GGRNA Home | Help | Advanced search

2020-10-26 19:10:52, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_004298               4755 bp    mRNA    linear   PRI 17-JUN-2013
DEFINITION  Homo sapiens nucleoporin 155kDa (NUP155), transcript variant 2,
            mRNA.
ACCESSION   NM_004298
VERSION     NM_004298.3  GI:509155835
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 4755)
  AUTHORS   Tarazon,E., Rivera,M., Rosello-Lleti,E., Molina-Navarro,M.M.,
            Sanchez-Lazaro,I.J., Espana,F., Montero,J.A., Lago,F.,
            Gonzalez-Juanatey,J.R. and Portoles,M.
  TITLE     Heart failure induces significant changes in nuclear pore complex
            of human cardiomyocytes
  JOURNAL   PLoS ONE 7 (11), E48957 (2012)
   PUBMED   23152829
REFERENCE   2  (bases 1 to 4755)
  AUTHORS   Parvez,B. and Darbar,D.
  TITLE     The 'missing' link in atrial fibrillation heritability
  JOURNAL   J Electrocardiol 44 (6), 641-644 (2011)
   PUBMED   21924735
REFERENCE   3  (bases 1 to 4755)
  AUTHORS   Kehat,I., Accornero,F., Aronow,B.J. and Molkentin,J.D.
  TITLE     Modulation of chromatin position and gene expression by HDAC4
            interaction with nucleoporins
  JOURNAL   J. Cell Biol. 193 (1), 21-29 (2011)
   PUBMED   21464227
  REMARK    GeneRIF: The Nup155-mediated localization was required for HDAC4's
            effect on gene expression.
REFERENCE   4  (bases 1 to 4755)
  AUTHORS   Mitchell,J.M., Mansfeld,J., Capitanio,J., Kutay,U. and Wozniak,R.W.
  TITLE     Pom121 links two essential subcomplexes of the nuclear pore complex
            core to the membrane
  JOURNAL   J. Cell Biol. 191 (3), 505-521 (2010)
   PUBMED   20974814
  REMARK    GeneRIF: The Nup155 depletion massively alters nuclear envelope
            structure, causing a dramatic decrease in Nuclear pore complexes
            numbers and the improper targeting of membrane proteins to the
            inner nuclear membrane.
REFERENCE   5  (bases 1 to 4755)
  AUTHORS   Rayala,H.J., Kendirgi,F., Barry,D.M., Majerus,P.W. and Wente,S.R.
  TITLE     The mRNA export factor human Gle1 interacts with the nuclear pore
            complex protein Nup155
  JOURNAL   Mol. Cell Proteomics 3 (2), 145-155 (2004)
   PUBMED   14645504
REFERENCE   6  (bases 1 to 4755)
  AUTHORS   Le Rouzic,E., Mousnier,A., Rustum,C., Stutz,F., Hallberg,E.,
            Dargemont,C. and Benichou,S.
  TITLE     Docking of HIV-1 Vpr to the nuclear envelope is mediated by the
            interaction with the nucleoporin hCG1
  JOURNAL   J. Biol. Chem. 277 (47), 45091-45098 (2002)
   PUBMED   12228227
REFERENCE   7  (bases 1 to 4755)
  AUTHORS   Zhang,X., Yang,H., Yu,J., Chen,C., Zhang,G., Bao,J., Du,Y.,
            Kibukawa,M., Li,Z., Wang,J., Hu,S., Dong,W., Wang,J., Gregersen,N.,
            Niebuhr,E. and Bolund,L.
  TITLE     Genomic organization, transcript variants and comparative analysis
            of the human nucleoporin 155 (NUP155) gene
  JOURNAL   Gene 288 (1-2), 9-18 (2002)
   PUBMED   12034489
REFERENCE   8  (bases 1 to 4755)
  AUTHORS   Shiota,C., Coffey,J., Grimsby,J., Grippo,J.F. and Magnuson,M.A.
  TITLE     Nuclear import of hepatic glucokinase depends upon glucokinase
            regulatory protein, whereas export is due to a nuclear export
            signal sequence in glucokinase
  JOURNAL   J. Biol. Chem. 274 (52), 37125-37130 (1999)
   PUBMED   10601273
REFERENCE   9  (bases 1 to 4755)
  AUTHORS   Zhang,X., Yang,H., Corydon,M.J., Zhang,X., Pedersen,S.,
            Korenberg,J.R., Chen,X.N., Laporte,J., Gregersen,N., Niebuhr,E.,
            Liu,G. and Bolund,L.
