GGRNA Home | Help | Advanced search

2019-03-25 14:39:49, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_004133               4101 bp    mRNA    linear   PRI 07-JUL-2013
DEFINITION  Homo sapiens hepatocyte nuclear factor 4, gamma (HNF4G), mRNA.
ACCESSION   NM_004133
VERSION     NM_004133.4  GI:115583653
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 4101)
  AUTHORS   Berndt,S.I., Gustafsson,S., Magi,R., Ganna,A., Wheeler,E.,
            Feitosa,M.F., Justice,A.E., Monda,K.L., Croteau-Chonka,D.C.,
            Day,F.R., Esko,T., Fall,T., Ferreira,T., Gentilini,D.,
            Jackson,A.U., Luan,J., Randall,J.C., Vedantam,S., Willer,C.J.,
            Winkler,T.W., Wood,A.R., Workalemahu,T., Hu,Y.J., Lee,S.H.,
            Liang,L., Lin,D.Y., Min,J.L., Neale,B.M., Thorleifsson,G., Yang,J.,
            Albrecht,E., Amin,N., Bragg-Gresham,J.L., Cadby,G., den Heijer,M.,
            Eklund,N., Fischer,K., Goel,A., Hottenga,J.J., Huffman,J.E.,
            Jarick,I., Johansson,A., Johnson,T., Kanoni,S., Kleber,M.E.,
            Konig,I.R., Kristiansson,K., Kutalik,Z., Lamina,C., Lecoeur,C.,
            Li,G., Mangino,M., McArdle,W.L., Medina-Gomez,C.,
            Muller-Nurasyid,M., Ngwa,J.S., Nolte,I.M., Paternoster,L.,
            Pechlivanis,S., Perola,M., Peters,M.J., Preuss,M., Rose,L.M.,
            Shi,J., Shungin,D., Smith,A.V., Strawbridge,R.J., Surakka,I.,
            Teumer,A., Trip,M.D., Tyrer,J., Van Vliet-Ostaptchouk,J.V.,
            Vandenput,L., Waite,L.L., Zhao,J.H., Absher,D., Asselbergs,F.W.,
            Atalay,M., Attwood,A.P., Balmforth,A.J., Basart,H., Beilby,J.,
            Bonnycastle,L.L., Brambilla,P., Bruinenberg,M., Campbell,H.,
            Chasman,D.I., Chines,P.S., Collins,F.S., Connell,J.M.,
            Cookson,W.O., de Faire,U., de Vegt,F., Dei,M., Dimitriou,M.,
            Edkins,S., Estrada,K., Evans,D.M., Farrall,M., Ferrario,M.M.,
            Ferrieres,J., Franke,L., Frau,F., Gejman,P.V., Grallert,H.,
            Gronberg,H., Gudnason,V., Hall,A.S., Hall,P., Hartikainen,A.L.,
            Hayward,C., Heard-Costa,N.L., Heath,A.C., Hebebrand,J., Homuth,G.,
            Hu,F.B., Hunt,S.E., Hypponen,E., Iribarren,C., Jacobs,K.B.,
            Jansson,J.O., Jula,A., Kahonen,M., Kathiresan,S., Kee,F.,
            Khaw,K.T., Kivimaki,M., Koenig,W., Kraja,A.T., Kumari,M.,
            Kuulasmaa,K., Kuusisto,J., Laitinen,J.H., Lakka,T.A.,
            Langenberg,C., Launer,L.J., Lind,L., Lindstrom,J., Liu,J.,
            Liuzzi,A., Lokki,M.L., Lorentzon,M., Madden,P.A., Magnusson,P.K.,
            Manunta,P., Marek,D., Marz,W., Mateo Leach,I., McKnight,B.,
            Medland,S.E., Mihailov,E., Milani,L., Montgomery,G.W., Mooser,V.,
            Muhleisen,T.W., Munroe,P.B., Musk,A.W., Narisu,N., Navis,G.,
            Nicholson,G., Nohr,E.A., Ong,K.K., Oostra,B.A., Palmer,C.N.,
            Palotie,A., Peden,J.F., Pedersen,N., Peters,A., Polasek,O.,
            Pouta,A., Pramstaller,P.P., Prokopenko,I., Putter,C.,
            Radhakrishnan,A., Raitakari,O., Rendon,A., Rivadeneira,F.,
            Rudan,I., Saaristo,T.E., Sambrook,J.G., Sanders,A.R., Sanna,S.,
            Saramies,J., Schipf,S., Schreiber,S., Schunkert,H., Shin,S.Y.,
            Signorini,S., Sinisalo,J., Skrobek,B., Soranzo,N., Stancakova,A.,
            Stark,K., Stephens,J.C., Stirrups,K., Stolk,R.P., Stumvoll,M.,
            Swift,A.J., Theodoraki,E.V., Thorand,B., Tregouet,D.A., Tremoli,E.,
            Van der Klauw,M.M., van Meurs,J.B., Vermeulen,S.H., Viikari,J.,
            Virtamo,J., Vitart,V., Waeber,G., Wang,Z., Widen,E., Wild,S.H.,
            Willemsen,G., Winkelmann,B.R., Witteman,J.C., Wolffenbuttel,B.H.,
            Wong,A., Wright,A.F., Zillikens,M.C., Amouyel,P., Boehm,B.O.,
            Boerwinkle,E., Boomsma,D.I., Caulfield,M.J., Chanock,S.J.,
