactatgtgttctattccggatgttctagctagaagtcattttaagattttgataaacaactttggttgaagaaattccttaagtattcaacacaaactttctaatatcttttgttagggttataccagaataaaatgcttctttacttccaagctatgcaagctcccagaggtaatagagtgacacatgatttaacttatatgtaaggtttaaaaaagtatttatcattataaacatacataccatttgggagcaggtttattaaccttgagagccaaaggtttccttaggccctgtaacattcagaacctttggtgtttcaggtggtattatagctcaaatagtgacaggacagggaatgcgttccaaaggaatattggagcaattttaacattgcagaaacctgctctgggtgtgtctctctgtagagataacctgatgattattaaatgtaaaattaaggcaactcatgaatatttttatttacaaagtgcttgaaactcagccaaggagagaaaactaagtacttttatataattcatcacttttctggctacagcaggacagaatatgaccatcttcgtttgaaggcaccaaatcgtcgcagtgtctttgccataagttgcagggttaaatgcgggaatctctccttgcgttcctgtctggcgtattctgaagaaaagaacagaattcttgtgcctacctaagaatttgagtagtgtctaaacaaacaaagcagttaggtcattttaactgacttgattatccaactggtctttgacagatttgactgttcatatttagtttatgtttgtctgatcatccagtttgctttattttgctgtgttttattttgttgtttgttttgttttgtaccagtgtactaaaactagtcaaaatacttgaattagtttgtttgtgcaaagtgtacaagcttagtaaagtgtccatgaagcaatagccatgaatgctaattatttctaaatagggccacatggttttaaactaatgatggtgaaagaaatacgatgactgagaaagtcatttcgcatgtttactattgttatattcgtgctttacttcaagagtgcagaaatcataataaataacaaactatttttgtgttttctcaatgtgaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:4685 -> Biological process: GO:0007158 [neuron cell-cell adhesion] evidence: TAS
            GeneID:4685 -> Cellular component: GO:0005886 [plasma membrane] evidence: IEA
            GeneID:4685 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA
            GeneID:4685 -> Cellular component: GO:0030424 [axon] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.