Home |
Help |
Advanced search
2024-04-25 21:22:29, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_004336 3636 bp mRNA linear PRI 15-JUL-2013
DEFINITION Homo sapiens BUB1 mitotic checkpoint serine/threonine kinase
(BUB1), transcript variant 1, mRNA.
ACCESSION NM_004336
VERSION NM_004336.4 GI:519666795
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3636)
AUTHORS Kumar,G., Breen,E.J. and Ranganathan,S.
TITLE Identification of ovarian cancer associated genes using an
integrated approach in a Boolean framework
JOURNAL BMC Syst Biol 7, 12 (2013)
PUBMED 23383610
REMARK GeneRIF: IRAK1, CHEK1 and BUB1 may play an important role in
ovarian cancer.
Publication Status: Online-Only
REFERENCE 2 (bases 1 to 3636)
AUTHORS Yang,C., Wang,H., Xu,Y., Brinkman,K.L., Ishiyama,H., Wong,S.T. and
Xu,B.
TITLE The kinetochore protein Bub1 participates in the DNA damage
response
JOURNAL DNA Repair (Amst.) 11 (2), 185-191 (2012)
PUBMED 22071147
REMARK GeneRIF: the molecular mechanism of DNA damage-induced Bub1
activation and highlight a critical role of Bub1 in DNA damage
response
REFERENCE 3 (bases 1 to 3636)
AUTHORS Yang,C., Tang,X., Guo,X., Niikura,Y., Kitagawa,K., Cui,K.,
Wong,S.T., Fu,L. and Xu,B.
TITLE Aurora-B mediated ATM serine 1403 phosphorylation is required for
mitotic ATM activation and the spindle checkpoint
JOURNAL Mol. Cell 44 (4), 597-608 (2011)
PUBMED 22099307
REMARK GeneRIF: ATM-mediated Bub1 Ser314 phosphorylation is required for
Bub1 activity and is essential for the activation of the spindle
checkpoint.
REFERENCE 4 (bases 1 to 3636)
AUTHORS Ricke,R.M., Jeganathan,K.B. and van Deursen,J.M.
TITLE Bub1 overexpression induces aneuploidy and tumor formation through
Aurora B kinase hyperactivation
JOURNAL J. Cell Biol. 193 (6), 1049-1064 (2011)
PUBMED 21646403
REMARK GeneRIF: Results establish that Bub1 has oncogenic properties and
suggest that Aurora B is a critical target through which
overexpressed Bub1 drives aneuploidization and tumorigenesis.
REFERENCE 5 (bases 1 to 3636)
AUTHORS Seeley,T.W., Wang,L. and Zhen,J.Y.
TITLE Phosphorylation of human MAD1 by the BUB1 kinase in vitro
JOURNAL Biochem. Biophys. Res. Commun. 257 (2), 589-595 (1999)
PUBMED 10198256
REFERENCE 6 (bases 1 to 3636)
AUTHORS Jablonski,S.A., Chan,G.K., Cooke,C.A., Earnshaw,W.C. and Yen,T.J.
TITLE The hBUB1 and hBUBR1 kinases sequentially assemble onto
kinetochores during prophase with hBUBR1 concentrating at the
kinetochore plates in mitosis
JOURNAL Chromosoma 107 (6-7), 386-396 (1998)
PUBMED 9914370
REFERENCE 7 (bases 1 to 3636)
AUTHORS Ouyang,B., Lan,Z., Meadows,J., Pan,H., Fukasawa,K., Li,W. and
Dai,W.
TITLE Human Bub1: a putative spindle checkpoint kinase closely linked to
cell proliferation
JOURNAL Cell Growth Differ. 9 (10), 877-885 (1998)
PUBMED 9790499
REFERENCE 8 (bases 1 to 3636)
AUTHORS Taylor,S.S., Ha,E. and McKeon,F.
TITLE The human homologue of Bub3 is required for kinetochore
localization of Bub1 and a Mad3/Bub1-related protein kinase
JOURNAL J. Cell Biol. 142 (1), 1-11 (1998)
PUBMED 9660858
REFERENCE 9 (bases 1 to 3636)
AUTHORS Cahill,D.P., Lengauer,C., Yu,J., Riggins,G.J., Willson,J.K.,
Markowitz,S.D., Kinzler,K.W. and Vogelstein,B.
