Home |
Help |
Advanced search
2024-05-11 11:53:16, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_004295 2902 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens TNF receptor-associated factor 4 (TRAF4), mRNA.
ACCESSION NM_004295
VERSION NM_004295.3 GI:118402591
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2902)
AUTHORS Zepp,J.A., Liu,C., Qian,W., Wu,L., Gulen,M.F., Kang,Z. and Li,X.
TITLE Cutting edge: TNF receptor-associated factor 4 restricts
IL-17-mediated pathology and signaling processes
JOURNAL J. Immunol. 189 (1), 33-37 (2012)
PUBMED 22649194
REMARK GeneRIF: Primary cells from TRAF4-deficient mice display markedly
enhanced IL-17-activated signaling pathways and induction of
chemokine mRNA/
REFERENCE 2 (bases 1 to 2902)
AUTHORS Marinis,J.M., Hutti,J.E., Homer,C.R., Cobb,B.A., Cantley,L.C.,
McDonald,C. and Abbott,D.W.
TITLE IkappaB kinase alpha phosphorylation of TRAF4 downregulates innate
immune signaling
JOURNAL Mol. Cell. Biol. 32 (13), 2479-2489 (2012)
PUBMED 22547678
REMARK GeneRIF: Like IKKalpha, TRAF4 is atypical within its family because
it is the only TRAF family member to negatively regulate innate
immune signaling. IKKalpha's phosphorylation of serine-426 on TRAF4
was required for this negative regulation.
REFERENCE 3 (bases 1 to 2902)
AUTHORS Marinis,J.M., Homer,C.R., McDonald,C. and Abbott,D.W.
TITLE A novel motif in the Crohn's disease susceptibility protein, NOD2,
allows TRAF4 to down-regulate innate immune responses
JOURNAL J. Biol. Chem. 286 (3), 1938-1950 (2011)
PUBMED 21097508
REMARK GeneRIF: A novel motif in the Crohn's disease susceptibility
protein, NOD2, allows TRAF4 to down-regulate innate immune
responses.
REFERENCE 4 (bases 1 to 2902)
AUTHORS Arthur,J.F., Shen,Y., Gardiner,E.E., Coleman,L., Murphy,D.,
Kenny,D., Andrews,R.K. and Berndt,M.C.
TITLE TNF receptor-associated factor 4 (TRAF4) is a novel binding partner
of glycoprotein Ib and glycoprotein VI in human platelets
JOURNAL J. Thromb. Haemost. 9 (1), 163-172 (2011)
PUBMED 20946164
REMARK GeneRIF: Identify TRAF4 as a novel binding partner for GPIb-IX-V
and GPVI in human platelets.
Erratum:[J Thromb Haemost. 2011 Dec;9(12):2523. Murphy, D [added]]
REFERENCE 5 (bases 1 to 2902)
AUTHORS Davila,S., Froeling,F.E., Tan,A., Bonnard,C., Boland,G.J.,
Snippe,H., Hibberd,M.L. and Seielstad,M.
TITLE New genetic associations detected in a host response study to
hepatitis B vaccine
JOURNAL Genes Immun. 11 (3), 232-238 (2010)
PUBMED 20237496
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
REFERENCE 6 (bases 1 to 2902)
AUTHORS Ye,X., Mehlen,P., Rabizadeh,S., VanArsdale,T., Zhang,H., Shin,H.,
Wang,J.J., Leo,E., Zapata,J., Hauser,C.A., Reed,J.C. and
Bredesen,D.E.
TITLE TRAF family proteins interact with the common neurotrophin receptor
and modulate apoptosis induction
JOURNAL J. Biol. Chem. 274 (42), 30202-30208 (1999)
PUBMED 10514511
REFERENCE 7 (bases 1 to 2902)
AUTHORS Krajewska,M., Krajewski,S., Zapata,J.M., Van Arsdale,T.,
Gascoyne,R.D., Berern,K., McFadden,D., Shabaik,A., Hugh,J.,
Reynolds,A., Clevenger,C.V. and Reed,J.C.
TITLE TRAF-4 expression in epithelial progenitor cells. Analysis in
normal adult, fetal, and tumor tissues
JOURNAL Am. J. Pathol. 152 (6), 1549-1561 (1998)
PUBMED 9626059
REFERENCE 8 (bases 1 to 2902)
AUTHORS Masson,R., Regnier,C.H., Chenard,M.P., Wendling,C., Mattei,M.G.,
Tomasetto,C. and Rio,M.C.
