Home |
Help |
Advanced search
2024-04-24 00:17:01, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_004540 5006 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens neural cell adhesion molecule 2 (NCAM2), mRNA.
ACCESSION NM_004540
VERSION NM_004540.3 GI:316659209
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 5006)
AUTHORS Fox,C.S., Liu,Y., White,C.C., Feitosa,M., Smith,A.V.,
Heard-Costa,N., Lohman,K., Johnson,A.D., Foster,M.C.,
Greenawalt,D.M., Griffin,P., Ding,J., Newman,A.B., Tylavsky,F.,
Miljkovic,I., Kritchevsky,S.B., Launer,L., Garcia,M.,
Eiriksdottir,G., Carr,J.J., Gudnason,V., Harris,T.B., Cupples,L.A.
and Borecki,I.B.
CONSRTM GIANT Consortium; MAGIC Consortium; GLGC Consortium
TITLE Genome-wide association for abdominal subcutaneous and visceral
adipose reveals a novel locus for visceral fat in women
JOURNAL PLoS Genet. 8 (5), E1002695 (2012)
PUBMED 22589738
REFERENCE 2 (bases 1 to 5006)
AUTHORS Takahashi,S., Kato,K., Nakamura,K., Nakano,R., Kubota,K. and
Hamada,H.
TITLE Neural cell adhesion molecule 2 as a target molecule for prostate
and breast cancer gene therapy
JOURNAL Cancer Sci. 102 (4), 808-814 (2011)
PUBMED 21214674
REMARK GeneRIF: High NCAM2 is associated with increased 5-Fluorouracil
sensitivity in prostate and breast cancer.
REFERENCE 3 (bases 1 to 5006)
AUTHORS Kulahin,N., Kristensen,O., Rasmussen,K.K., Olsen,L., Rydberg,P.,
Vestergaard,B., Kastrup,J.S., Berezin,V., Bock,E., Walmod,P.S. and
Gajhede,M.
TITLE Structural model and trans-interaction of the entire ectodomain of
the olfactory cell adhesion molecule
JOURNAL Structure 19 (2), 203-211 (2011)
PUBMED 21300289
REMARK GeneRIF: A complete structural model of the entire ectodomain of
human NCAM2 has been assembled from crystal structures of six
recombinant proteins corresponding to different regions of the
ectodomain.
REFERENCE 4 (bases 1 to 5006)
AUTHORS Wang,K., Li,W.D., Zhang,C.K., Wang,Z., Glessner,J.T., Grant,S.F.,
Zhao,H., Hakonarson,H. and Price,R.A.
TITLE A genome-wide association study on obesity and obesity-related
traits
JOURNAL PLoS ONE 6 (4), E18939 (2011)
PUBMED 21552555
REMARK Erratum:[PLoS One. 2012;7(2). doi:
10.1371/annotation/a34ee94e-3e6a-48bd-a19e-398a4bb88580]
Publication Status: Online-Only
REFERENCE 5 (bases 1 to 5006)
AUTHORS Han,M.R., Schellenberg,G.D. and Wang,L.S.
CONSRTM Alzheimer's Disease Neuroimaging Initiative
TITLE Genome-wide association reveals genetic effects on human Abeta42
and tau protein levels in cerebrospinal fluids: a case control
study
JOURNAL BMC Neurol 10, 90 (2010)
PUBMED 20932310
REMARK GeneRIF: Observational study and genome-wide association study of
gene-disease association. (HuGE Navigator)
Publication Status: Online-Only
REFERENCE 6 (bases 1 to 5006)
AUTHORS Rasmussen,K.K., Kulahin,N., Kristensen,O., Poulsen,J.C.,
Sigurskjold,B.W., Kastrup,J.S., Berezin,V., Bock,E., Walmod,P.S.
and Gajhede,M.
TITLE Crystal structure of the Ig1 domain of the neural cell adhesion
molecule NCAM2 displays domain swapping
JOURNAL J. Mol. Biol. 382 (5), 1113-1120 (2008)
PUBMED 18706912
REMARK GeneRIF: In the crystal structure, two Ig domains interact by
domain swapping, as the two N-terminal beta-strands are
interchanged.
