GGRNA Home | Help | Advanced search

2020-10-26 19:51:29, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_004358               3659 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens cell division cycle 25B (CDC25B), transcript variant
            2, mRNA.
ACCESSION   NM_004358
VERSION     NM_004358.3  GI:47078250
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3659)
  AUTHORS   Hsieh,W.L., Lin,Y.K., Tsai,C.N., Wang,T.M., Chen,T.Y. and Pang,J.H.
  TITLE     Indirubin, an acting component of indigo naturalis, inhibits EGFR
            activation and EGF-induced CDC25B gene expression in epidermal
            keratinocytes
  JOURNAL   J. Dermatol. Sci. 67 (2), 140-146 (2012)
   PUBMED   22721997
  REMARK    GeneRIF: Indirubin, an acting component of indigo naturalis,
            inhibits EGFR activation and EGF-induced CDC25B gene expression in
            epidermal ke
REFERENCE   2  (bases 1 to 3659)
  AUTHORS   Yu,X.Y., Zhang,Z., Zhang,G.J., Guo,K.F. and Kong,C.Z.
  TITLE     Knockdown of Cdc25B in renal cell carcinoma is associated with
            decreased malignant features
  JOURNAL   Asian Pac. J. Cancer Prev. 13 (3), 931-935 (2012)
   PUBMED   22631674
  REMARK    GeneRIF: downregulation of Cdc25B resulted in slower growth, more
            G2/M cells, weaker capacity for migration and invasion and
            induction of apoptosis in renal carcinoma cell line 769-P
            transfectants; findings suggest an important role of Cdc25B in
            renal cell carcinoma development
REFERENCE   3  (bases 1 to 3659)
  AUTHORS   Liffers,S.T., Munding,J.B., Vogt,M., Kuhlmann,J.D., Verdoodt,B.,
            Nambiar,S., Maghnouj,A., Mirmohammadsadegh,A., Hahn,S.A. and
            Tannapfel,A.
  TITLE     MicroRNA-148a is down-regulated in human pancreatic ductal
            adenocarcinomas and regulates cell survival by targeting CDC25B
  JOURNAL   Lab. Invest. 91 (10), 1472-1479 (2011)
   PUBMED   21709669
  REMARK    GeneRIF: We identified CDC25B as novel miR-148a target which may
            confer a proliferative advantage in pancreatic ductal
            adenocarcinomas.
REFERENCE   4  (bases 1 to 3659)
  AUTHORS   Lobjois,V., Froment,C., Braud,E., Grimal,F., Burlet-Schiltz,O.,
            Ducommun,B. and Bouche,J.P.
  TITLE     Study of the docking-dependent PLK1 phosphorylation of the CDC25B
            phosphatase
  JOURNAL   Biochem. Biophys. Res. Commun. 410 (1), 87-90 (2011)
   PUBMED   21640712
  REMARK    GeneRIF: there are 13 sites phosphorylated by PLK1 in CDC25B.This
            study illustrates the complexity of the phosphorylation pattern and
            of the subsequent regulation of CDC25B activity.
REFERENCE   5  (bases 1 to 3659)
  AUTHORS   Nakamura,S., Nagata,Y., Tan,L., Takemura,T., Shibata,K., Fujie,M.,
            Fujisawa,S., Tanaka,Y., Toda,M., Makita,R., Tsunekawa,K.,
            Yamada,M., Yamaoka,M., Yamashita,J., Ohnishi,K. and Yamashita,M.
  TITLE     Transcriptional repression of Cdc25B by IER5 inhibits the
            proliferation of leukemic progenitor cells through NF-YB and p300
            in acute myeloid leukemia
  JOURNAL   PLoS ONE 6 (11), E28011 (2011)
   PUBMED   22132193
  REMARK    GeneRIF: Transcriptional repression mediated by IER5 regulates
            Cdc25B expression levels via the release of NF-YB and p300 in acute
            myeloid leukemia.
REFERENCE   6  (bases 1 to 3659)
  AUTHORS   Baldin,V., Cans,C., Superti-Furga,G. and Ducommun,B.
  TITLE     Alternative splicing of the human CDC25B tyrosine phosphatase.
            Possible implications for growth control?