            Cupples,L.A., Cusi,D., Dedoussis,G.V., Erdmann,J., Eriksson,J.G.,
            Franks,P.W., Froguel,P., Gieger,C., Gyllensten,U., Hamsten,A.,
            Harris,T.B., Hengstenberg,C., Hicks,A.A., Hingorani,A., Hinney,A.,
            Hofman,A., Hovingh,K.G., Hveem,K., Illig,T., Jarvelin,M.R.,
            Jockel,K.H., Keinanen-Kiukaanniemi,S.M., Kiemeney,L.A., Kuh,D.,
            Laakso,M., Lehtimaki,T., Levinson,D.F., Martin,N.G., Metspalu,A.,
            Morris,A.D., Nieminen,M.S., Njolstad,I., Ohlsson,C.,
            Oldehinkel,A.J., Ouwehand,W.H., Palmer,L.J., Penninx,B., Power,C.,
            Province,M.A., Psaty,B.M., Qi,L., Rauramaa,R., Ridker,P.M.,
            Ripatti,S., Salomaa,V., Samani,N.J., Snieder,H., Sorensen,T.I.,
            Spector,T.D., Stefansson,K., Tonjes,A., Tuomilehto,J.,
            Uitterlinden,A.G., Uusitupa,M., van der Harst,P., Vollenweider,P.,
            Wallaschofski,H., Wareham,N.J., Watkins,H., Wichmann,H.E.,
            Wilson,J.F., Abecasis,G.R., Assimes,T.L., Barroso,I., Boehnke,M.,
            Borecki,I.B., Deloukas,P., Fox,C.S., Frayling,T., Groop,L.C.,
            Haritunian,T., Heid,I.M., Hunter,D., Kaplan,R.C., Karpe,F.,
            Moffatt,M.F., Mohlke,K.L., O'Connell,J.R., Pawitan,Y., Schadt,E.E.,
            Schlessinger,D., Steinthorsdottir,V., Strachan,D.P.,
            Thorsteinsdottir,U., van Duijn,C.M., Visscher,P.M., Di Blasio,A.M.,
            Hirschhorn,J.N., Lindgren,C.M., Morris,A.P., Meyre,D., Scherag,A.,
            McCarthy,M.I., Speliotes,E.K., North,K.E., Loos,R.J. and
            Ingelsson,E.
  TITLE     Genome-wide meta-analysis identifies 11 new loci for anthropometric
            traits and provides insights into genetic architecture
  JOURNAL   Nat. Genet. 45 (5), 501-512 (2013)
   PUBMED   23563607
  REMARK    GeneRIF: Single nucleotide polymorphisms in HNF4G gene is
            associated with obesity.
REFERENCE   2  (bases 1 to 4101)
  AUTHORS   Kottgen A, Albrecht E, Teumer A, Vitart V, Krumsiek J, Hundertmark
            C, Pistis G, Ruggiero D, O'Seaghdha CM, Haller T, Yang Q, Tanaka T,
            Johnson AD, Kutalik Z, Smith AV, Shi J, Struchalin M, Middelberg
            RP, Brown MJ, Gaffo AL, Pirastu N, Li G, Hayward C, Zemunik T,
            Huffman J, Yengo L, Zhao JH, Demirkan A, Feitosa MF, Liu X, Malerba
            G, Lopez LM, van der Harst P, Li X, Kleber ME, Hicks AA, Nolte IM,
            Johansson A, Murgia F, Wild SH, Bakker SJ, Peden JF, Dehghan A,
            Steri M, Tenesa A, Lagou V, Salo P, Mangino M, Rose LM, Lehtimaki
            T, Woodward OM, Okada Y, Tin A, Muller C, Oldmeadow C, Putku M,
            Czamara D, Kraft P, Frogheri L, Thun GA, Grotevendt A, Gislason GK,
            Harris TB, Launer LJ, McArdle P, Shuldiner AR, Boerwinkle E, Coresh
            J, Schmidt H, Schallert M, Martin NG, Montgomery GW, Kubo M,
            Nakamura Y, Tanaka T, Munroe PB, Samani NJ, Jacobs DR Jr, Liu K,
            D'Adamo P, Ulivi S, Rotter JI, Psaty BM, Vollenweider P, Waeber G,
            Campbell S, Devuyst O, Navarro P, Kolcic I, Hastie N, Balkau B,
            Froguel P, Esko T, Salumets A, Khaw KT, Langenberg C, Wareham NJ,
            Isaacs A, Kraja A, Zhang Q, Wild PS, Scott RJ, Holliday EG, Org E,
            Viigimaa M, Bandinelli S, Metter JE, Lupo A, Trabetti E, Sorice R,
            Doring A, Lattka E, Strauch K, Theis F, Waldenberger M, Wichmann
            HE, Davies G, Gow AJ, Bruinenberg M, Stolk RP, Kooner JS, Zhang W,
            Winkelmann BR, Boehm BO, Lucae S, Penninx BW, Smit JH, Curhan G,
            Mudgal P, Plenge RM, Portas L, Persico I, Kirin M, Wilson JF, Mateo
            Leach I, van Gilst WH, Goel A, Ongen H, Hofman A, Rivadeneira F,
            Uitterlinden AG, Imboden M, von Eckardstein A, Cucca F, Nagaraja R,