  TITLE     Localization of a human nucleoporin 155 gene (NUP155) to the 5p13
            region and cloning of its cDNA
  JOURNAL   Genomics 57 (1), 144-151 (1999)
   PUBMED   10191094
REFERENCE   10 (bases 1 to 4755)
  AUTHORS   Gorlich,D. and Mattaj,I.W.
  TITLE     Nucleocytoplasmic transport
  JOURNAL   Science 271 (5255), 1513-1518 (1996)
   PUBMED   8599106
  REMARK    Review article
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DC401967.1, DA249538.1,
            AB018334.1, BM478072.1, BC039257.1, AI037962.1 and BQ435836.1.
            On Jun 4, 2013 this sequence version replaced gi:24430147.
            
            Summary: Nucleoporins are proteins that play an important role in
            the assembly and functioning of the nuclear pore complex (NPC)
            which regulates the movement of macromolecules across the nuclear
            envelope (NE). The protein encoded by this gene plays a role in the
            fusion of NE vesicles and formation of the double membrane NE. The
            protein may also be involved in cardiac physiology and may be
            associated with the pathogenesis of atrial fibrillation.
            Alternative splicing results in multiple transcript variants of
            this gene. A pseudogene associated with this gene is located on
            chromosome 6. [provided by RefSeq, May 2013].
            
            Transcript Variant: This variant (2) uses an alternate splice site
            in the 5' terminal exon and uses a downstream start codon compared
            to variant 1. It encodes isoform 2 which has a shorter N-terminus
            compared to isoform 1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB018334.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-88                DC401967.1         1-88
            89-341              DA249538.1         1-253
            342-504             AB018334.1         1-163
            505-505             BM478072.1         254-254
            506-4191            AB018334.1         165-3850
            4192-4540           BC039257.1         4004-4352
            4541-4726           AI037962.1         30-215              c
            4727-4731           BQ435836.1         683-687
            4732-4755           AI037962.1         1-24                c
FEATURES             Location/Qualifiers
     source          1..4755
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="5"
                     /map="5p13.1"
     gene            1..4755
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /note="nucleoporin 155kDa"
                     /db_xref="GeneID:9631"
                     /db_xref="HGNC:8063"
                     /db_xref="MIM:606694"
     exon            1..461
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    404..406
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /note="upstream in-frame stop codon"
     exon            462..599
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     CDS             482..4480
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /note="isoform 2 is encoded by transcript variant 2;
                     nuclear pore complex protein Nup155; 155 kDa nucleoporin"
                     /codon_start=1
                     /product="nuclear pore complex protein Nup155 isoform 2"
                     /protein_id="NP_004289.1"
                     /db_xref="GI:4758844"
                     /db_xref="CCDS:CCDS43310.1"
                     /db_xref="GeneID:9631"
                     /db_xref="HGNC:8063"
                     /db_xref="MIM:606694"
                     /translation="