TITLE Tumor necrosis factor receptor associated factor 4 (TRAF4)
expression pattern during mouse development
JOURNAL Mech. Dev. 71 (1-2), 187-191 (1998)
PUBMED 9507120
REFERENCE 9 (bases 1 to 2902)
AUTHORS Regnier,C.H., Tomasetto,C., Moog-Lutz,C., Chenard,M.P.,
Wendling,C., Basset,P. and Rio,M.C.
TITLE Presence of a new conserved domain in CART1, a novel member of the
tumor necrosis factor receptor-associated protein family, which is
expressed in breast carcinoma
JOURNAL J. Biol. Chem. 270 (43), 25715-25721 (1995)
PUBMED 7592751
REFERENCE 10 (bases 1 to 2902)
AUTHORS Tomasetto,C., Regnier,C., Moog-Lutz,C., Mattei,M.G., Chenard,M.P.,
Lidereau,R., Basset,P. and Rio,M.C.
TITLE Identification of four novel human genes amplified and
overexpressed in breast carcinoma and localized to the q11-q21.3
region of chromosome 17
JOURNAL Genomics 28 (3), 367-376 (1995)
PUBMED 7490069
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from CR990949.1, BC001769.1 and
AC010761.10.
On Nov 24, 2006 this sequence version replaced gi:22027621.
Summary: This gene encodes a member of the TNF receptor associated
factor (TRAF) family. TRAF proteins are associated with, and
mediate signal transduction from members of the TNF receptor
superfamily. The encoded protein has been shown to interact with
neurotrophin receptor, p75 (NTR/NTSR1), and negatively regulate NTR
induced cell death and NF-kappa B activation. This protein has been
found to bind to p47phox, a cytosolic regulatory factor included in
a multi-protein complex known as NAD(P)H oxidase. This protein
thus, is thought to be involved in the oxidative activation of
MAPK8/JNK. Alternatively spliced transcript variants have been
observed but the full-length nature of only one has been
determined. [provided by RefSeq, Jul 2008].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BC001769.1, X80200.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025082, ERS025084 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-16 CR990949.1 22-37
17-2024 BC001769.1 1-2008
2025-2902 AC010761.10 102233-103110
FEATURES Location/Qualifiers
source 1..2902
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="17"
/map="17q11-q12"
gene 1..2902
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/note="TNF receptor-associated factor 4"
/db_xref="GeneID:9618"
/db_xref="HGNC:12034"
/db_xref="HPRD:03915"
/db_xref="MIM:602464"
exon 1..251
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/inference="alignment:Splign:1.39.8"
variation 87
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:35592573"
variation 107
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:35739193"
CDS 109..1521
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/note="tumor necrosis receptor-associated factor 4A;
malignant 62; cysteine-rich domain associated with ring
and TRAF domain; MLN 62; RING finger protein 83;
metastatic lymph node gene 62 protein; cysteine-rich
domain associated with RING and Traf domains protein 1"
/codon_start=1
/product="TNF receptor-associated factor 4"
/protein_id="NP_004286.2"
/db_xref="GI:22027622"
/db_xref="CCDS:CCDS11243.1"
/db_xref="GeneID:9618"
/db_xref="HGNC:12034"
/db_xref="HPRD:03915"
/db_xref="MIM:602464"
/translation="
MPGFDYKFLEKPKRRLLCPLCGKPMREPVQVSTCGHRFCDTCLQEFLSEGVFKCPEDQLPLDYAKIYPDPELEVQVLGLPIRCIHSEEGCRWSGPLRHLQGHLNTCSFNVIPCPNRCPMKLSRRDLPAHLQHDCPKRRLKCEFCGCDFSGEAYESHEGMCPQESVYCENKCGARMMRRLLAQHATSECPKRTQPCTYCTKEFVFDTIQSHQYQCPRLPVACPNQCGVGTVAREDLPGHLKDSCNTALVLCPFKDSGCKHRCPKLAMARHVEESVKPHLAMMCALVSRQRQELQELRRELEELSVGSDGVLIWKIGSYGRRLQEAKAKPNLECFSPAFYTHKYGYKLQVSAFLNGNGSGEGTHLSLYIRVLPGAFDNLLEWPFARRVTFSLLDQSDPGLAKPQHVTETFHPDPNWKNFQKPGTWRGSLDESSLGFGYPKFISHQDIRKRNYVRDDAVFIRAAVELPRKILS
"
misc_feature 160..273
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/note="RING-finger (Really Interesting New Gene) domain, a
specialized type of Zn-finger of 40 to 60 residues that
binds two atoms of zinc; defined by the 'cross-brace'
motif C-X2-C-X(9-39)-C-X(1-3)-
H-X(2-3)-(N/C/H)-X2-C-X(4-48)C-X2-C; probably involved
in...; Region: RING; cd00162"
/db_xref="CDD:29102"
misc_feature order(160..162,169..171,208..210,214..216,223..225,
232..234,268..270)
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/note="cross-brace motif; other site"
/db_xref="CDD:29102"
misc_feature 412..576
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/note="TRAF-type zinc finger; Region: zf-TRAF; pfam02176"
/db_xref="CDD:190233"
misc_feature 574..738
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/note="TRAF-type zinc finger; Region: zf-TRAF; pfam02176"
/db_xref="CDD:190233"
misc_feature 736..915
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/note="TRAF-type zinc finger; Region: zf-TRAF; pfam02176"
/db_xref="CDD:190233"
misc_feature 1030..1497
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/note="Tumor Necrosis Factor Receptor (TNFR)-Associated
Factor (TRAF) family, TRAF4 subfamily, TRAF domain,
C-terminal MATH subdomain; composed of proteins with
similarity to human TRAF4, including the Drosophila
protein DTRAF1. TRAF molecules serve as adapter...;
Region: MATH_TRAF4; cd03781"
/db_xref="CDD:58112"
misc_feature order(1039..1041,1045..1047,1129..1134,1225..1227,
1234..1236,1285..1287)
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/note="trimer interface [polypeptide binding]; other site"
/db_xref="CDD:58112"
misc_feature order(1153..1155,1159..1161,1204..1206,1333..1335,
1402..1413)
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/note="TNFR binding site; other site"
/db_xref="CDD:58112"
misc_feature 1384..1386
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9BUZ4.1); phosphorylation site"
variation 159
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:183753634"
variation 168
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:199796853"
exon 252..303
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/inference="alignment:Splign:1.39.8"
variation 267
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:140160816"
variation 273
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:369370618"
exon 304..408
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/inference="alignment:Splign:1.39.8"
variation 315
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:201471848"
variation 317
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:150297549"
variation 365
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:200933035"
variation 379
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:375510394"
variation 402
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:112813368"
exon 409..570
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/inference="alignment:Splign:1.39.8"
variation 455
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:112254662"
variation 476
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:372483090"
variation 502
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:376103008"
variation 549
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:200681592"
exon 571..732
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/inference="alignment:Splign:1.39.8"
variation 588
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:137860332"
variation 625
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:35932778"
variation 639
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:375013541"
variation 640
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1044066"
variation 641
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:145159053"
variation 643
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="g"
/db_xref="dbSNP:78085629"
variation 675
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:373259531"
variation 714
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:2070265"
exon 733..888
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/inference="alignment:Splign:1.39.8"
variation 800
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:142126345"
variation 833
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:200896572"
variation 843
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:377015203"
variation 848
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:370410197"
variation 852
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="g"
/replace="t"
/db_xref="dbSNP:144767741"
variation 853
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:377604096"
exon 889..2902
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/inference="alignment:Splign:1.39.8"
variation 902
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:141868310"
variation 911
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:371551731"
variation 934
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:374710555"
variation 973
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:367635342"
variation 974
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:200330319"
variation 984
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="g"
/replace="t"
/db_xref="dbSNP:371469401"
variation 998
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:202170589"
variation 1032
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:201421207"
variation 1063
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:368789267"
variation 1068
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:150617731"
variation 1167
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:373425358"
variation 1172
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:377490762"
STS 1195..2058
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/standard_name="TRAF4_282.2"