            Piras MG, Nauck M, Schurmann C, Budde K, Ernst F, Farrington SM,
            Theodoratou E, Prokopenko I, Stumvoll M, Jula A, Perola M, Salomaa
            V, Shin SY, Spector TD, Sala C, Ridker PM, Kahonen M, Viikari J,
            Hengstenberg C, Nelson CP, Meschia JF, Nalls MA, Sharma P,
            Singleton AB, Kamatani N, Zeller T, Burnier M, Attia J, Laan M,
            Klopp N, Hillege HL, Kloiber S, Choi H, Pirastu M, Tore S,
            Probst-Hensch NM, Volzke H, Gudnason V, Parsa A, Schmidt R,
            Whitfield JB, Fornage M, Gasparini P, Siscovick DS, Polasek O,
            Campbell H, Rudan I, Bouatia-Naji N, Metspalu A, Loos RJ, van Duijn
            CM, Borecki IB, Ferrucci L, Gambaro G, Deary IJ, Wolffenbuttel BH,
            Chambers JC, Marz W, Pramstaller PP, Snieder H, Gyllensten U,
            Wright AF, Navis G, Watkins H, Witteman JC, Sanna S, Schipf S,
            Dunlop MG, Tonjes A, Ripatti S, Soranzo N, Toniolo D, Chasman DI,
            Raitakari O, Kao WH, Ciullo M, Fox CS, Caulfield M, Bochud M and
            Gieger C.
  CONSRTM   LifeLines Cohort Study; CARDIoGRAM Consortium; DIAGRAM Consortium;
            ICBP Consortium; MAGIC Consortium
  TITLE     Genome-wide association analyses identify 18 new loci associated
            with serum urate concentrations
  JOURNAL   Nat. Genet. 45 (2), 145-154 (2013)
   PUBMED   23263486
REFERENCE   3  (bases 1 to 4101)
  AUTHORS   Daigo,K., Kawamura,T., Ohta,Y., Ohashi,R., Katayose,S., Tanaka,T.,
            Aburatani,H., Naito,M., Kodama,T., Ihara,S. and Hamakubo,T.
  TITLE     Proteomic analysis of native hepatocyte nuclear factor-4alpha
            (HNF4alpha) isoforms, phosphorylation status, and interactive
            cofactors
  JOURNAL   J. Biol. Chem. 286 (1), 674-686 (2011)
   PUBMED   21047794
  REMARK    GeneRIF: Heterodimerization of HNF4alpha and HNF4gamma was found
REFERENCE   4  (bases 1 to 4101)
  AUTHORS   Speliotes EK, Willer CJ, Berndt SI, Monda KL, Thorleifsson G,
            Jackson AU, Lango Allen H, Lindgren CM, Luan J, Magi R, Randall JC,
            Vedantam S, Winkler TW, Qi L, Workalemahu T, Heid IM,
            Steinthorsdottir V, Stringham HM, Weedon MN, Wheeler E, Wood AR,
            Ferreira T, Weyant RJ, Segre AV, Estrada K, Liang L, Nemesh J, Park
            JH, Gustafsson S, Kilpelainen TO, Yang J, Bouatia-Naji N, Esko T,
            Feitosa MF, Kutalik Z, Mangino M, Raychaudhuri S, Scherag A, Smith
            AV, Welch R, Zhao JH, Aben KK, Absher DM, Amin N, Dixon AL, Fisher
            E, Glazer NL, Goddard ME, Heard-Costa NL, Hoesel V, Hottenga JJ,
            Johansson A, Johnson T, Ketkar S, Lamina C, Li S, Moffatt MF, Myers
            RH, Narisu N, Perry JR, Peters MJ, Preuss M, Ripatti S, Rivadeneira
            F, Sandholt C, Scott LJ, Timpson NJ, Tyrer JP, van Wingerden S,
            Watanabe RM, White CC, Wiklund F, Barlassina C, Chasman DI, Cooper
            MN, Jansson JO, Lawrence RW, Pellikka N, Prokopenko I, Shi J,
            Thiering E, Alavere H, Alibrandi MT, Almgren P, Arnold AM, Aspelund
            T, Atwood LD, Balkau B, Balmforth AJ, Bennett AJ, Ben-Shlomo Y,
            Bergman RN, Bergmann S, Biebermann H, Blakemore AI, Boes T,
            Bonnycastle LL, Bornstein SR, Brown MJ, Buchanan TA, Busonero F,
            Campbell H, Cappuccio FP, Cavalcanti-Proenca C, Chen YD, Chen CM,
            Chines PS, Clarke R, Coin L, Connell J, Day IN, den Heijer M, Duan
            J, Ebrahim S, Elliott P, Elosua R, Eiriksdottir G, Erdos MR,
            Eriksson JG, Facheris MF, Felix SB, Fischer-Posovszky P, Folsom AR,
            Friedrich N, Freimer NB, Fu M, Gaget S, Gejman PV, Geus EJ, Gieger
            C, Gjesing AP, Goel A, Goyette P, Grallert H, Grassler J,
            Greenawalt DM, Groves CJ, Gudnason V, Guiducci C, Hartikainen AL,