MSDMDYPLQGPGLLSVPNLPEISSIRRVPLPPELVEQFGHMQCNCMMGVFPPISRAWLTIDSDIFMWNYEDGGDLAYFDGLSETILAVGLVKPKAGIFQPHVRHLLVLATPVDIVILGLSYANLQTGSGVLNDSLSGGMQLLPDPLYSLPTDNTYLLTITSTDNGRIFLAGKDGCLYEVAYQAEAGWFSQRCRKINHSKSSLSFLVPSLLQFTFSEDDPILQIAIDNSRNILYTRSEKGVIQVYDLGQDGQGMSRVASVSQNAIVSAAGNIARTIDRSVFKPIVQIAVIENSESLDCQLLAVTHAGVRLYFSTCPFRQPLARPNTLTLVHVRLPPGFSASSTVEKPSKVHRALYSKGILLMAASENEDNDILWCVNHDTFPFQKPMMETQMTAGVDGHSWALSAIDELKVDKIITPLNKDHIPITDSPVVVQQHMLPPKKFVLLSAQGSLMFHKLRPVDQLRHLLVSNVGGDGEEIERFFKLHQEDQACATCLILACSTAACDREVSAWATRAFFRYGGEAQMRFPTTLPPPSNVGPILGSPVYSSSPVPSGSPYPNPSFLGTPSHGIQPPAMSTPVCALGNPATQATNMSCVTGPEIVYSGKHNGICIYFSRIMGNIWDASLVVERIFKSGNREITAIESSVPCQLLESVLQELKGLQEFLDRNSQFAGGPLGNPNTTAKVQQRLIGFMRPENGNPQQMQQELQRKFHEAQLSEKISLQAIQQLVRKSYQALALWKLLCEHQFTIIVAELQKELQEQLKITTFKDLVIRDKELTGALIASLINCYIRDNAAVDGISLHLQDICPLLYSTDDAICSKANELLQRSRQVQNKTEKERMLRESLKEYQKISNQVDLSNVCAQYRQVRFYEGVVELSLTAAEKKDPQGLGLHFYKHGEPEEDIVGLQAFQERLNSYKCITDTLQELVNQSKAAPQSPSVPKKPGPPVLSSDPNMLSNEEAGHHFEQMLKLSQRSKDELFSIALYNWLIQVDLADKLLQVASPFLEPHLVRMAKVDQNRVRYMDLLWRYYEKNRSFSNAARVLSRLADMHSTEISLQQRLEYIARAILSAKSSTAISSIAADGEFLHELEEKMEVARIQLQIQETLQRQYSHHSSVQDAVSQLDSELMDITKLYGEFADPFKLAECKLAIIHCAGYSDPILVQTLWQDIIEKELSDSVTLSSSDRMHALSLKIVLLGKIYAGTPRFFPLDFIVQFLEQQVCTLNWDVGFVIQTMNEIGVPLPRLLEVYDQLFKSRDPFWNRMKKPLHLLDCIHVLLIRYVENPSQVLNCERRRFTNLCLDAVCGYLVELQSMSSSVAVQAITGNFKSLQAKLERLH
"
     misc_feature    530..1831
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /note="Nup133 N terminal like; Region: Nucleoporin_N;
                     pfam08801"
                     /db_xref="CDD:204070"
     misc_feature    2402..4069
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /note="Non-repetitive/WGA-negative nucleoporin C-terminal;
                     Region: Nucleoporin_C; pfam03177"
                     /db_xref="CDD:190553"
     exon            600..696
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            697..767
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            768..860
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            861..1027
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            1028..1133
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            1134..1207
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            1208..1299
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            1300..1397
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            1398..1550
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            1551..1651
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            1652..1822
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            1823..1933
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            1934..2028
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            2029..2117
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            2118..2180
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            2181..2328
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            2329..2395
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            2396..2511
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            2512..2609
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            2610..2740
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            2741..2932
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            2933..3071
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            3072..3207
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            3208..3361
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            3362..3466
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            3467..3621
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            3622..3751
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     STS             3678..3839
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /standard_name="MARC_21512-21513:1032982746:3"
                     /db_xref="UniSTS:268564"
     exon            3752..3865
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            3866..3986
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            3987..4097
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            4098..4234
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            4235..4341
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     exon            4342..4747
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /inference="alignment:Splign:1.39.8"
     polyA_signal    4519..4524
                     /gene="NUP155"
                     /gene_synonym="N155"
     polyA_site      4542
                     /gene="NUP155"
                     /gene_synonym="N155"
                     /note="This is an internal site."