REFERENCE 7 (bases 1 to 5006)
AUTHORS Schmitt-Ulms,G., Hansen,K., Liu,J., Cowdrey,C., Yang,J.,
DeArmond,S.J., Cohen,F.E., Prusiner,S.B. and Baldwin,M.A.
TITLE Time-controlled transcardiac perfusion cross-linking for the study
of protein interactions in complex tissues
JOURNAL Nat. Biotechnol. 22 (6), 724-731 (2004)
PUBMED 15146195
REFERENCE 8 (bases 1 to 5006)
AUTHORS Zhang,H., Li,X.J., Martin,D.B. and Aebersold,R.
TITLE Identification and quantification of N-linked glycoproteins using
hydrazide chemistry, stable isotope labeling and mass spectrometry
JOURNAL Nat. Biotechnol. 21 (6), 660-666 (2003)
PUBMED 12754519
REFERENCE 9 (bases 1 to 5006)
AUTHORS Alenius,M. and Bohm,S.
TITLE Differential function of RNCAM isoforms in precise target selection
of olfactory sensory neurons
JOURNAL Development 130 (5), 917-927 (2003)
PUBMED 12538518
REFERENCE 10 (bases 1 to 5006)
AUTHORS Paoloni-Giacobino,A., Chen,H. and Antonarakis,S.E.
TITLE Cloning of a novel human neural cell adhesion molecule gene (NCAM2)
that maps to chromosome region 21q21 and is potentially involved in
Down syndrome
JOURNAL Genomics 43 (1), 43-51 (1997)
PUBMED 9226371
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from BC052946.1, AP001115.1 and
AI207079.1.
On Jan 4, 2011 this sequence version replaced gi:33519480.
Summary: The protein encoded by this gene belongs to the
immunoglobulin superfamily. It is a type I membrane protein and may
function in selective fasciculation and zone-to-zone projection of
the primary olfactory axons. [provided by RefSeq, Jul 2008].
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BC052946.1, BC036088.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025082, ERS025084 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-3580 BC052946.1 1-3580
3581-4688 AP001115.1 6201-7308
4689-5006 AI207079.1 1-318 c
FEATURES Location/Qualifiers
source 1..5006
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="21"
/map="21q21.1"
gene 1..5006
/gene="NCAM2"
/gene_synonym="NCAM21"
/note="neural cell adhesion molecule 2"
/db_xref="GeneID:4685"
/db_xref="HGNC:7657"
/db_xref="HPRD:03619"
/db_xref="MIM:602040"
exon 1..304
/gene="NCAM2"
/gene_synonym="NCAM21"
/inference="alignment:Splign:1.39.8"
variation 53
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="g"
/db_xref="dbSNP:374091153"
misc_feature 67..69
/gene="NCAM2"
/gene_synonym="NCAM21"
/note="upstream in-frame stop codon"
variation 82
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:367957001"
variation 233
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:371712887"
variation 240
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="c"
/db_xref="dbSNP:201169186"
CDS 250..2763
/gene="NCAM2"
/gene_synonym="NCAM21"
/note="NCAM-2; N-CAM-2"
/codon_start=1
/product="neural cell adhesion molecule 2 precursor"
/protein_id="NP_004531.2"
/db_xref="GI:33519481"