            Hassanali N, Hall AS, Havulinna AS, Hayward C, Heath AC,
            Hengstenberg C, Hicks AA, Hinney A, Hofman A, Homuth G, Hui J, Igl
            W, Iribarren C, Isomaa B, Jacobs KB, Jarick I, Jewell E, John U,
            Jorgensen T, Jousilahti P, Jula A, Kaakinen M, Kajantie E, Kaplan
            LM, Kathiresan S, Kettunen J, Kinnunen L, Knowles JW, Kolcic I,
            Konig IR, Koskinen S, Kovacs P, Kuusisto J, Kraft P, Kvaloy K,
            Laitinen J, Lantieri O, Lanzani C, Launer LJ, Lecoeur C, Lehtimaki
            T, Lettre G, Liu J, Lokki ML, Lorentzon M, Luben RN, Ludwig B,
            Manunta P, Marek D, Marre M, Martin NG, McArdle WL, McCarthy A,
            McKnight B, Meitinger T, Melander O, Meyre D, Midthjell K,
            Montgomery GW, Morken MA, Morris AP, Mulic R, Ngwa JS, Nelis M,
            Neville MJ, Nyholt DR, O'Donnell CJ, O'Rahilly S, Ong KK, Oostra B,
            Pare G, Parker AN, Perola M, Pichler I, Pietilainen KH, Platou CG,
            Polasek O, Pouta A, Rafelt S, Raitakari O, Rayner NW, Ridderstrale
            M, Rief W, Ruokonen A, Robertson NR, Rzehak P, Salomaa V, Sanders
            AR, Sandhu MS, Sanna S, Saramies J, Savolainen MJ, Scherag S,
            Schipf S, Schreiber S, Schunkert H, Silander K, Sinisalo J,
            Siscovick DS, Smit JH, Soranzo N, Sovio U, Stephens J, Surakka I,
            Swift AJ, Tammesoo ML, Tardif JC, Teder-Laving M, Teslovich TM,
            Thompson JR, Thomson B, Tonjes A, Tuomi T, van Meurs JB, van Ommen
            GJ, Vatin V, Viikari J, Visvikis-Siest S, Vitart V, Vogel CI,
            Voight BF, Waite LL, Wallaschofski H, Walters GB, Widen E, Wiegand
            S, Wild SH, Willemsen G, Witte DR, Witteman JC, Xu J, Zhang Q,
            Zgaga L, Ziegler A, Zitting P, Beilby JP, Farooqi IS, Hebebrand J,
            Huikuri HV, James AL, Kahonen M, Levinson DF, Macciardi F, Nieminen
            MS, Ohlsson C, Palmer LJ, Ridker PM, Stumvoll M, Beckmann JS,
            Boeing H, Boerwinkle E, Boomsma DI, Caulfield MJ, Chanock SJ,
            Collins FS, Cupples LA, Smith GD, Erdmann J, Froguel P, Gronberg H,
            Gyllensten U, Hall P, Hansen T, Harris TB, Hattersley AT, Hayes RB,
            Heinrich J, Hu FB, Hveem K, Illig T, Jarvelin MR, Kaprio J, Karpe
            F, Khaw KT, Kiemeney LA, Krude H, Laakso M, Lawlor DA, Metspalu A,
            Munroe PB, Ouwehand WH, Pedersen O, Penninx BW, Peters A,
            Pramstaller PP, Quertermous T, Reinehr T, Rissanen A, Rudan I,
            Samani NJ, Schwarz PE, Shuldiner AR, Spector TD, Tuomilehto J, Uda
            M, Uitterlinden A, Valle TT, Wabitsch M, Waeber G, Wareham NJ,
            Watkins H, Wilson JF, Wright AF, Zillikens MC, Chatterjee N,
            McCarroll SA, Purcell S, Schadt EE, Visscher PM, Assimes TL,
            Borecki IB, Deloukas P, Fox CS, Groop LC, Haritunians T, Hunter DJ,
            Kaplan RC, Mohlke KL, O'Connell JR, Peltonen L, Schlessinger D,
            Strachan DP, van Duijn CM, Wichmann HE, Frayling TM,
            Thorsteinsdottir U, Abecasis GR, Barroso I, Boehnke M, Stefansson
            K, North KE, McCarthy MI, Hirschhorn JN, Ingelsson E and Loos RJ.
  CONSRTM   MAGIC; Procardis Consortium
  TITLE     Association analyses of 249,796 individuals reveal 18 new loci
            associated with body mass index
  JOURNAL   Nat. Genet. 42 (11), 937-948 (2010)
   PUBMED   20935630
REFERENCE   5  (bases 1 to 4101)
  AUTHORS   Franke,A., Hampe,J., Rosenstiel,P., Becker,C., Wagner,F.,
            Hasler,R., Little,R.D., Huse,K., Ruether,A., Balschun,T.,
            Wittig,M., Elsharawy,A., Mayr,G., Albrecht,M., Prescott,N.J.,
            Onnie,C.M., Fournier,H., Keith,T., Radelof,U., Platzer,M.,
            Mathew,C.G., Stoll,M., Krawczak,M., Nurnberg,P. and Schreiber,S.