TITLE Mutations of mitotic checkpoint genes in human cancers
JOURNAL Nature 392 (6673), 300-303 (1998)
PUBMED 9521327
REFERENCE 10 (bases 1 to 3636)
AUTHORS Pangilinan,F., Li,Q., Weaver,T., Lewis,B.C., Dang,C.V. and
Spencer,F.
TITLE Mammalian BUB1 protein kinases: map positions and in vivo
expression
JOURNAL Genomics 46 (3), 379-388 (1997)
PUBMED 9441741
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AC226101.3 and AF047471.1.
This sequence is a reference standard in the RefSeqGene project.
On Jul 2, 2013 this sequence version replaced gi:211938448.
Summary: This gene encodes a serine/threonine-protein kinase that
play a central role in mitosis. The encoded protein functions in
part by phosphorylating members of the mitotic checkpoint complex
and activating the spindle checkpoint. This protein also plays a
role in inhibiting the activation of the anaphase promoting
complex/cyclosome. This protein may also function in the DNA damage
response. Mutations in this gene have been associated with
aneuploidy and several forms of cancer. Alternate splicing results
in multiple transcript variants. [provided by RefSeq, Jul 2013].
Transcript Variant: This variant (1) represents the longest
transcript and encodes the longest isoform (1).
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AK291221.1, AF053305.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-77 AC226101.3 2118-2194
78-3502 AF047471.1 1-3425
3503-3636 AC226101.3 42394-42527
FEATURES Location/Qualifiers
source 1..3636
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="2"
/map="2q14"
gene 1..3636
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/note="BUB1 mitotic checkpoint serine/threonine kinase"
/db_xref="GeneID:699"
/db_xref="HGNC:1148"
/db_xref="HPRD:03907"
/db_xref="MIM:602452"
exon 1..138
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/inference="alignment:Splign:1.39.8"
misc_feature 8..10
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/note="upstream in-frame stop codon"
CDS 113..3370
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/EC_number="2.7.11.1"
/note="isoform 1 is encoded by transcript variant 1;
putative serine/threonine-protein kinase; mitotic spindle
checkpoint kinase; BUB1 budding uninhibited by
benzimidazoles 1 homolog"
/codon_start=1
/product="mitotic checkpoint serine/threonine-protein
kinase BUB1 isoform 1"
/protein_id="NP_004327.1"
/db_xref="GI:4757878"
/db_xref="CCDS:CCDS33273.1"
/db_xref="GeneID:699"
/db_xref="HGNC:1148"
/db_xref="HPRD:03907"
/db_xref="MIM:602452"
/translation="
MDTPENVLQMLEAHMQSYKGNDPLGEWERYIQWVEENFPENKEYLITLLEHLMKEFLDKKKYHNDPRFISYCLKFAEYNSDLHQFFEFLYNHGIGTLSSPLYIAWAGHLEAQGELQHASAVLQRGIQNQAEPREFLQQQYRLFQTRLTETHLPAQARTSEPLHNVQVLNQMITSKSNPGNNMACISKNQGSELSGVISSACDKESNMERRVITISKSEYSVHSSLASKVDVEQVVMYCKEKLIRGESEFSFEELRAQKYNQRRKHEQWVNEDRHYMKRKEANAFEEQLLKQKMDELHKKLHQVVETSHEDLPASQERSEVNPARMGPSVGSQQELRAPCLPVTYQQTPVNMEKNPREAPPVVPPLANAISAALVSPATSQSIAPPVPLKAQTVTDSMFAVASKDAGCVNKSTHEFKPQSGAEIKEGCETHKVANTSSFHTTPNTSLGMVQATPSKVQPSPTVHTKEALGFIMNMFQAPTLPDISDDKDEWQSLDQNEDAFEAQFQKNVRSSGAWGVNKIISSLSSAFHVFEDGNKENYGLPQPKNKPTGARTFGERSVSRLPSKPKEEVPHAEEFLDDSTVWGIRCNKTLAPSPKSPGDFTSAAQLASTPFHKLPVESVHILEDKENVVAKQCTQATLDSCEENMVVPSRDGKFSPIQEKSPKQALSSHMYSASLLRLSQPAAGGVLTCEAELGVEACRLTDTDAAIAEDPPDAIAGLQAEWMQMSSLGTVDAPNFIVGNPWDDKLIFKLLSGLSKPVSSYPNTFEWQCKLPAIKPKTEFQLGSKLVYVHHLLGEGAFAQVYEATQGDLNDAKNKQKFVLKVQKPANPWEFYIGTQLMERLKPSMQHMFMKFYSAHLFQNGSVLVGELYSYGTLLNAINLYKNTPEKVMPQGLVISFAMRMLYMIEQVHDCEIIHGDIKPDNFILGNGFLEQDDEDDLSAGLALIDLGQSIDMKLFPKGTIFTAKCETSGFQCVEMLSNKPWNYQIDYFGVAATVYCMLFGTYMKVKNEGGECKPEGLFRRLPHLDMWNEFFHVMLNIPDCHHLPSLDLLRQKLKKVFQQHYTNKIRALRNRLIVLLLECKRSRK
"
misc_feature 113..550
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (O43683.1);
Region: Necessary for kinetochore localization"
misc_feature 128..490
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/note="Mad3/BUB1 homology region 1; Region: Mad3_BUB1_I;
pfam08311"
/db_xref="CDD:191994"
misc_feature 284..307
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (O43683.1);
Region: Nuclear localization signal (Potential)"
misc_feature 407..508
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (O43683.1);
Region: Necessary for interaction with CASC5"
misc_feature 797..880
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (O43683.1);
Region: Necessary for interaction with BUB3"
misc_feature 1052..1054
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(O43683.1); phosphorylation site"
misc_feature 1052..1054
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1235..1237
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(O43683.1); phosphorylation site"
misc_feature 1484..1540
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (O43683.1);
Region: Essential for loading of BUBR1, MAD1L1 and MAD2L1
to kinetochores"