/db_xref="CCDS:CCDS42910.1"
/db_xref="GeneID:4685"
/db_xref="HGNC:7657"
/db_xref="HPRD:03619"
/db_xref="MIM:602040"
/translation="
MSLLLSFYLLGLLVSSGQALLQVTISLSKVELSVGESKFFTCTAIGEPESIDWYNPQGEKIISTQRVVVQKEGVRSRLTIYNANIEDAGIYRCQATDAKGQTQEATVVLEIYQKLTFREVVSPQEFKQGEDAEVVCRVSSSPAPAVSWLYHNEEVTTISDNRFAMLANNNLQILNINKSDEGIYRCEGRVEARGEIDFRDIIVIVNVPPAISMPQKSFNATAERGEEMTFSCRASGSPEPAISWFRNGKLIEENEKYILKGSNTELTVRNIINSDGGPYVCRATNKAGEDEKQAFLQVFVQPHIIQLKNETTYENGQVTLVCDAEGEPIPEITWKRAVDGFTFTEGDKSLDGRIEVKGQHGSSSLHIKDVKLSDSGRYDCEAASRIGGHQKSMYLDIEYAPKFISNQTIYYSWEGNPINISCDVKSNPPASIHWRRDKLVLPAKNTTNLKTYSTGRKMILEIAPTSDNDFGRYNCTATNHIGTRFQEYILALADVPSSPYGVKIIELSQTTAKVSFNKPDSHGGVPIHHYQVDVKEVASEIWKIVRSHGVQTMVVLNNLEPNTTYEIRVAAVNGKGQGDYSKIEIFQTLPVREPSPPSIHGQPSSGKSFKLSITKQDDGGAPILEYIVKYRSKDKEDQWLEKKVQGNKDHIILEHLQWTMGYEVQITAANRLGYSEPTVYEFSMPPKPNIIKDTLFNGLGLGAVIGLGVAALLLILVVTDVSCFFIRQCGLLMCITRRMCGKKSGSSGKSKELEEGKAAYLKDGSKEPIVEMRTEDERVTNHEDGSPVNEPNETTPLTEPEKLPLKEEDGKEALNPETIEIKVSNDIIQSKEDDSKA
"
sig_peptide 250..306
/gene="NCAM2"
/gene_synonym="NCAM21"
/inference="COORDINATES: ab initio prediction:SignalP:4.0"
mat_peptide 307..2760
/gene="NCAM2"
/gene_synonym="NCAM21"
/product="Neural cell adhesion molecule 2"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (O15394.2)"
misc_feature 310..585
/gene="NCAM2"
/gene_synonym="NCAM21"
/note="First immunoglobulin (Ig)-like domain of neural
cell adhesion molecule NCAM-2; Region: Ig1_NCAM-2;
cd05866"
/db_xref="CDD:143274"
misc_feature 313..582
/gene="NCAM2"
/gene_synonym="NCAM21"
/note="Immunoglobulin I-set domain; Region: I-set;
pfam07679"
/db_xref="CDD:191810"
misc_feature order(355..357,361..366)
/gene="NCAM2"
/gene_synonym="NCAM21"
/note="dimer interface [polypeptide binding]; other site"
/db_xref="CDD:143274"
misc_feature 595..828
/gene="NCAM2"
/gene_synonym="NCAM21"
/note="Immunoglobulin I-set domain; Region: I-set;
pfam07679"
/db_xref="CDD:191810"
misc_feature 631..816
/gene="NCAM2"
/gene_synonym="NCAM21"
/note="Immunoglobulin C-2 Type; Region: IGc2; smart00408"
/db_xref="CDD:197706"
misc_feature 871..1152
/gene="NCAM2"
/gene_synonym="NCAM21"
/note="Immunoglobulin domain; Region: Ig; cl11960"
/db_xref="CDD:213125"
misc_feature 892..1143
/gene="NCAM2"
/gene_synonym="NCAM21"
/note="Immunoglobulin I-set domain; Region: I-set;
pfam07679"
/db_xref="CDD:191810"
misc_feature 1147..1440
/gene="NCAM2"
/gene_synonym="NCAM21"
/note="Fifth immunoglobulin (Ig)-like domain of Neural
Cell Adhesion Molecule NCAM-2 (also known as OCAM/mamFas
II and RNCAM); Region: Ig5_NCAM-2; cd05870"
/db_xref="CDD:143278"
misc_feature 1501..1698
/gene="NCAM2"
/gene_synonym="NCAM21"
/note="Immunoglobulin domain; Region: Ig; cd00096"
/db_xref="CDD:143165"
misc_feature 1735..2013
/gene="NCAM2"
/gene_synonym="NCAM21"
/note="Fibronectin type 3 domain; One of three types of
internal repeats found in the plasma protein fibronectin.