  TITLE     Systematic association mapping identifies NELL1 as a novel IBD
            disease gene
  JOURNAL   PLoS ONE 2 (8), E691 (2007)
   PUBMED   17684544
  REMARK    GeneRIF: Observational study and genome-wide association study of
            gene-disease association. (HuGE Navigator)
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 4101)
  AUTHORS   Nusbaum,C., Mikkelsen,T.S., Zody,M.C., Asakawa,S., Taudien,S.,
            Garber,M., Kodira,C.D., Schueler,M.G., Shimizu,A., Whittaker,C.A.,
            Chang,J.L., Cuomo,C.A., Dewar,K., FitzGerald,M.G., Yang,X.,
            Allen,N.R., Anderson,S., Asakawa,T., Blechschmidt,K., Bloom,T.,
            Borowsky,M.L., Butler,J., Cook,A., Corum,B., DeArellano,K.,
            DeCaprio,D., Dooley,K.T., Dorris,L. III, Engels,R., Glockner,G.,
            Hafez,N., Hagopian,D.S., Hall,J.L., Ishikawa,S.K., Jaffe,D.B.,
            Kamat,A., Kudoh,J., Lehmann,R., Lokitsang,T., Macdonald,P.,
            Major,J.E., Matthews,C.D., Mauceli,E., Menzel,U., Mihalev,A.H.,
            Minoshima,S., Murayama,Y., Naylor,J.W., Nicol,R., Nguyen,C.,
            O'Leary,S.B., O'Neill,K., Parker,S.C., Polley,A., Raymond,C.K.,
            Reichwald,K., Rodriguez,J., Sasaki,T., Schilhabel,M., Siddiqui,R.,
            Smith,C.L., Sneddon,T.P., Talamas,J.A., Tenzin,P., Topham,K.,
            Venkataraman,V., Wen,G., Yamazaki,S., Young,S.K., Zeng,Q.,
            Zimmer,A.R., Rosenthal,A., Birren,B.W., Platzer,M., Shimizu,N. and
            Lander,E.S.
  TITLE     DNA sequence and analysis of human chromosome 8
  JOURNAL   Nature 439 (7074), 331-335 (2006)
   PUBMED   16421571
REFERENCE   7  (bases 1 to 4101)
  AUTHORS   Ozeki,T., Takahashi,Y., Nakayama,K., Funayama,M., Nagashima,K.,
            Kodama,T. and Kamataki,T.
  TITLE     Hepatocyte nuclear factor-4 alpha/gamma and hepatocyte nuclear
            factor-1 alpha as causal factors of interindividual difference in
            the expression of human dihydrodiol dehydrogenase 4 mRNA in human
            livers
  JOURNAL   Pharmacogenetics 13 (1), 49-53 (2003)
   PUBMED   12544512
  REMARK    GeneRIF: results suggest that the expression level of dihydrodiol
            dehydrogenase 4 mRNA is cooperatively regulated by the amounts of
            HNF-1 alpha, HNF-4 alpha and HNF-4 gamma
REFERENCE   8  (bases 1 to 4101)
  AUTHORS   Wisely,G.B., Miller,A.B., Davis,R.G., Thornquest,A.D. Jr.,
            Johnson,R., Spitzer,T., Sefler,A., Shearer,B., Moore,J.T.,
            Miller,A.B., Willson,T.M. and Williams,S.P.
  TITLE     Hepatocyte nuclear factor 4 is a transcription factor that
            constitutively binds fatty acids
  JOURNAL   Structure 10 (9), 1225-1234 (2002)
   PUBMED   12220494
  REMARK    GeneRIF: 2.7 A X-ray crystalography results suggest that the HNF4s
            may be transcription factors that are constitutively bound to fatty
            acids
REFERENCE   9  (bases 1 to 4101)
  AUTHORS   Plengvidhya,N., Antonellis,A., Wogan,L.T., Poleev,A.,
            Borgschulze,M., Warram,J.H., Ryffel,G.U., Krolewski,A.S. and
            Doria,A.
  TITLE     Hepatocyte nuclear factor-4gamma: cDNA sequence, gene organization,
            and mutation screening in early-onset autosomal-dominant type 2
            diabetes
  JOURNAL   Diabetes 48 (10), 2099-2102 (1999)
   PUBMED   10512380
REFERENCE   10 (bases 1 to 4101)
  AUTHORS   Drewes,T., Senkel,S., Holewa,B. and Ryffel,G.U.
  TITLE     Human hepatocyte nuclear factor 4 isoforms are encoded by distinct
            and differentially expressed genes
  JOURNAL   Mol. Cell. Biol. 16 (3), 925-931 (1996)
   PUBMED   8622695
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            BX571750.1 and AC040917.6.