/db_xref="UniSTS:277843"
variation 1197
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="g"
/db_xref="dbSNP:201134433"
variation 1234
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="c"
/db_xref="dbSNP:370726398"
variation 1258
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:373050140"
variation 1259
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:145321614"
variation 1278
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="g"
/replace="t"
/db_xref="dbSNP:141662072"
variation 1335
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:147636334"
variation 1338
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:140544266"
variation 1362
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="g"
/db_xref="dbSNP:35100992"
variation 1368
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:370893083"
variation 1371
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:375520998"
variation 1378
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:201034539"
variation 1379
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:144429633"
variation 1387
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:3744640"
variation 1452
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="c"
/db_xref="dbSNP:202028805"
variation 1503
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="g"
/db_xref="dbSNP:370031471"
variation 1536
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:367932681"
variation 1537
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:371664470"
variation 1550
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:35760160"
variation 1663..1664
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace=""
/replace="c"
/db_xref="dbSNP:144389970"
variation 1707
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:8198"
STS 1875..2004
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/standard_name="RH16881"
/db_xref="UniSTS:81389"
variation 1921
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:34730851"
polyA_signal 1999..2004
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
variation 2008
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:35475536"
polyA_site 2024
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
variation 2044
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:34916824"
variation 2083..2084
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace=""
/replace="t"
/db_xref="dbSNP:35155991"
variation 2103
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="g"
/replace="t"
/db_xref="dbSNP:182245314"
variation 2219
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="g"
/db_xref="dbSNP:139461795"
variation 2257
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:3181215"
variation 2270
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:149442005"
variation 2289
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:188200557"
variation 2315
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:192759741"
variation 2323
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:183656671"
variation 2354
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:188532199"
variation 2362
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:376797856"
variation 2371
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:192196572"
variation 2433
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="t"
/db_xref="dbSNP:184735335"
variation 2464
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:189551906"
variation 2476
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:147532320"
variation 2498
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:191302208"
variation 2562
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:184499563"
variation 2613
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace=""
/replace="a"
/db_xref="dbSNP:3214580"
variation 2613
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="t"
/db_xref="dbSNP:200532695"
variation 2629
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:117451491"
variation 2636
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="g"
/db_xref="dbSNP:75044810"
variation 2697
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="g"
/db_xref="dbSNP:78297051"
variation 2698
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="a"
/replace="g"
/db_xref="dbSNP:11555009"
variation 2812
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
/replace="c"
/replace="t"
/db_xref="dbSNP:1047167"
polyA_signal 2881..2886
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
polyA_site 2902
/gene="TRAF4"
/gene_synonym="CART1; MLN62; RNF83"
ORIGIN