Its tenth fibronectin type III repeat contains an RGD cell
recognition sequence in a flexible loop between 2 strands.
Approximately 2% of all...; Region: FN3; cd00063"
/db_xref="CDD:28945"
misc_feature order(1735..1737,1930..1932,1975..1977)
/gene="NCAM2"
/gene_synonym="NCAM21"
/note="Interdomain contacts; other site"
/db_xref="CDD:28945"
misc_feature order(1978..1983,1987..1992)
/gene="NCAM2"
/gene_synonym="NCAM21"
/note="Cytokine receptor motif; other site"
/db_xref="CDD:28945"
misc_feature 2029..2283
/gene="NCAM2"
/gene_synonym="NCAM21"
/note="Fibronectin type 3 domain; One of three types of
internal repeats found in the plasma protein fibronectin.
Its tenth fibronectin type III repeat contains an RGD cell
recognition sequence in a flexible loop between 2 strands.
Approximately 2% of all...; Region: FN3; cd00063"
/db_xref="CDD:28945"
misc_feature order(2029..2031,2221..2223,2266..2268)
/gene="NCAM2"
/gene_synonym="NCAM21"
/note="Interdomain contacts; other site"
/db_xref="CDD:28945"
misc_feature order(2269..2274,2278..2283)
/gene="NCAM2"
/gene_synonym="NCAM21"
/note="Cytokine receptor motif; other site"
/db_xref="CDD:28945"
misc_feature 2341..2403
/gene="NCAM2"
/gene_synonym="NCAM21"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (O15394.2);
transmembrane region"
variation 261
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:368840931"
variation 267
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:201622691"
variation 272
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:192751071"
variation 297
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:116546079"
exon 305..379
/gene="NCAM2"
/gene_synonym="NCAM21"
/inference="alignment:Splign:1.39.8"
variation 313
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="c"
/db_xref="dbSNP:200376885"
variation 332
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:373572347"
exon 380..586
/gene="NCAM2"
/gene_synonym="NCAM21"
/inference="alignment:Splign:1.39.8"
variation 451
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:368265311"
variation 454
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:371967791"
variation 487
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:190353867"
variation 495
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:182642680"
variation 502
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:199788139"
variation 510
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="g"
/replace="t"
/db_xref="dbSNP:375059644"
variation 524
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:370033455"
variation 549
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="t"
/db_xref="dbSNP:199783337"
variation 562
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:373062950"
exon 587..730
/gene="NCAM2"
/gene_synonym="NCAM21"
/inference="alignment:Splign:1.39.8"
variation 612
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:377268529"
variation 645
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:369453911"
variation 659
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:188667430"
variation 667
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:200645709"
variation 698
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="t"
/db_xref="dbSNP:377546997"
variation 700
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="g"
/db_xref="dbSNP:370615799"
variation 721
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:373022329"
exon 731..868
/gene="NCAM2"
/gene_synonym="NCAM21"
/inference="alignment:Splign:1.39.8"
variation 748
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:374401078"
variation 753
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:145537614"
variation 787
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="g"
/replace="t"
/db_xref="dbSNP:371793861"
variation 795
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:376209656"
variation 796
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:185885193"
exon 869..986
/gene="NCAM2"
/gene_synonym="NCAM21"
/inference="alignment:Splign:1.39.8"
variation 873
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:200660519"
variation 874
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:375644333"
variation 924
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="c"
/db_xref="dbSNP:200071466"
variation 929
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:369385488"