            On Oct 6, 2006 this sequence version replaced gi:40254474.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BX571750.1, HQ692842.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025082, ERS025084 [ECO:0000350]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-2570              BX571750.1         1-2570
            2571-4101           AC040917.6         59518-61048
FEATURES             Location/Qualifiers
     source          1..4101
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="8"
                     /map="8q21.11"
     gene            1..4101
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /note="hepatocyte nuclear factor 4, gamma"
                     /db_xref="GeneID:3174"
                     /db_xref="HGNC:5026"
                     /db_xref="MIM:605966"
     exon            1..113
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /inference="alignment:Splign:1.39.8"
     variation       16
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372721351"
     CDS             26..1363
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /note="HNF-4-gamma; nuclear receptor subfamily 2 group A
                     member 2"
                     /codon_start=1
                     /product="hepatocyte nuclear factor 4-gamma"
                     /protein_id="NP_004124.4"
                     /db_xref="GI:115583654"
                     /db_xref="CCDS:CCDS6220.2"
                     /db_xref="GeneID:3174"
                     /db_xref="HGNC:5026"
                     /db_xref="MIM:605966"
                     /translation="
MDMANYSEVLDPTYTTLEFETMQILYNSSDSSAPETSMNTTDNGVNCLCAICGDRATGKHYGASSCDGCKGFFRRSIRKSHVYSCRFSRQCVVDKDKRNQCRYCRLRKCFRAGMKKEAVQNERDRISTRRSTFDGSNIPSINTLAQAEVRSRQISVSSPGSSTDINVKKIASIGDVCESMKQQLLVLVEWAKYIPAFCELPLDDQVALLRAHAGEHLLLGATKRSMMYKDILLLGNNYVIHRNSCEVEISRVANRVLDELVRPFQEIQIDDNEYACLKAIVFFDPDAKGLSDPVKIKNMRFQVQIGLEDYINDRQYDSRGRFGELLLLLPTLQSITWQMIEQIQFVKLFGMVKIDNLLQEMLLGGASNDGSHLHHPMHPHLSQDPLTGQTILLGPMSTLVHADQISTPETPLPSPPQGSGQEQYKIAANQASVISHQHLSKQKQL
"
     misc_feature    170..397
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /note="DNA-binding domain of heptocyte nuclear factor 4
                     (HNF4) is composed of two C4-type zinc fingers; Region:
                     NR_DBD_HNF4A; cd06960"
                     /db_xref="CDD:143518"
     misc_feature    order(170..172,179..181,221..223,230..232,278..280,
                     296..298,326..328,335..337)
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /note="zinc binding site [ion binding]; other site"
                     /db_xref="CDD:143518"
     misc_feature    order(188..190,200..208,224..229,233..235,239..241,
                     245..250,257..259,317..322,329..331,338..340,377..385,
                     389..391)
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:143518"
     misc_feature    order(281..283,320..325,329..331)
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /note="homodimer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:143518"
     misc_feature    443..1108
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /note="The ligand binding domain of heptocyte nuclear
                     factor 4, which is explosively expanded in nematodes;
                     Region: NR_LBD_HNF4_like; cd06931"
                     /db_xref="CDD:132729"
     misc_feature    order(542..544,560..562,572..574,674..676,686..688,
                     695..697,725..730,779..781,1049..1054,1061..1063)
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /note="ligand binding site [chemical binding]; other site"
                     /db_xref="CDD:132729"
     misc_feature    order(587..589,599..601,629..634,638..643,650..655,
                     1091..1096,1103..1108)
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /note="coactivator recognition site [polypeptide binding];
                     other site"
                     /db_xref="CDD:132729"
     misc_feature    order(800..802,863..865,881..883,923..928,935..940,
                     947..952,980..985,989..997,1001..1006,1010..1018,
                     1022..1027,1034..1036)
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:132729"
     variation       29
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374803306"
     variation       32
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369058537"
     variation       43
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200724292"
     variation       58
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:377418053"
     variation       62
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369885281"
     STS             107..1456
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /db_xref="UniSTS:485816"
     variation       111
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2943549"
     exon            114..282
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /inference="alignment:Splign:1.39.8"
     variation       115
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375937036"
     variation       154
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201693249"
     variation       226
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144670354"
     exon            283..377
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /inference="alignment:Splign:1.39.8"
     variation       346
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148698401"
     variation       355
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188288774"
     variation       369
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372359154"
     exon            378..484
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /inference="alignment:Splign:1.39.8"
     variation       386
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371075278"
     variation       392
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141373271"
     variation       394
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201010130"
     variation       408
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373120695"
     variation       417
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374852729"
     variation       419
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374808528"
     variation       438..439
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:34372969"
     variation       460
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368749738"
     variation       473
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147422598"
     exon            485..640
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /inference="alignment:Splign:1.39.8"
     variation       498
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139676008"
     variation       527
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200165958"
     variation       529
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199710439"
     variation       542
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371098188"
     variation       550
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:16939095"
     variation       562
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201120200"
     variation       564
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3765201"
     variation       568
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1805099"
     variation       570
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201472707"