  JOURNAL   Oncogene 14 (20), 2485-2495 (1997)
   PUBMED   9188863
REFERENCE   7  (bases 1 to 3659)
  AUTHORS   Conklin,D.S., Galaktionov,K. and Beach,D.
  TITLE     14-3-3 proteins associate with cdc25 phosphatases
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 92 (17), 7892-7896 (1995)
   PUBMED   7644510
REFERENCE   8  (bases 1 to 3659)
  AUTHORS   Galaktionov,K. and Beach,D.
  TITLE     Specific activation of cdc25 tyrosine phosphatases by B-type
            cyclins: evidence for multiple roles of mitotic cyclins
  JOURNAL   Cell 67 (6), 1181-1194 (1991)
   PUBMED   1836978
REFERENCE   9  (bases 1 to 3659)
  AUTHORS   Nagata,A., Igarashi,M., Jinno,S., Suto,K. and Okayama,H.
  TITLE     An additional homolog of the fission yeast cdc25+ gene occurs in
            humans and is highly expressed in some cancer cells
  JOURNAL   New Biol. 3 (10), 959-968 (1991)
   PUBMED   1662986
REFERENCE   10 (bases 1 to 3659)
  AUTHORS   Strausfeld,U., Labbe,J.C., Fesquet,D., Cavadore,J.C., Picard,A.,
            Sadhu,K., Russell,P. and Doree,M.
  TITLE     Dephosphorylation and activation of a p34cdc2/cyclin B complex in
            vitro by human CDC25 protein
  JOURNAL   Nature 351 (6323), 242-245 (1991)
   PUBMED   1828290
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AK092713.1, BC051711.1,
            S78187.1 and BX640836.1.
            On May 7, 2004 this sequence version replaced gi:11641416.
            
            Summary: CDC25B is a member of the CDC25 family of phosphatases.
            CDC25B activates the cyclin dependent kinase CDC2 by removing two
            phosphate groups and it is required for entry into mitosis. CDC25B
            shuttles between the nucleus and the cytoplasm due to nuclear
            localization and nuclear export signals. The protein is nuclear in
            the M and G1 phases of the cell cycle and moves to the cytoplasm
            during S and G2. CDC25B has oncogenic properties, although its role
            in tumor formation has not been determined. Multiple transcript
            variants for this gene exist. [provided by RefSeq, Jul 2008].
            
            Transcript Variant: This variant (2), also known as CDC25B1, uses
            an alternate splice site in the 5' coding region, compared to
            variant 1, resulting in a shorter protein (isoform 2) compared to
            isoform 1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: S78187.1, M81934.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025089, ERS025093 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-86                AK092713.1         16-101
            87-556              BC051711.1         6-475
            557-2458            S78187.1           19-1920
            2459-3003           BC051711.1         2421-2965
            3004-3624           BX640836.1         1984-2604
            3625-3659           S78187.1           3084-3118
FEATURES             Location/Qualifiers
     source          1..3659
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="20"
                     /map="20p13"
     gene            1..3659
                     /gene="CDC25B"
                     /note="cell division cycle 25B"
                     /db_xref="GeneID:994"
                     /db_xref="HGNC:1726"
                     /db_xref="HPRD:00307"
                     /db_xref="MIM:116949"
     exon            1..978
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       69
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183999341"
     variation       158
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11569978"
     variation       251
                     /gene="CDC25B"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374054731"
     misc_feature    470..472
                     /gene="CDC25B"
                     /note="upstream in-frame stop codon"
     variation       568
                     /gene="CDC25B"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:6116042"
     variation       662
                     /gene="CDC25B"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:13038734"
     variation       665..666
                     /gene="CDC25B"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:11462398"
     variation       666..667
                     /gene="CDC25B"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:71678223"
     variation       772
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11087603"
     variation       775
                     /gene="CDC25B"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372029025"
     CDS             779..2479
                     /gene="CDC25B"
                     /EC_number="3.1.3.48"
                     /note="isoform 2 is encoded by transcript variant 2;
                     M-phase inducer phosphatase 2; dual specificity
                     phosphatase Cdc25B"
                     /codon_start=1
                     /product="M-phase inducer phosphatase 2 isoform 2"
                     /protein_id="NP_004349.1"
                     /db_xref="GI:4757950"
                     /db_xref="CCDS:CCDS13065.1"
                     /db_xref="GeneID:994"
                     /db_xref="HGNC:1726"
                     /db_xref="HPRD:00307"
                     /db_xref="MIM:116949"
                     /translation="