misc_feature 1715..1723
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (O43683.1);
Region: KEN box 1"
misc_feature 1799..1801
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(O43683.1); phosphorylation site"
misc_feature 1889..1891
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(O43683.1); phosphorylation site"
misc_feature 1898..1900
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(O43683.1); phosphorylation site"
misc_feature 1937..1939
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine, by CDK1; propagated from
UniProtKB/Swiss-Prot (O43683.1); phosphorylation site"
misc_feature 1937..1939
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:00302"
misc_feature 1985..1993
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (O43683.1);
Region: KEN box 2"
misc_feature 2075..2077
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(O43683.1); phosphorylation site"
misc_feature 2075..2077
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 2489..3106
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/note="Catalytic domain of Protein Kinases; Region: PKc;
cd00180"
/db_xref="CDD:173623"
misc_feature order(2489..2503,2513..2515,2567..2569,2573..2575,
2660..2662,2708..2719,2729..2731,2735..2737,2861..2863,
2867..2869,2873..2878,2882..2884,2948..2950,2957..2959,
3011..3022)
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/note="active site"
/db_xref="CDD:173623"
misc_feature order(2489..2503,2513..2515,2567..2569,2573..2575,
2660..2662,2708..2719,2729..2731,2861..2863,2867..2869,
2873..2878,2882..2884,2948..2950)
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:173623"
misc_feature order(2501..2503,2729..2731,2735..2737,2861..2863,
2867..2869,2873..2875,2957..2959,3011..3022)
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/note="substrate binding site [chemical binding]; other
site"
/db_xref="CDD:173623"
misc_feature order(2945..2965,3011..3022)
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/note="activation loop (A-loop); other site"
/db_xref="CDD:173623"
exon 139..198
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/inference="alignment:Splign:1.39.8"
exon 199..337
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/inference="alignment:Splign:1.39.8"
exon 338..534
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/inference="alignment:Splign:1.39.8"
exon 535..578
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/inference="alignment:Splign:1.39.8"
exon 579..679
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/inference="alignment:Splign:1.39.8"
exon 680..732
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/inference="alignment:Splign:1.39.8"
exon 733..917
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/inference="alignment:Splign:1.39.8"
exon 918..1069
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/inference="alignment:Splign:1.39.8"
exon 1070..1329
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/inference="alignment:Splign:1.39.8"
exon 1330..1388
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/inference="alignment:Splign:1.39.8"
exon 1389..1517
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/inference="alignment:Splign:1.39.8"
exon 1518..1628
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/inference="alignment:Splign:1.39.8"
exon 1629..1728
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/inference="alignment:Splign:1.39.8"
exon 1729..1810
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/inference="alignment:Splign:1.39.8"
exon 1811..1988
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/inference="alignment:Splign:1.39.8"
exon 1989..2076
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/inference="alignment:Splign:1.39.8"
exon 2077..2315
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/inference="alignment:Splign:1.39.8"
exon 2316..2459
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/inference="alignment:Splign:1.39.8"
exon 2460..2575
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/inference="alignment:Splign:1.39.8"
exon 2576..2737
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/inference="alignment:Splign:1.39.8"
exon 2738..2895
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/inference="alignment:Splign:1.39.8"
exon 2896..3067
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/inference="alignment:Splign:1.39.8"
exon 3068..3174
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/inference="alignment:Splign:1.39.8"
exon 3175..3636
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/inference="alignment:Splign:1.39.8"
polyA_signal 3474..3479
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
polyA_site 3502
/gene="BUB1"
/gene_synonym="BUB1A; BUB1L; hBUB1"
/note="The 3'-most polyA site has not been determined.