accgccagtcggcgccgcccggagccgggagcgccgctccagcgaggcgcgggctgtggggccgccgcgtgcctggccccgctcgcccgtgccggccgctcgcccgccatgcctggcttcgactacaagttcctggagaagcccaagcgacggctgctgtgcccactgtgcgggaagcccatgcgcgagcctgtgcaggtttccacctgcggccaccgtttctgcgatacctgcctgcaggagttcctcagtgaaggagtcttcaagtgccctgaggaccagcttcctctggactatgccaagatctacccagacccggagctggaagtacaagtattgggcctgcctatccgctgcatccacagtgaggagggctgccgctggagtgggccactacgtcatctacagggccacctgaatacctgcagcttcaatgtcattccctgccctaatcgctgccccatgaagctgagccgccgtgatctacctgcacacttgcagcatgactgccccaagcggcgcctcaagtgcgagttttgtggctgtgacttcagtggggaggcctatgagagccatgagggtatgtgcccccaggagagtgtctactgtgagaataagtgtggtgcccgcatgatgcggcggctgctggcccagcatgccacctctgagtgccccaagcgcactcagccctgcacctactgcactaaggagttcgtctttgacaccatccagagccaccagtaccagtgcccaaggctgcctgttgcctgccccaaccaatgtggtgtgggcactgtggctcgggaggacctgccaggccatctgaaggacagctgtaacaccgccctggtgctctgcccattcaaagactccggctgcaagcacaggtgccctaagctggcaatggcacggcatgtggaggagagtgtgaagccacatctggccatgatgtgtgccctggtgagccggcaacggcaggagctgcaggagcttcggcgagagctggaggagctatcagtgggcagtgatggcgtgctcatctggaagattggcagctatggacggcggctacaggaggccaaggccaagcccaaccttgagtgcttcagcccagccttctacacacataagtatggttacaagctgcaggtgtctgcattcctcaatggcaatggcagtggtgagggcacacacctctcactgtacattcgtgtgctgcctggtgcctttgacaatctccttgagtggccctttgcccgccgtgtcaccttctccctgctggatcagagcgaccctgggctggctaaaccacagcacgtcactgagaccttccaccccgacccaaactggaagaatttccagaagccaggcacgtggcggggctccctggatgagagttctctgggctttggttatcccaagttcatctcccaccaggacattcgaaagcgaaactatgtgcgggatgatgcagtcttcatccgtgctgctgttgaactgccccggaagatcctcagctgagtgcaggtggggttcgaggggaaaggacgatggggcatgacctcagtcaggcactggctgaacttggagagggggccggacccccgtcagctgcttctgctgcctaggttctgttaccccatcctccctcccccagccaccaccctcaggtgcctccaattggtgcttcagccctggcccctgtggggaacaggtcttggggtcatgaagggctggaaacaagtgaccccagggcctgtctcccttcttgggtagggcagacatgccttggtgccggtcacactctacacggactgaggtgcctgctcaggtgctatgtcccaagagccataagggggtgggaattggggagggagaaagggtagttcaaagagtctgtcttgagatctgattttttccccctttacctagctgtgccccctctggttatttatttccttagtgccaggagggcacagcaggggagccctgatttttaataaatccggaattgtatttattaatttgcttccagcctgacttacctgggttggttaggtccctgggaggctcaaccaaactgaaggcaaagaaaggaccagtcagagaagggccgctgcctgggtctggccccaggatccagcttacctgctggctcgccctctgatggacgccgggaaaactgcatcgggctttgtgtggaagacggtccctgccactgccctctgccgatgaaatgcgggaagtgtatggcctagatgtttcataaggctggagtccctggtcagccccaccagattagtgcttctaccctaggcagggctttcttggtctaatggtaataagcaccgacactgctaagcactttacgtgcattattatttcattgaaaagaactgtcaagtgaaatactttttagcacagtaactggctttgtgggctctagagaagagttaatgaggcagtgcatgttcttggcccagagtaagtgcttagtgaatgctttctaactccgaaccccagccacatccagggactgggtgttgagcaaaaggggccttcaagatgttcaaggcacttggattttctcctgtctctcatcggcttttcttaacgggcctcagtgggtgcatgtgattatccacgtttcacctatgaaacatgaacagaggagactgacttatcagtgattcttccgcgggttcggacagggcctcgattctgttttaaactccagtagtccctagaaattgtagctccctctagttgtggcaataggtgtgggtccttgtgcttgcttttggcaagtttctgagctacacagggcctccattaccgtcactggtgaaatgcggctcacctcccagatttgttgtaaagattaaatgaactggtcagcaca
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:9618 -> Molecular function: GO:0003677 [DNA binding] evidence: TAS
GeneID:9618 -> Molecular function: GO:0004842 [ubiquitin-protein ligase activity] evidence: IEA
GeneID:9618 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:9618 -> Molecular function: GO:0008270 [zinc ion binding] evidence: IEA
GeneID:9618 -> Molecular function: GO:0019901 [protein kinase binding] evidence: IEA
GeneID:9618 -> Molecular function: GO:0031625 [ubiquitin protein ligase binding] evidence: IPI
GeneID:9618 -> Molecular function: GO:0031996 [thioesterase binding] evidence: IPI
GeneID:9618 -> Molecular function: GO:0050699 [WW domain binding] evidence: IPI
GeneID:9618 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA
GeneID:9618 -> Biological process: GO:0007165 [signal transduction] evidence: TAS
GeneID:9618 -> Biological process: GO:0007250 [activation of NF-kappaB-inducing kinase activity] evidence: IEA
GeneID:9618 -> Biological process: GO:0007585 [respiratory gaseous exchange] evidence: IEA
GeneID:9618 -> Biological process: GO:0030323 [respiratory tube development] evidence: IEA
GeneID:9618 -> Biological process: GO:0042981 [regulation of apoptotic process] evidence: IEA
GeneID:9618 -> Biological process: GO:0045860 [positive regulation of protein kinase activity] evidence: IDA
GeneID:9618 -> Biological process: GO:0046330 [positive regulation of JNK cascade] evidence: IDA
GeneID:9618 -> Biological process: GO:0090073 [positive regulation of protein homodimerization activity] evidence: IDA
GeneID:9618 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:9618 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:9618 -> Cellular component: GO:0005856 [cytoskeleton] evidence: IEA
GeneID:9618 -> Cellular component: GO:0005886 [plasma membrane] evidence: IEA
GeneID:9618 -> Cellular component: GO:0005923 [tight junction] evidence: IEA
GeneID:9618 -> Cellular component: GO:0048471 [perinuclear region of cytoplasm] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.