MEVPQPEPAPGSALSPAGVCGGAQRPGHLPGLLLGSHGLLGSPVRAAASSPVTTLTQTMHDLAGLGSRSRLTHLSLSRRASESSLSSESSESSDAGLCMDSPSPMDPHMAEQTFEQAIQAASRIIRNEQFAIRRFQSMPVRLLGHSPVLRNITNSQAPDGRRKSEAGSGAASSSGEDKENDGFVFKMPWKPTHPSSTHALAEWASRREAFAQRPSSAPDLMCLSPDRKMEVEELSPLALGRFSLTPAEGDTEEDDGFVDILESDLKDDDAVPPGMESLISAPLVKTLEKEEEKDLVMYSKCQRLFRSPSMPCSVIRPILKRLERPQDRDTPVQNKRRRSVTPPEEQQEAEEPKARVLRSKSLCHDEIENLLDSDHRELIGDYSKAFLLQTVDGKHQDLKYISPETMVALLTGKFSNIVDKFVIVDCRYPYEYEGGHIKTAVNLPLERDAESFLLKSPIAPCSLDKRVILIFHCEFSSERGPRMCRFIRERDRAVNDYPSLYYPEMYILKGGYKEFFPQHPNFCEPQDYRPMNHEAFKDELKTFRLKTRSWAGERSRRELCSRLQDQ
"
     misc_feature    1073..1888
                     /gene="CDC25B"
                     /note="M-phase inducer phosphatase; Region:
                     M-inducer_phosp; pfam06617"
                     /db_xref="CDD:115287"
     misc_feature    1214..1216
                     /gene="CDC25B"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00302"
     misc_feature    1292..1294
                     /gene="CDC25B"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00277"
     misc_feature    1295..1297
                     /gene="CDC25B"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00277"
     misc_feature    1697..1699
                     /gene="CDC25B"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:06119"
     misc_feature    1793..1795
                     /gene="CDC25B"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:04066"
     misc_feature    1970..2329
                     /gene="CDC25B"
                     /note="Cdc25 phosphatases are members of the Rhodanese
                     Homology Domain superfamily. They activate the cell
                     division kinases throughout the cell cycle progression.
                     Cdc25 phosphatases dephosphorylate phosphotyrosine and
                     phosphothreonine residues, in order to...; Region: Cdc25;
                     cd01530"
                     /db_xref="CDD:29093"
     misc_feature    2195..2215
                     /gene="CDC25B"
                     /note="oxyanion binding site; other site"
                     /db_xref="CDD:29093"
     misc_feature    2195..2197
                     /gene="CDC25B"
                     /note="active site residue [active]"
                     /db_xref="CDD:29093"
     variation       820
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11569979"
     variation       838
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375122468"
     variation       889
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368274446"
     variation       953
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372183442"
     variation       965
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145700972"
     variation       973
                     /gene="CDC25B"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373847564"
     exon            979..1064
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       981
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146567070"
     variation       989
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141031701"
     variation       996
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375803588"
     variation       997
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370072424"
     variation       1021
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201619391"
     variation       1027
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374599445"
     variation       1036
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147311787"
     variation       1039
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368877264"
     variation       1049
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199501910"
     exon            1065..1116
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       1084
                     /gene="CDC25B"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371577332"
     variation       1107
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376436608"
     variation       1108
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148241851"
     variation       1112
                     /gene="CDC25B"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141382375"
     variation       1114
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139123058"
     variation       1116
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370155414"
     exon            1117..1158
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       1117
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150375046"
     variation       1145
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137919521"
     variation       1146
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143386679"
     variation       1155
                     /gene="CDC25B"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143369164"
     exon            1159..1195
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       1170
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111654983"
     variation       1178
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147172963"
     variation       1179
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371528141"
     variation       1186
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61755298"
     variation       1189
                     /gene="CDC25B"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:368675680"
     variation       1190
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140433155"
     variation       1195
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201436986"
     exon            1196..1318
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       1220