variation 969
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:372783673"
exon 987..1147
/gene="NCAM2"
/gene_synonym="NCAM21"
/inference="alignment:Splign:1.39.8"
variation 1017
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:201388906"
variation 1022
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:201863336"
variation 1049
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:181082007"
variation 1077
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:183863673"
exon 1148..1293
/gene="NCAM2"
/gene_synonym="NCAM21"
/inference="alignment:Splign:1.39.8"
variation 1210
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:371257511"
variation 1220
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:373865162"
variation 1221
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:192323183"
variation 1234
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:371618690"
variation 1241
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="c"
/db_xref="dbSNP:201849934"
variation 1258
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="g"
/replace="t"
/db_xref="dbSNP:374986975"
variation 1288
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:35654962"
exon 1294..1444
/gene="NCAM2"
/gene_synonym="NCAM21"
/inference="alignment:Splign:1.39.8"
variation 1298
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:232518"
variation 1307
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:372471672"
variation 1312
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:201907310"
variation 1326
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:375115280"
exon 1445..1632
/gene="NCAM2"
/gene_synonym="NCAM21"
/inference="alignment:Splign:1.39.8"
variation 1467
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:369013380"
variation 1497
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:201042589"
variation 1557
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:182238995"
variation 1624
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:370667294"
exon 1633..1729
/gene="NCAM2"
/gene_synonym="NCAM21"
/inference="alignment:Splign:1.39.8"
variation 1640
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="g"
/db_xref="dbSNP:367607910"
variation 1671
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:986371"
variation 1707
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:201931205"
exon 1730..1903
/gene="NCAM2"
/gene_synonym="NCAM21"
/inference="alignment:Splign:1.39.8"
variation 1731
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:199571975"
variation 1746
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:185457460"
variation 1747
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:201396138"
variation 1749
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:368831351"
variation 1773
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:189917854"
variation 1783
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:375854261"
variation 1806
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:370200278"
variation 1837
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:201558975"
variation 1855
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:373091914"
variation 1863
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:377668299"
variation 1886
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:373557277"
variation 1891..1892
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace=""
/replace="c"
/db_xref="dbSNP:35592118"
exon 1904..2023
/gene="NCAM2"
/gene_synonym="NCAM21"
/inference="alignment:Splign:1.39.8"
variation 1929
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:186217734"
variation 1941
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="g"
/replace="t"
/db_xref="dbSNP:370058893"
variation 1944
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:190741777"
variation 1950
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:1059062"
exon 2024..2145
/gene="NCAM2"
/gene_synonym="NCAM21"
/inference="alignment:Splign:1.39.8"
variation 2100
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:371587120"
variation 2143
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:199790866"
variation 2145
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="g"
/replace="t"
/db_xref="dbSNP:201578279"
exon 2146..2326
/gene="NCAM2"
/gene_synonym="NCAM21"