     exon            641..728
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /inference="alignment:Splign:1.39.8"
     variation       652
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73692606"
     variation       656
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370121611"
     variation       663
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75249933"
     variation       706
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1805098"
     exon            729..881
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /inference="alignment:Splign:1.39.8"
     variation       765
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201892334"
     variation       769
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148814443"
     variation       776
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201625743"
     variation       814..815
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:34135667"
     exon            882..1118
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /inference="alignment:Splign:1.39.8"
     variation       896
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:142979219"
     variation       924
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376806020"
     variation       941
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183146707"
     variation       949
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146622279"
     variation       996
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141373967"
     variation       1033
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145103946"
     variation       1082
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61755717"
     variation       1092
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138897994"
     variation       1093
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143897221"
     exon            1119..1241
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /inference="alignment:Splign:1.39.8"
     variation       1128
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373673448"
     variation       1137
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199803114"
     variation       1145
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369700596"
     variation       1153
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372960353"
     variation       1169
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375963985"
     variation       1174
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:139324425"
     variation       1196
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138158547"
     exon            1242..4101
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /inference="alignment:Splign:1.39.8"
     variation       1253..1254
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:34783717"
     variation       1253
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201091500"
     variation       1261
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116212851"
     variation       1273
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61753714"
     variation       1288
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:148532560"
     variation       1333
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138203385"
     variation       1345
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188511496"
     STS             1361..1477
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /standard_name="STS-Z49826"
                     /db_xref="UniSTS:69310"
     variation       1384
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142844346"
     variation       1398
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371242252"
     variation       1428
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1805100"
     variation       1489
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2272669"
     variation       1500
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:192940216"
     variation       1702
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2941477"
     variation       1716
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:184799012"
     variation       1725
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:116190863"
     variation       1769
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2941478"
     variation       1871
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:16939104"
     variation       1895
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150642861"
     variation       1901
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:13251904"
     variation       1937
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:117918767"
     variation       1938
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188803761"
     variation       1991
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2941479"
     variation       2003
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:79326815"
     variation       2023
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:180839874"
     variation       2154
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2941480"
     variation       2189..2190
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:35024255"
     variation       2199
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:16939105"
     variation       2248
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183958795"
     variation       2250
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139673271"
     variation       2319..2323
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace=""
                     /replace="atatc"
                     /db_xref="dbSNP:201279175"
     variation       2320..2325
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace=""
                     /replace="tatcat"
                     /db_xref="dbSNP:202169852"
     variation       2383
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:117524236"
     variation       2396
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143615065"
     variation       2400
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2941481"
     variation       2412
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188294689"
     variation       2508
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374801762"
     variation       2561
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17306807"
     variation       2607
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:73692613"
     variation       2612
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:77555098"
     variation       2616
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:11292886"
     variation       2619
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:199888487"
     variation       2621
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201207943"
     variation       2622
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1515020"
     variation       2625
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:191724665"
     variation       2660
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17398054"
     variation       2665
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181843650"
     variation       2690
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:146872446"
     variation       2884
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:73331898"
     variation       2895