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375465916"
     variation       1223
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201911534"
     variation       1226
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371350767"
     variation       1248
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373068861"
     variation       1249
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11552106"
     variation       1256
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367573455"
     variation       1260
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144359318"
     variation       1265
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199988612"
     variation       1270
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376072567"
     exon            1319..1441
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       1323
                     /gene="CDC25B"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:202155757"
     variation       1367
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368042199"
     variation       1388
                     /gene="CDC25B"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142459784"
     variation       1406
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200968688"
     exon            1442..1576
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       1444..1445
                     /gene="CDC25B"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:35741868"
     variation       1448
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111545759"
     variation       1457
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202222511"
     variation       1458
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201435494"
     variation       1500
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151315259"
     variation       1512
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372916640"
     variation       1513
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375854669"
     variation       1514
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202059655"
     variation       1518
                     /gene="CDC25B"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:139531565"
     variation       1571
                     /gene="CDC25B"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373171092"
     exon            1577..1657
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       1592
                     /gene="CDC25B"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144187197"
     variation       1646
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201902192"
     variation       1656..1657
                     /gene="CDC25B"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:35824153"
     exon            1658..1834
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       1663
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145108436"
     variation       1681
                     /gene="CDC25B"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200104998"
     variation       1694
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141314132"
     variation       1701
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375465349"
     variation       1706
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371407165"
     variation       1718
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149795416"
     variation       1724
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376224294"
     variation       1767
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369403610"
     variation       1768
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372954698"
     variation       1771
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61746575"
     variation       1788
                     /gene="CDC25B"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376488245"
     variation       1789
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2228465"
     exon            1835..1930
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       1843
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143612466"
     variation       1846
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11570010"
     variation       1851
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374005977"
     variation       1886
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376924240"
     variation       1889
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371158244"
     variation       1904
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138180783"
     exon            1931..1993
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       1954
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371343744"
     exon            1994..2092
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       2003
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2228464"
     variation       2010
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376914644"
     variation       2011
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146556613"
     variation       2030
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199832947"
     exon            2093..2226
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       2117
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377681163"
     variation       2118
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138651339"
     variation       2120
                     /gene="CDC25B"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61742036"