This is an internal polyA site."
ORIGIN
ggcgccctgaaacgttcggcgagccgactgcggctgcgcggggtattcgaatcggcggcggcttctagtttgcggttcaggtttggccgctgccggccagcgtcctctggccatggacaccccggaaaatgtccttcagatgcttgaagcccacatgcagagctacaagggcaatgaccctcttggtgaatgggaaagatacatacagtgggtagaagagaattttcctgagaataaagaatacttgataactttactagaacatttaatgaaggaatttttagataagaagaaataccacaatgacccaagattcatcagttattgtttaaaatttgctgagtacaacagtgacctccatcaattttttgagtttctgtacaaccatgggattggaaccctgtcatcccctctgtacattgcctgggcggggcatctggaagcccaaggagagctgcagcatgccagtgctgtccttcagagaggaattcaaaaccaggctgaacccagagagttcctgcaacaacaatacaggttatttcagacacgcctcactgaaacccatttgccagctcaagctagaacctcagaacctctgcataatgttcaggttttaaatcaaatgataacatcaaaatcaaatccaggaaataacatggcctgcatttctaagaatcagggttcagagctttctggagtgatatcttcagcttgtgataaagagtcaaatatggaacgaagagtgatcacgatttctaaatcagaatattctgtgcactcatctttggcatccaaagttgatgttgagcaggttgttatgtattgcaaggagaagcttattcgtggggaatcagaattttcctttgaagaattgagagcccagaaatacaatcaacggagaaagcatgagcaatgggtaaatgaagacagacattatatgaaaaggaaagaagcaaatgcttttgaagaacagctattaaaacagaaaatggatgaacttcataagaagttgcatcaggtggtggagacatcccatgaggatctgcccgcttcccaggaaaggtccgaggttaatccagcacgtatggggccaagtgtaggctcccagcaggaactgagagcgccatgtcttccagtaacctatcagcagacaccagtgaacatggaaaagaacccaagagaggcacctcctgttgttcctcctttggcaaatgctatttctgcagctttggtgtccccagccaccagccagagcattgctcctcctgttcctttgaaagcccagacagtaacagactccatgtttgcagtggccagcaaagatgctggatgtgtgaataagagtactcatgaattcaagccacagagtggagcagagatcaaagaagggtgtgaaacacataaggttgccaacacaagttcttttcacacaactccaaacacatcactgggaatggttcaggcaacgccatccaaagtgcagccatcacccaccgtgcacacaaaagaagcattaggtttcatcatgaatatgtttcaggctcctacacttcctgatatttctgatgacaaagatgaatggcaatctctagatcaaaatgaagatgcatttgaagcccagtttcaaaaaaatgtaaggtcatctggggcttggggagtcaataagatcatctcttctttgtcatctgcttttcatgtgtttgaagatggaaacaaagaaaattatggattaccacagcctaaaaataaacccacaggagccaggacctttggagaacgctctgtcagcagacttccttcaaaaccaaaggaggaagtgcctcatgctgaagagtttttggatgactcaactgtatggggtattcgctgcaacaaaaccctggcacccagtcctaagagcccaggagacttcacatctgctgcacaacttgcgtctacaccattccacaagcttccagtggagtcagtgcacattttagaagataaagaaaatgtggtagcaaaacagtgtacccaggcgactttggattcttgtgaggaaaacatggtggtgccttcaagggatggaaaattcagtccaattcaagagaaaagcccaaaacaggccttgtcgtctcacatgtattcagcatccttacttcgtctgagccagcctgctgcaggtggggtacttacctgtgaggcagagttgggcgttgaggcttgcagactcacagacactgacgctgccattgcagaagatccaccagatgctattgctgggctccaagcagaatggatgcagatgagttcacttgggactgttgatgctccaaacttcattgttgggaacccatgggatgataagctgattttcaaacttttatctgggctttctaaaccagtgagttcctatccaaatacttttgaatggcaatgtaaacttccagccatcaagcccaagactgaatttcaattgggttctaagctggtctatgtccatcaccttcttggagaaggagcctttgcccaggtgtacgaagctacccagggagatctgaatgatgctaaaaataaacagaaatttgttttaaaggtccaaaagcctgccaacccctgggaattctacattgggacccagttgatggaaagactaaagccatctatgcagcacatgtttatgaagttctattctgcccacttattccagaatggcagtgtattagtaggagagctctacagctatggaacattattaaatgccattaacctctataaaaatacccctgaaaaagtgatgcctcaaggtcttgtcatctcttttgctatgagaatgctttacatgattgagcaagtgcatgactgtgaaatcattcatggagacattaaaccagacaatttcatacttggaaacggatttttggaacaggatgatgaagatgatttatctgctggcttggcactgattgacctgggtcagagtatagatatgaaactttttccaaaaggaactatattcacagcaaagtgtgaaacatctggttttcagtgtgttgagatgctcagcaacaaaccatggaactaccagatcgattactttggggttgctgcaacagtatattgcatgctctttggcacttacatgaaagtgaaaaatgaaggaggagagtgtaagcctgaaggtctttttagaaggcttcctcatttggatatgtggaatgaattttttcatgttatgttgaatattccagattgtcatcatcttccatctttggatttgttaaggcaaaagctgaagaaagtatttcaacaacactatactaacaagattagggccctacgtaataggctaattgtactgctcttagaatgtaagcgttcacgaaaataaaatttggatatagacagtccttaaaaatcacactgtaaatatgaatctgctcactttaaacctgtttttttttcatttattgtttatgtaaatgtttgttaaaaataaatcccatggaatatttccatgtaacttagttgttataaatatttcaacaaaatatacaaccccataaggtccctatatagcaggctgattgggctgcttctgggatgcaagcatttgtgagaataattcagacatgagcattctctagaaatcacttt
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:699 -> Molecular function: GO:0004672 [protein kinase activity] evidence: TAS
GeneID:699 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: IEA
GeneID:699 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:699 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
GeneID:699 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: TAS
GeneID:699 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA
GeneID:699 -> Biological process: GO:0007059 [chromosome segregation] evidence: IEA
GeneID:699 -> Biological process: GO:0007063 [regulation of sister chromatid cohesion] evidence: IDA
GeneID:699 -> Biological process: GO:0007067 [mitosis] evidence: IEA
GeneID:699 -> Biological process: GO:0007093 [mitotic cell cycle checkpoint] evidence: TAS
GeneID:699 -> Biological process: GO:0007094 [mitotic spindle assembly checkpoint] evidence: TAS
GeneID:699 -> Biological process: GO:0008283 [cell proliferation] evidence: IEA
GeneID:699 -> Biological process: GO:0019048 [modulation by virus of host morphology or physiology] evidence: IEA
GeneID:699 -> Biological process: GO:0051301 [cell division] evidence: IEA
GeneID:699 -> Biological process: GO:0051983 [regulation of chromosome segregation] evidence: IMP
GeneID:699 -> Biological process: GO:0071173 [spindle assembly checkpoint] evidence: IDA
GeneID:699 -> Biological process: GO:0071173 [spindle assembly checkpoint] evidence: IMP
GeneID:699 -> Cellular component: GO:0000776 [kinetochore] evidence: IDA
GeneID:699 -> Cellular component: GO:0000777 [condensed chromosome kinetochore] evidence: IDA
GeneID:699 -> Cellular component: GO:0000780 [condensed nuclear chromosome, centromeric region] evidence: IEA
GeneID:699 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_004327 -> EC 2.7.11.1
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.