     polyA_signal    4724..4729
                     /gene="NUP155"
                     /gene_synonym="N155"
     polyA_site      4747
                     /gene="NUP155"
                     /gene_synonym="N155"
ORIGIN      
atgaagcggaagtgcgtcatgtcgaggcgccaaggcgctcgtttggcgcgcgcgccctaggcggcggatctaagctaacttcttggatcttttcttgtttctccttggtttttgactttttctggaccctggtgtctacgatttccgagatgccgtcttctttgttgggcgcggcgatgccggcctctacatctgccgcagccctgcaggaagctctggaaaatgctggacggctcatcgaccgtcagttgcaagaggaccgcatgtacccggacctttccgagctgcttatggtgtctgccccaagtgagtgatagtgaccctgctttctcaacctaaaggactctcgcctgacttcctaatttgctacttatccccagcgttggtcccggcgaggatatgctgagatttatggcactgttggctgcatttttggagaacagcaagcagcttcttttcagataatcccaccgtttctggcatgtcagatatggattatcctttgcaaggacctggtttgctgtccgtacccaaccttccagagatcagttccatccgaagagttcctctcccacctgaacttgttgagcagtttggacatatgcagtgtaattgcatgatgggtgtgttccctcctatcagcagagcttggctcacaattgacagtgatatattcatgtggaactatgaggatggaggagaccttgcctattttgatggacttagtgagactattcttgctgtggggcttgtgaagccaaaagcaggcatctttcaacctcatgtgcgacacctcctggttttggcgacccctgtagacatagtaattcttggactcagctatgctaatttgcaaacaggttctggagttcttaatgatagtttgtctggtggaatgcagttgcttccagatcctttatattctcttcctactgataatacttaccttttaacaataacttccactgataatggcagaattttcttggctggaaaggatggctgtttatatgaagtagcctaccaggctgaagcagggtggtttagccaaagatgtaggaaaataaaccactcaaagagctcactttctttccttgttccttccttgctacaattcacgttctcagaagatgatcctattcttcaaattgcaattgataattctagaaatattttatatacacgatctgagaaaggagtaatacaggtgtatgatttgggacaagatggacaaggaatgagcagagttgcctctgtgtcacagaatgccattgtctctgctgctggtaacattgctaggaccatcgatcgttctgtttttaaaccaattgtccaaatagcagtgattgaaaattctgaatcactggactgtcagttattggctgtcacacatgcaggtgttaggttatattttagcacttgtccattcagacagccattagcacggcctaatacactgacgctggttcatgtccgcttacctcctggattctcagcatcttcaaccgtggaaaagccttcaaaagtacatagagctctttatagtaaaggtattctattgatggcagcctcagaaaatgaggataatgatattttatggtgtgtcaaccatgatacttttcctttccaaaagccaatgatggaaacccagatgacagctggtgttgatggtcattcctgggctctttctgcgatagatgaattgaaagtagataaaataattacacctttaaacaaggatcatattccaataactgattcaccagttgttgtacagcagcacatgttacctccgaagaaatttgttctcctctcagcacaggggagccttatgtttcataaacttagacctgtagatcaactgaggcatctacttgtgagtaatgtgggaggagatggagaagagattgaaagattctttaaattacatcaggaagaccaggcttgtgcaacttgccttattcttgcttgctccactgctgcctgtgatagagaagtatctgcctgggctactcgggctttctttaggtatggtggtgaagcacagatgagatttccaaccactcttccgcctccaagtaatgttggtcccatcttggggtctcctgtctattctagttctcctgttcctagtggtagtccctatccaaatccatcctttttgggaacaccgtctcatggtatacagcctcctgccatgtcaactccagtgtgtgctctgggaaacccagcaactcaggccacaaatatgagttgtgtgactggaccagagattgtgtactctggaaaacacaatggtatttgcatttacttttctcggatcatgggaaacatttgggatgcaagcttagttgtggagagaatattcaagagtggcaacagagagatcactgcaattgaaagtagtgttccctgccaactgctagagtcagtgctacaagaactaaagggtttgcaggaatttctagacagaaactcccagtttgcaggaggaccattaggaaatccaaatactactgctaaagtgcagcagaggctgataggattcatgcgtcctgaaaacggaaatccccagcaaatgcaacaggaactgcagaggaagtttcatgaggctcaactaagtgaaaagatttcacttcaggcaattcagcagttggttcgaaaatcatatcaggctctggctttatggaaacttctttgtgaacatcaattcactatcattgtggcagaacttcagaaggaacttcaagagcagctgaagatcaccacctttaaagatcttgtaatcagggacaaagaactcacaggggcattaattgcttctcttatcaactgctacatcagagataatgccgctgttgatggcattagtttacatttacaggatatctgcccacttctatatagcactgatgatgcaatttgttctaaggcaaatgagcttctccagcgttcccgacaagttcaaaataagactgaaaaagaaagaatgttaagggaatcattaaaggaatatcaaaaaattagcaatcaagtggacctttccaatgtttgtgctcagtatagacaagtgagattttatgagggtgtggtggaactttctcttacggctgcagagaaaaaagatcctcaaggtcttgggcttcatttctataaacatggagaaccagaagaagacatagttggacttcaggccttccaagaaagattaaacagttacaaatgcattacagacacacttcaagaactggtaaatcaaagtaaggccgctcctcagtctcccagtgtacccaaaaaacctggtcctccagtgttgtcatctgatccaaatatgctgagtaatgaagaagcaggacatcattttgaacaaatgcttaaattgtcacagcgatccaaggatgagctctttagtattgccctttataattggctaatacaagtcgaccttgcagataagctgctacaggttgcttctccatttctggagccacatctagtccgaatggccaaagttgatcaaaacagagttcgttatatggatttactctggcggtattacgagaagaacagaagtttcagtaatgctgctcgtgtactgtccagactggctgacatgcatagcacagaaatttcacttcagcagcgactagagtacattgctcgagccattcttagtgccaaaagttccactgccatttcatcaatagctgccgatggtgaatttcttcatgaattagaagaaaaaatggaggttgctaggatccaacttcagatacaggagacactacaaaggcagtattcccatcattcttctgtacaggatgcagtttctcagctggattctgagctgatggacataactaagctttatggggaatttgctgacccatttaaacttgcagagtgcaaacttgcaataattcattgtgccggttattcagaccctatattggtgcagacactttggcaagatatcatagagaaagaattgagtgacagtgtgacattgagctcctcggatagaatgcatgctcttagtctcaagattgttctccttggcaaaatttatgctggcacaccacgcttctttcctttagattttattgtacagtttttagaacagcaggtttgtactttgaactgggatgtgggcttcgtaatacagacaatgaatgaaattggagtaccattacctagactactagaagtttatgatcagttgttcaaatcacgggatccattctggaacagaatgaagaagccactgcaccttttggattgtatacatgtattattgataagatatgttgagaatcccagccaagttttaaattgtgaaaggagaagatttacaaatctctgcctggatgctgtttgtggttaccttgttgagctccagtctatgagctcgtcagtagcagtacaagccatcactgggaattttaaatctcttcaagctaaattagaacggcttcattaattactgtgatatactttcatccgttttatgatctgtaaaataaaaactcagctgggtccagatatcaggtgttctaaatctaagaatgtaagaacaatcttaatagaaatatgtttttaataagtggctaatatctacaaatagtacctttgctaaatgaattcttttttatgactattttgttttttagtaattgggtgaaaaaacaactgaaatgagattatttattattttaacataaggattaaaaaaatttagaaactcttaaaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:9631 -> Molecular function: GO:0005215 [transporter activity] evidence: TAS
            GeneID:9631 -> Molecular function: GO:0017056 [structural constituent of nuclear pore] evidence: IEA
            GeneID:9631 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: TAS
            GeneID:9631 -> Biological process: GO:0005975 [carbohydrate metabolic process] evidence: TAS
            GeneID:9631 -> Biological process: GO:0006406 [mRNA export from nucleus] evidence: IEA
            GeneID:9631 -> Biological process: GO:0006606 [protein import into nucleus] evidence: IEA
            GeneID:9631 -> Biological process: GO:0006998 [nuclear envelope organization] evidence: IDA
            GeneID:9631 -> Biological process: GO:0007077 [mitotic nuclear envelope disassembly] evidence: TAS
            GeneID:9631 -> Biological process: GO:0008645 [hexose transport] evidence: TAS
            GeneID:9631 -> Biological process: GO:0010827 [regulation of glucose transport] evidence: TAS
            GeneID:9631 -> Biological process: GO:0015758 [glucose transport] evidence: TAS
            GeneID:9631 -> Biological process: GO:0016032 [viral process] evidence: TAS
            GeneID:9631 -> Biological process: GO:0019221 [cytokine-mediated signaling pathway] evidence: TAS
            GeneID:9631 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS
            GeneID:9631 -> Biological process: GO:0055085 [transmembrane transport] evidence: TAS
            GeneID:9631 -> Biological process: GO:0086014 [regulation of atrial cardiac muscle cell action potential] evidence: IEA
            GeneID:9631 -> Cellular component: GO:0005635 [nuclear envelope] evidence: IDA
            GeneID:9631 -> Cellular component: GO:0005635 [nuclear envelope] evidence: TAS
            GeneID:9631 -> Cellular component: GO:0005643 [nuclear pore] evidence: IEA
            GeneID:9631 -> Cellular component: GO:0031965 [nuclear membrane] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.