/inference="alignment:Splign:1.39.8"
variation 2152
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:201923816"
variation 2199
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:371365100"
variation 2206
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:143579715"
variation 2232
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="g"
/replace="t"
/db_xref="dbSNP:369824131"
variation 2307
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:373825696"
exon 2327..2531
/gene="NCAM2"
/gene_synonym="NCAM21"
/inference="alignment:Splign:1.39.8"
variation 2361
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="t"
/db_xref="dbSNP:146260588"
variation 2366
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="g"
/replace="t"
/db_xref="dbSNP:370874916"
variation 2406
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:2017705"
variation 2478
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:376916039"
variation 2490
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="g"
/replace="t"
/db_xref="dbSNP:199849179"
variation 2505
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="c"
/db_xref="dbSNP:200071566"
exon 2532..2651
/gene="NCAM2"
/gene_synonym="NCAM21"
/inference="alignment:Splign:1.39.8"
variation 2588
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:372189468"
variation 2613
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:376609572"
exon 2652..5002
/gene="NCAM2"
/gene_synonym="NCAM21"
/inference="alignment:Splign:1.39.8"
variation 2659
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:370098612"
variation 2663
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:200849313"
variation 2690
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:372354690"
variation 2704
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="t"
/db_xref="dbSNP:377126033"
variation 2714
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:200269454"
variation 2724
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:141499528"
variation 2725
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:376541267"
variation 2734
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="g"
/db_xref="dbSNP:150466591"
variation 2748
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:372679606"
variation 2769
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:376424506"
variation 2771
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:371111387"
variation 2777
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="g"
/replace="t"
/db_xref="dbSNP:374214782"
variation 2781
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:138211870"
variation 2801
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:377288652"
variation 2813
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:149595362"
STS 2823..3550
/gene="NCAM2"
/gene_synonym="NCAM21"
/standard_name="NCAM2"
/db_xref="UniSTS:266420"
variation 3019
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:115974435"
variation 3086..3089
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace=""
/replace="tatt"
/db_xref="dbSNP:373439061"
variation 3127
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="c"
/db_xref="dbSNP:76145255"
variation 3128
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="g"
/db_xref="dbSNP:74455293"
variation 3129..3130
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace=""
/replace="t"
/db_xref="dbSNP:11398016"
variation 3129
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="g"
/replace="t"
/db_xref="dbSNP:75973494"
variation 3243
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="g"
/replace="t"
/db_xref="dbSNP:193230694"
variation 3269
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:144224108"
variation 3275
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="c"
/db_xref="dbSNP:2826892"
variation 3435
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="g"
/replace="t"
/db_xref="dbSNP:140004991"
variation 3439
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="t"
/db_xref="dbSNP:141962625"
variation 3468
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:146019015"
polyA_signal 3553..3558
/gene="NCAM2"
/gene_synonym="NCAM21"
variation 3576
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="c"
/db_xref="dbSNP:375571711"
polyA_site 3584
/gene="NCAM2"
/gene_synonym="NCAM21"
variation 3609..3610
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace=""
