2024-04-19 22:19:17, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_004012 9914 bp mRNA linear PRI 26-MAY-2013 DEFINITION Homo sapiens dystrophin (DMD), transcript variant Dp260-2, mRNA. ACCESSION NM_004012 VERSION NM_004012.3 GI:238018049 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 9914) AUTHORS Suzuki,H., Kameyama,T., Ohe,K., Tsukahara,T. and Mayeda,A. TITLE Nested introns in an intron: evidence of multi-step splicing in a large intron of the human dystrophin pre-mRNA JOURNAL FEBS Lett. 587 (6), 555-561 (2013) PUBMED 23395799 REMARK GeneRIF: The evidence obtained for multi-step splicing in a large intron of the human dystrophin pre-mRNA. REFERENCE 2 (bases 1 to 9914) AUTHORS Singh,S.M. and Mallela,K.M. TITLE The N-terminal actin-binding tandem calponin-homology (CH) domain of dystrophin is in a closed conformation in solution and when bound to F-actin JOURNAL Biophys. J. 103 (9), 1970-1978 (2012) PUBMED 23199925 REMARK GeneRIF: In solution, dystrophin N-terminal actin-binding domain binds to F-actin in a closed conformation. REFERENCE 3 (bases 1 to 9914) AUTHORS Bovolenta,M., Erriquez,D., Valli,E., Brioschi,S., Scotton,C., Neri,M., Falzarano,M.S., Gherardi,S., Fabris,M., Rimessi,P., Gualandi,F., Perini,G. and Ferlini,A. TITLE The DMD locus harbours multiple long non-coding RNAs which orchestrate and control transcription of muscle dystrophin mRNA isoforms JOURNAL PLoS ONE 7 (9), E45328 (2012) PUBMED 23028937 REMARK GeneRIF: Findings reveal that DMD lncRNAs may contribute to the orchestration and homeostasis of the muscle dystrophin expression pattern by either selective targeting and down-modulating the dystrophin promoter transcriptional activity. REFERENCE 4 (bases 1 to 9914) AUTHORS Brioschi,S., Gualandi,F., Scotton,C., Armaroli,A., Bovolenta,M., Falzarano,M.S., Sabatelli,P., Selvatici,R., D'Amico,A., Pane,M., Ricci,G., Siciliano,G., Tedeschi,S., Pini,A., Vercelli,L., De Grandis,D., Mercuri,E., Bertini,E., Merlini,L., Mongini,T. and Ferlini,A. TITLE Genetic characterization in symptomatic female DMD carriers: lack of relationship between X-inactivation, transcriptional DMD allele balancing and phenotype JOURNAL BMC Med. Genet. 13, 73 (2012) PUBMED 22894145 REMARK GeneRIF: No relationship between X-inactivation pattern and transcriptional behaviour of DMD gene was observed in Duchenne muscular dystrophies. Publication Status: Online-Only REFERENCE 5 (bases 1 to 9914) AUTHORS Kapoor,S., Bindu,P.S., Taly,A.B., Sinha,S., Gayathri,N., Rani,S.V., Chandak,G.R. and Kumar,A. TITLE Genetic analysis of an Indian family with members affected with Waardenburg syndrome and Duchenne muscular dystrophy JOURNAL Mol. Vis. 18, 2022-2032 (2012) PUBMED 22876130 REMARK GeneRIF: A novel missense mutation in EDN3 and a deletion mutation in DMD has been found in the same Indian family members affected with Waardenburg syndrome and Duchenne muscular dystrophy. REFERENCE 6 (bases 1 to 9914) AUTHORS Nigro,V., Politano,L., Nigro,G., Romano,S.C., Molinari,A.M. and Puca,G.A. TITLE Detection of a nonsense mutation in the dystrophin gene by multiple SSCP JOURNAL Hum. Mol. Genet. 1 (7), 517-520 (1992) PUBMED 1307253 REFERENCE 7 (bases 1 to 9914) AUTHORS Gorecki,D.C., Monaco,A.P., Derry,J.M., Walker,A.P., Barnard,E.A. and Barnard,P.J. TITLE Expression of four alternative dystrophin transcripts in brain regions regulated by different promoters JOURNAL Hum. Mol. Genet. 