     variation       2122
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11570015"
     variation       2125
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141229949"
     variation       2150
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370128666"
     variation       2152
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1056720"
     variation       2154
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61755297"
     variation       2194
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374888909"
     variation       2218
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149394412"
     variation       2222
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199659921"
     variation       2223
                     /gene="CDC25B"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200957584"
     exon            2227..2338
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       2308
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146399677"
     variation       2332
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143897481"
     exon            2339..3633
                     /gene="CDC25B"
                     /inference="alignment:Splign:1.39.8"
     variation       2353
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374526361"
     variation       2378
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11570019"
     variation       2422
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368410035"
     variation       2435
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371947700"
     variation       2442
                     /gene="CDC25B"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:514523"
     variation       2443
                     /gene="CDC25B"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:514521"
     variation       2462
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369357260"
     variation       2475
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200551395"
     variation       2488
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371951429"
     variation       2498
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372117595"
     variation       2517
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375603041"
     variation       2543
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41279402"
     variation       2544
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2229592"
     variation       2607
                     /gene="CDC25B"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:201707296"
     variation       2690
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11570020"
     variation       2701
                     /gene="CDC25B"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368742502"
     variation       2712
                     /gene="CDC25B"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139271260"
     variation       2720
                     /gene="CDC25B"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:55732615"
     variation       2749
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189019990"
     variation       2829
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6052085"
     variation       2849
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11087604"
     variation       2855
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11087605"
     variation       2923
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142635163"
     variation       2964..2965
                     /gene="CDC25B"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:35980638"
     variation       2977
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11570021"
     STS             3048..3384
                     /gene="CDC25B"
                     /standard_name="D20S1012"
                     /db_xref="UniSTS:32857"
     variation       3118
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181412320"
     variation       3145..3166
                     /gene="CDC25B"
                     /replace=""
                     /replace="tacccactcggtcccagttttg"
                     /db_xref="dbSNP:71331068"
     variation       3146..3167
                     /gene="CDC25B"
                     /replace=""
                     /replace="acccactcggtcccagttttgt"
                     /db_xref="dbSNP:11570022"
     variation       3154
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11570023"
     variation       3216
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367792437"
     variation       3363
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186687615"
     variation       3438
                     /gene="CDC25B"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1803263"
     STS             3485..3609
                     /gene="CDC25B"
                     /standard_name="SHGC-30160"
                     /db_xref="UniSTS:79344"
     variation       3508
                     /gene="CDC25B"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:8156"
     variation       3552
                     /gene="CDC25B"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3516"
     polyA_signal    3608..3613
                     /gene="CDC25B"
     polyA_site      3629
                     /gene="CDC25B"
                     /experiment="experimental evidence, no additional details
                     recorded"
     polyA_site      3633
                     /gene="CDC25B"
ORIGIN      