/replace="at"
/db_xref="dbSNP:140516043"
variation 3881
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:9982042"
variation 3884
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:139994201"
variation 3921
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:114266934"
variation 3982
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="g"
/replace="t"
/db_xref="dbSNP:75567000"
variation 3996
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:17003886"
variation 4044..4045
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace=""
/replace="g"
/db_xref="dbSNP:34336002"
variation 4045
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="t"
/db_xref="dbSNP:142165520"
variation 4118
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:185301591"
variation 4156
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="c"
/db_xref="dbSNP:377756584"
variation 4225
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="g"
/replace="t"
/db_xref="dbSNP:188899203"
variation 4226
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:151203363"
variation 4257
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:191895244"
variation 4391
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:75722922"
variation 4468
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:369674790"
variation 4505
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:17807776"
variation 4516
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:2826893"
variation 4598
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="g"
/db_xref="dbSNP:184023496"
variation 4704
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="g"
/replace="t"
/db_xref="dbSNP:1059065"
variation 4714
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="t"
/db_xref="dbSNP:1136456"
variation 4719
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="g"
/replace="t"
/db_xref="dbSNP:1059066"
variation 4724..4728
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace=""
/replace="tttgt"
/db_xref="dbSNP:370856648"
variation 4726
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="g"
/replace="t"
/db_xref="dbSNP:1059067"
variation 4731
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="g"
/replace="t"
/db_xref="dbSNP:1059068"
variation 4736
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="g"
/replace="t"
/db_xref="dbSNP:1059069"
variation 4739
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="t"
/db_xref="dbSNP:373450121"
variation 4798
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="g"
/db_xref="dbSNP:1059070"
STS 4809..4956
/gene="NCAM2"
/gene_synonym="NCAM21"
/standard_name="RH92742"
/db_xref="UniSTS:91562"
variation 4812
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:139085311"
variation 4838
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="t"
/db_xref="dbSNP:372664773"
variation 4855
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="c"
/db_xref="dbSNP:377438608"
variation 4967
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="c"
/replace="t"
/db_xref="dbSNP:188415861"
polyA_signal 4969..4974
/gene="NCAM2"
/gene_synonym="NCAM21"
variation 4979
/gene="NCAM2"
/gene_synonym="NCAM21"
/replace="a"
/replace="t"
/db_xref="dbSNP:369919953"
polyA_site 5002
/gene="NCAM2"
/gene_synonym="NCAM21"
ORIGIN
gctgccgccgcggcggccgctgctgctgctgcttctgccgccgctgccgccgccgctgcctggatatagtgcggcaagagcggagcttgcagtcactttgcgaggaggagcgcgcgggctgcgggcggctggggcaccgcgggagcggcggcggcggctctagcagaggcggccggggcagcgaaaggttctctctccagggctggacttaataactttgaaactgtccaccggtgtcacgtcctgaacatgagcctcctcctctccttctacctgctggggttgcttgtcagtagcgggcaagctcttcttcaagtgacaatttcacttagcaaagtagagcttagtgttggagaatctaaattcttcacatgtacagcgattggtgaacctgaaagtatagattggtataatcctcaaggagagaagataatttcaacacagagggtagtagtgcaaaaggaaggtgttaggtcacggttaaccatctacaatgcaaatatagaagatgcagggatatatcgttgtcaagcaacagatgccaaaggacaaacacaagaagctacagtagttttggaaatttaccaaaaactcactttcagagaagtggtatctccacaagaattcaaacaaggagaagatgcagaagtggtttgccgagttagcagttcacctgcacctgctgtcagctggttgtatcataatgaggaagtcaccactatttccgacaatcggttcgctatgttagcaaacaataacctgcagattctcaacatcaataaaagtgatgaaggtatatacagatgtgaaggaagagtggaggccaggggagaaattgacttccgtgatatcattgttattgttaatgtgccgccagcaatctcaatgcctcagaaatcttttaatgccacagcagagagaggagaagaaatgacattttcctgcagggcctcaggctctccagaacccgccatctcctggttcaggaatggcaagctcattgaagaaaatgagaagtacatattgaaagggagcaatacagaactcactgtcaggaacataatcaatagtgatggtggtccttatgtctgcagggccacaaataaggcaggagaagatgaaaagcaagctttcctccaagtctttgtacagcctcacataatacagcttaaaaatgaaactacatatgagaatggtcaagtcacactcgtatgtgatgcggaaggggagcctattccagaaatcacttggaaaagagctgtggatggcttcacgttcactgaaggcgataagagcctggacggccgtatcgaagtcaaagggcagcatggaagctcatcactgcatattaaagatgtgaagttgtcagattcagggagatatgactgtgaagctgcaagcagaattggagggcatcaaaagagcatgtaccttgatattgaatatgcccccaagtttatatcaaaccaaacaatttattactcttgggaaggaaatcctatcaatataagttgtgatgtgaaatcgaatccaccagcatcaattcactggagaagagataaattagtcttacctgctaaaaacacgaccaatttaaagacttatagtacaggaagaaagatgatattagagattgcacctacatctgacaatgactttggacgctataattgcacagccactaatcatataggaacaagatttcaagaatatattcttgctttggctgacgtgccatccagtccctatggagtgaagatcatagagctgtcgcagaccacggccaaggtttccttcaacaaaccggactcccatggaggtgtacctattcatcactatcaggtggatgtcaaagaagtagcgtcagaaatctggaaaattgtacgctcccatggagttcaaacaatggttgttttgaacaacctggaaccaaatacaacttatgaaatcagggttgcagctgtaaatggaaagggacaaggagactacagtaaaatagaaatcttccaaacattaccagttcgtgaaccaagtcctccatccatacatggacagccaagcagtggaaagagctttaaactcagcatcaccaaacaggacgatggaggggcccctattttggaatacattgtgaaatatagaagtaaagataaggaagaccaatggctagagaaaaaagtgcaaggaaataaagaccacatcattttggagcatctccagtggaccatggggtatgaagttcagattacagctgccaatagattgggatattctgaaccgacagtttatgaattcagcatgccaccaaagcccaacattattaaagacacgctgtttaatggtcttgggcttggagcagtaattggcctgggagttgctgcactgctgctaattcttgtggtaacagacgtcagctgcttctttattcggcaatgtgggttgctgatgtgcatcactaggagaatgtgtggaaagaaaagtggctccagtggcaaaagtaaagaactcgaagaaggaaaagctgcatacctgaaagatggatcaaaagaaccaatagtggagatgagaacagaggatgaaagagttactaatcacgaagatgggagcccagtaaatgagccaaatgaaaccacaccactgacagaacctgaaaaattgcctttaaaggaagaagatgggaaagaagctctaaatccagaaactatagaaattaaagtttctaacgacatcattcaatcaaaagaagacgacagcaaagcataacaacaatattacaggggcttgaacaacactacgaagagtatttggattgcgtgaccctatgaccaaaactattccattgaccttaatttcttgggaaacttctagcttggaatagcttgtacacatatacatatgatcaaatactcctgcccatgatccattcccttttgttattgttgttgttgttgctgttgttgttaattttgttaagaatttcaatatcaagactgactggcaccaacactttggtattcaatttgattctatgactgaagtactggaatttattatgtggctaaagtgctctatttattaagaactatatttaataccaccaacaaatataggggttaaggaaaaaaaacgtgagctacatgtgtaagaaggccctgcatgtgtatgagtcctattctgggcaaatagattcttaaagtggctttcaacttcaagatgaaggagcttaataatggttactcattttatcaggggaatttcagggaacgtaggcgtcaaagagccagttatctttagcagatattaaaaattgaaaactttggagaactcatttcaagttatgattcagtgcattttcaacattgatttttgatagactgaagtgccagatcaaaattgttacccatttgaaagaatattagttgtatataaaattagattagaaagactttctaaatctctatctctttatatatgtcctattcattcacaatggattatacaaaaaaaagtgtattgcaagtgaaataatattgatttctgccctcagcttcaaataaagtaaattgaaatgggaacaatatcaatatggtgtcttgatatatttataaatatgtgattatcatttatttttaaaataatttatcaaaaaacaagtctttagtgttcaaatacttcaaatcatatcctcagatatatttttagcccatggttttatataatctttaagaactaattttaccactgttataggttcaccattaaatataattggctaataaaaattttaaggttgactaaattaagaagaaattatttaacattttaatgtgccataaaagagtaaatgataaataattaaatgccactatgtgttctattccggatgttctagctagaagtcattttaagattttgataaacaactttggttgaagaaattccttaagtattcaacacaaactttctaatatcttttgttagggttataccagaataaaatgcttctttacttccaagctatgcaagctcccagaggtaatagagtgacacatgatttaacttatatgtaaggtttaaaaaagtatttatcattataaacatacataccatttgggagcaggtttattaaccttgagagccaaaggtttccttaggccctgtaacattcagaacctttggtgtttcaggtggtattatagctcaaatagtgacaggacagggaatgcgttccaaaggaatattggagcaattttaacattgcagaaacctgctctgggtgtgtctctctgtagagataacctgatgattattaaatgtaaaattaaggcaactcatgaatatttttatttacaaagtgcttgaaactcagccaaggagagaaaactaagtacttttatataattcatcacttttctggctacagcaggacagaatatgaccatcttcgtttgaaggcaccaaatcgtcgcagtgtctttgccataagttgcagggttaaatgcgggaatctctccttgcgttcctgtctggcgtattctgaagaaaagaacagaattcttgtgcctacctaagaatttgagtagtgtctaaacaaacaaagcagttaggtcattttaactgacttgattatccaactggtctttgacagatttgactgttcatatttagtttatgtttgtctgatcatccagtttgctttattttgctgtgttttattttgttgtttgttttgttttgtaccagtgtactaaaactagtcaaaatacttgaattagtttgtttgtgcaaagtgtacaagcttagtaaagtgtccatgaagcaatagccatgaatgctaattatttctaaatagggccacatggttttaaactaatgatggtgaaagaaatacgatgactgagaaagtcatttcgcatgtttactattgttatattcgtgctttacttcaagagtgcagaaatcataataaataacaaactatttttgtgttttctcaatgtgaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:4685 -> Biological process: GO:0007158 [neuron cell-cell adhesion] evidence: TAS
GeneID:4685 -> Cellular component: GO:0005886 [plasma membrane] evidence: IEA
GeneID:4685 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA
GeneID:4685 -> Cellular component: GO:0030424 [axon] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.