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185409544"
     variation       2980
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190271168"
     variation       3027
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2941482"
     variation       3040
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140737476"
     variation       3140
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:113612061"
     variation       3168..3169
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:34963256"
     variation       3188
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144392926"
     variation       3246..3248
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace=""
                     /replace="atc"
                     /db_xref="dbSNP:373915148"
     variation       3283..3285
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:113351166"
     variation       3285
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76997879"
     variation       3291..3292
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:35478074"
     variation       3443
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12682439"
     variation       3458
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:184901602"
     variation       3478
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:56373371"
     variation       3648
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2941483"
     variation       3702
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2943538"
     variation       3770..3771
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:34772424"
     variation       3800
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2941484"
     variation       3895
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189760647"
     variation       3950
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183929234"
     variation       4023
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11774375"
     variation       4092
                     /gene="HNF4G"
                     /gene_synonym="NR2A2; NR2A3"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:11309608"
ORIGIN      
gagggtatcagaaccaatactggacatggacatggcaaattacagtgaagttttggacccaacttacacaactttggagtttgaaactatgcagattctatataattcaagtgatagttctgccccagagacaagtatgaataccacagacaacggtgtcaactgtctgtgtgctatctgtggggacagagcaacaggaaaacactatggggcatccagctgtgatgggtgcaagggtttcttcagacgcagcattcgtaagagtcacgtttattcttgcaggttcagtcggcaatgtgttgttgacaaggacaaaaggaatcaatgtagatattgtcgattaagaaagtgttttagagcgggaatgaaaaaagaagctgtacaaaatgaacgtgacagaataagcaccagaagaagcacatttgatggcagcaacatcccctccattaacacactggcacaagctgaagttcggtctcgccagatctcagtctcaagccctgggtcaagcactgacataaacgttaagaaaattgcaagtattggtgatgtctgtgaatctatgaaacagcagctcttagtcttggtggaatgggctaaatatattcctgccttctgtgaattaccattggatgatcaggtggcactgttgagagctcacgcaggggagcacttactgcttggagctacaaagagatccatgatgtataaagatattttgcttttgggaaacaactatgttattcaccgcaacagctgtgaagttgagattagccgtgtggccaatcgtgttctagatgagctggttagaccatttcaagaaatccagattgatgacaatgagtatgcttgtttaaaggcaattgtattttttgatccagatgcaaaagggctaagcgatccagtaaaaattaagaacatgaggttccaagtgcagatcggtttggaggactacatcaatgatcggcagtatgactcccgggggaggtttggagagttgcttctgctcctgcccacactgcagagcatcacgtggcaaatgattgagcaaatacagtttgttaaactttttgggatggttaaaattgacaatctacttcaggaaatgctattaggtggggcttccaatgatggcagtcatctccatcatccaatgcatccacatttgtctcaagacccattaactggacaaactatacttttaggtcccatgtcaacactggttcatgcagaccagatctcaactcctgaaaccccactcccttccccaccacaaggctctgggcaagaacagtacaaaatagctgcaaaccaagcatcagtcatttcacaccagcatctctccaaacaaaagcaattgtgaaaatgtgtttacttcagaacggcactacataaatgtgaaaagttgttgatcttgaaatatctcaggatagcacttttggcaaactcttagccaaggcttcttcattggtgctgttataagatggtgtcctattttcttgtttatacgttcattctgtttgttattgctactatgtaaaactttcacatgcaaccaatgtatatctgagtttgaagatgtttatatagggtattttttccaactgcccctgcattgtgcctgaaccaattgaatcttatgtatgagtttcatttgttttattaatgttaatttaaatctgtaaataattgctttattgtgatgtgatacagaacaaagtgttcgtttttgactgaaaatagtagatcagaaatctcagtttaatataaaatgagctaagtttttaaaaataaattataaacttggagattagaaaaataaagcagttgctgtagaataggctgtatctttttcaagaagaatctcttatggacagtctgtggtaaagaagcaactctttgctttagagttaaatattcctatcttaagtttagaaaaatacaaaaaaccattccaaggatgactggatactttttgaaatctgactttctttgaagatgtatgttaagcaaaaacatgttgcttttatcagttaggatacagggtgaactgtaacaaagaaacccctaaaacagtgactaaatcaagagaggaatctatttctttctcctgaaacaatttagaaaatagttatccattgactagaaattagtacatgcccacagctggctcccacggtagccaggagaattatctataggtggaaagtctgtgtcagccaaagccatgtcactctgagagaactgattctgaggacaagttagccatctaccacccatgtcccttatttggtcctcacaataacactttaggagagatatcattatcgctgttttataaataagggaaactttagcttgagggtttaaggaacataaccaaagttcacaaacataacgagtgagagaaacacattcaagcccaggtctagttgactttaatgaatctttggtgtggaatgaaaaatgtgaacttcttactcatagtgtggtttttaaatatatgcagttgagtgatgattggatactattcatcatattgcctataatatatatttaccgataagcagtgagtgtaaaattgttgtagcttgaataagaaaccacttttgtagttttaaccagactttctcttaaaaacattagataaaataaaagattcaccggatggattctgatgaaaacgaaaacaaagtaaaatgactggcttagcagattctttgaaatgtagcagcccagggatgtaccaaatgtcgaattctagactgaggagtagagttcattggagtcttaaactctctgatatcacttaaagctggagtttattttaaaacaaatgaagcatgggccacctcatgatgcagtggctcctctctggttgaggagagggaaaattggaaaaactggtcgagtaattatcaataattttttttaaaaagaggatcccaaactgtaaaagattgaaataatctttctcaggattttttaaatgtctaagattatgatgtcatatctcccacttaccttataagtaaaaaggttaatatcaagtaacttattagctcttaaagtaaaattgaacttattaaaagctatctatgatttaatagatttaataaaattccttcacgacctggtacccttgtgaaactgtaaaatatatcatatggggggagttttttaactcttattttttgaaaatttactgtagcttctatttcgtgaataagaatgttttgattttgatcatacaaataacttttgtagatttttgtttacttttgggggggttcccttagaagacattaaaaaaaaatactgccttggtctgtgcaggctgctgtaatgaaatactatgaacttggcagcttataaacaacagaaatttatttctcgctgttctcaatggtgggaagtccaagattaagggatcaacaaattaggcctctggatcatacatggcattttctagctgtgtccttatacataaaaggaaaaaggtagctctctcgagtctctttaataaagatactaattctcatgactgaatcaccctccaaaggccccacctcctaataccatcactctggggactaggtgtcagcatgtgaattttggaaaacacaaaaattcagaacatagcaaatacctttgaagtataaaagataaaattcatttttagtgaaccctgtaatttattcgtgtatatttactaaacagctgtatctttgaaattgttagtaatgattctgcttcaataactatggtcagggaatttataatattatatttttatatactgaactgccatagatgctggaaaaaaggaactgatgttttcagcatattttcaaaatattgataagggaagttattacttttatatagtattcaacttttttcaggtaatagaagtgaataatttattgtgaaataattcattttataaatgtataattatttttataaattttattgttggaaatcaaaaattagtagattttttaccatgttaaattatagtgagattaaagtattactaaactgtgatgctatgtttgtttcactaaactttctaaataaaaactgagaaaaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:3174 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: TAS
            GeneID:3174 -> Molecular function: GO:0003707 [steroid hormone receptor activity] evidence: IEA
            GeneID:3174 -> Molecular function: GO:0004879 [ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity] evidence: IEA
            GeneID:3174 -> Molecular function: GO:0008270 [zinc ion binding] evidence: IEA
            GeneID:3174 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA
            GeneID:3174 -> Biological process: GO:0006357 [regulation of transcription from RNA polymerase II promoter] evidence: TAS
            GeneID:3174 -> Biological process: GO:0006367 [transcription initiation from RNA polymerase II promoter] evidence: TAS
            GeneID:3174 -> Biological process: GO:0010467 [gene expression] evidence: TAS
            GeneID:3174 -> Biological process: GO:0031018 [endocrine pancreas development] evidence: TAS
            GeneID:3174 -> Biological process: GO:0045893 [positive regulation of transcription, DNA-dependent] evidence: IEA
            GeneID:3174 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.