gcagccagtcgcggaggcggggaggctgcgcggtcagaggcgcctggagcgagcgaatcctggcccaccgcctgcccaaccgcgtgaccttgattgagttaatgaacttcacgcctcagcgtccaggtctgtaaaatggggtgtctaacgcagaccgtacagcccagctgggtttagcaaacttccgggagccagttggagcctctccccatccctagcggtgatcccaggtgacgacatgccgcggggggtcctgcggaggccaccctagggcgttgctgctgcctttgggagtgtggagctccaaaccatgtcgcgagaggcggattttgggaggccgggatcctcgcgccagggggatgtgcgagggtgtgggataaatcttaattcctccggcccacccaaagcctggaaatccagcctccgcgcctcttgccctgcgggccccgccctcagtcccgccctcatctaacccgctaccccattggtggcgtccggcggcgcggctgctgttatttttcgaatatataaggaggtggaagtggcagctgcaactagaggcttccctggctggtgcctgagcccggcgtccctcgccccccgccctccccgcatccctctcctccctcgcgcctggccctgtggctcttcctccctccctccttccccccccccccacccctcgcccgctgcctccctcggcccagccagctgtgccggcgtttgttggctgccctgcgcccggccctccagccagccttctgccggccccgccgcgatggaggtgccccagccggagcccgcgccaggctcggctctcagtccagcaggcgtgtgcggtggcgcccagcgtccgggccacctcccgggcctcctgctgggatctcatggcctcctggggtccccggtgcgggcggccgcttcctcgccggtcaccaccctcacccagaccatgcacgacctcgccgggctcggcagccgcagccgcctgacgcacctatccctgtctcgacgggcatccgaatcctccctgtcgtctgaatcctccgaatcttctgatgcaggtctctgcatggattcccccagccctatggacccccacatggcggagcagacgtttgaacaggccatccaggcagccagccggatcattcgaaacgagcagtttgccatcagacgcttccagtctatgccggtgaggctgctgggccacagccccgtgcttcggaacatcaccaactcccaggcgcccgacggccggaggaagagcgaggcgggcagtggagctgccagcagctctggggaagacaaggagaatgatggatttgtcttcaagatgccatggaagcccacacatcccagctccacccatgctctggcagagtgggccagccgcagggaagcctttgcccagagacccagctcggcccccgacctgatgtgtctcagtcctgaccggaagatggaagtggaggagctcagccccctggccctaggtcgcttctctctgacccctgcagagggggatactgaggaagatgatggatttgtggacatcctagagagtgacttaaaggatgatgatgcagttcccccaggcatggagagtctcattagtgccccactggtcaagaccttggaaaaggaagaggaaaaggacctcgtcatgtacagcaagtgccagcggctcttccgctctccgtccatgccctgcagcgtgatccggcccatcctcaagaggctggagcggccccaggacagggacacgcccgtgcagaataagcggaggcggagcgtgacccctcctgaggagcagcaggaggctgaggaacctaaagcccgcgtcctccgctcaaaatcactgtgtcacgatgagatcgagaacctcctggacagtgaccaccgagagctgattggagattactctaaggccttcctcctacagacagtagacggaaagcaccaagacctcaagtacatctcaccagaaacgatggtggccctattgacgggcaagttcagcaacatcgtggataagtttgtgattgtagactgcagatacccctatgaatatgaaggcgggcacatcaagactgcggtgaacttgcccctggaacgcgacgccgagagcttcctactgaagagccccatcgcgccctgtagcctggacaagagagtcatcctcattttccactgtgaattctcatctgagcgtgggccccgcatgtgccgtttcatcagggaacgagaccgtgctgtcaacgactaccccagcctctactaccctgagatgtatatcctgaaaggcggctacaaggagttcttccctcagcacccgaacttctgtgaaccccaggactaccggcccatgaaccacgaggccttcaaggatgagctaaagaccttccgcctcaagactcgcagctgggctggggagcggagccggcgggagctctgtagccggctgcaggaccagtgaggggcctgcgccagtcctgctacctcccttgcctttcgaggcctgaagccagctgccctatgggcctgccgggctgagggcctgctggaggcctcaggtgctgtccatgggaaagatggtgtgggtgtcctgcctgtctgccccagcccagattcccctgtgtcatcccatcattttccatatcctggtgccccccacccctggaagagcccagtctgttgagttagttaagttgggttaataccagcttaaaggcagtattttgtgtcctccaggagcttcttgtttccttgttagggttaacccttcatcttcctgtgtcctgaaacgctcctttgtgtgtgtgtcagctgaggctgggggagagccgtggtccctgaggatgggtcagagctaaactccttcctggcctgagagtcagctctctgccctgtgtacttcccgggccagggctgcccctaatctctgtaggaaccgtggtatgtctgccatgttgcccctttctcttttcccctttcctgtcccaccatacgagcacctccagcctgaacagaagctcttactctttcctatttcagtgttacctgtgtgcttggtctgtttgactttacgcccatctcaggacacttccgtagactgtttaggttcccctgtcaaatatcagttacccactcggtcccagttttgttgccccagaaagggatgttattatccttgggggctcccagggcaagggttaaggcctgaatcatgagcctgctggaagcccagcccctactgctgtgaaccctggggcctgactgctcagaacttgctgctgtcttgttgcggatggatggaaggttggatggatgggtggatggccgtggatggccgtggatgcgcagtgccttgcatacccaaaccaggtgggagcgttttgttgagcatgacagcctgcagcaggaatatatgtgtgcctatttgtgtggacaaaaatatttacacttagggtttggagctattcaagaggaaatgtcacagaagcagctaaaccaaggactgagcaccctctggattctgaatctcaagatgggggcagggctgtgcttgaaggccctgctgagtcatctgttagggccttggttcaataaagcactgagcaagttgagaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:994 -> Molecular function: GO:0004725 [protein tyrosine phosphatase activity] evidence: TAS
            GeneID:994 -> Molecular function: GO:0019901 [protein kinase binding] evidence: IPI
            GeneID:994 -> Biological process: GO:0000086 [G2/M transition of mitotic cell cycle] evidence: TAS
            GeneID:994 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: TAS
            GeneID:994 -> Biological process: GO:0001556 [oocyte maturation] evidence: IEA
            GeneID:994 -> Biological process: GO:0006468 [protein phosphorylation] evidence: IDA
            GeneID:994 -> Biological process: GO:0007067 [mitosis] evidence: IEA
            GeneID:994 -> Biological process: GO:0007144 [female meiosis I] evidence: IEA
            GeneID:994 -> Biological process: GO:0008284 [positive regulation of cell proliferation] evidence: TAS
            GeneID:994 -> Biological process: GO:0032467 [positive regulation of cytokinesis] evidence: IMP
            GeneID:994 -> Biological process: GO:0035335 [peptidyl-tyrosine dephosphorylation] evidence: TAS
            GeneID:994 -> Biological process: GO:0045860 [positive regulation of protein kinase activity] evidence: IEA
            GeneID:994 -> Biological process: GO:0045931 [positive regulation of mitotic cell cycle] evidence: IMP
            GeneID:994 -> Biological process: GO:0051301 [cell division] evidence: IEA
            GeneID:994 -> Cellular component: GO:0000922 [spindle pole] evidence: IDA
            GeneID:994 -> Cellular component: GO:0005622 [intracellular] evidence: NAS
            GeneID:994 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
            GeneID:994 -> Cellular component: GO:0005813 [centrosome] evidence: IDA
            GeneID:994 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_004349 -> EC 3.1.3.48

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.