1 (7), 505-510 (1992) PUBMED 1307251 REFERENCE 8 (bases 1 to 9914) AUTHORS Lederfein,D., Levy,Z., Augier,N., Mornet,D., Morris,G., Fuchs,O., Yaffe,D. and Nudel,U. TITLE A 71-kilodalton protein is a major product of the Duchenne muscular dystrophy gene in brain and other nonmuscle tissues JOURNAL Proc. Natl. Acad. Sci. U.S.A. 89 (12), 5346-5350 (1992) PUBMED 1319059 REFERENCE 9 (bases 1 to 9914) AUTHORS Rapaport,D., Lederfein,D., den Dunnen,J.T., Grootscholten,P.M., Van Ommen,G.J., Fuchs,O., Nudel,U. and Yaffe,D. TITLE Characterization and cell type distribution of a novel, major transcript of the Duchenne muscular dystrophy gene JOURNAL Differentiation 49 (3), 187-193 (1992) PUBMED 1377655 REFERENCE 10 (bases 1 to 9914) AUTHORS Koenig,M., Monaco,A.P. and Kunkel,L.M. TITLE The complete sequence of dystrophin predicts a rod-shaped cytoskeletal protein JOURNAL Cell 53 (2), 219-228 (1988) PUBMED 3282674 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL109609.5, M18533.1 and BC028720.1. On May 24, 2009 this sequence version replaced gi:150036269. Summary: The dystrophin gene is the largest gene found in nature, measuring 2.4 Mb. The gene was identified through a positional cloning approach, targeted at the isolation of the gene responsible for Duchenne (DMD) and Becker (BMD) Muscular Dystrophies. DMD is a recessive, fatal, X-linked disorder occurring at a frequency of about 1 in 3,500 new-born males. BMD is a milder allelic form. In general, DMD patients carry mutations which cause premature translation termination (nonsense or frame shift mutations), while in BMD patients dystrophin is reduced either in molecular weight (derived from in-frame deletions) or in expression level. The dystrophin gene is highly complex, containing at least eight independent, tissue-specific promoters and two polyA-addition sites. Furthermore, dystrophin RNA is differentially spliced, producing a range of different transcripts, encoding a large set of protein isoforms. Dystrophin (as encoded by the Dp427 transcripts) is a large, rod-like cytoskeletal protein which is found at the inner surface of muscle fibers. Dystrophin is part of the dystrophin-glycoprotein complex (DGC), which bridges the inner cytoskeleton (F-actin) and the extra-cellular matrix. [provided by RefSeq, Jul 2008]. Transcript Variant: transcript Dp260-2 uses exons 30-79, starting from a promoter/exon 1 sequence located in intron 29 of the dystrophin gene that is alternatively spliced and lacks N-terminal amino acids 1-1357 of the full length dystrophin (Dp427m isoform). The Dp260-2 transcript encodes a unique N-terminal MSARKLRNLSYKK sequence. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## RNAseq introns :: mixed/partial sample support ERS025081, ERS025082 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: full length. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-236 AL109609.5 101912-102147 c 237-570 M18533.1 4280-4613 571-571 AL109609.5 79506-79506 c 572-1694 M18533.1 4615-5737 1695-1695 AL109609.5 35892-35892 c 1696-8669 M18533.1 5739-12712 8670-9914 BC028720.1 3398-4642 FEATURES Location/Qualifiers source 1..9914 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="X" /map="Xp21.2" gene 1..9914 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="dystrophin" /db_xref="GeneID:1756" /db_xref="HGNC:2928" /db_xref="HPRD:02303" /db_xref="MIM:300377" variation 23 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:72468651" variation 157 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="t" /db_xref="dbSNP:72468650" misc_feature 195..197 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="upstream in-frame stop codon" CDS 198..7223 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Dp260-2 isoform is encoded by transcript variant Dp260-2" /codon_start=1 /product="dystrophin Dp260-2 isoform" /protein_id="NP_004003.1" /db_xref="GI:5032291" /db_xref="GeneID:1756" /db_xref="HGNC:2928" /db_xref="HPRD:02303" /db_xref="MIM:300377" /translation="
MSARKLRNLSYKKAVRRQKLLEQSIQSAQETEKSLHLIQESLTFIDKQLAAYIADKVDAAQMPQEAQKIQSDLTSHEISLEEMKKHNQGKEAAQRVLSQIDVAQKKLQDVSMKFRLFQKPANFEQRLQESKMILDEVKMHLPALETKSVEQEVVQSQLNHCVNLYKSLSEVKSEVEMVIKTGRQIVQKKQTENPKELDERVTALKLHYNELGAKVTERKQQLEKCLKLSRKMRKEMNVLTEWLAATDMELTKRSAVEGMPSNLDSEVAWGKATQKEIEKQKVHLKSITEVGEALKTVLGKKETLVEDKLSLLNSNWIAVTSRAEEWLNLLLEYQKHMETFDQNVDHITKWIIQADTLLDESEKKKPQQKEDVLKRLKAELNDIRPKVDSTRDQAANLMANRGDHCRKLVEPQISELNHRFAAISHRIKTGKASIPLKELEQFNSDIQKLLEPLEAEIQQGVNLKEEDFNKDMNEDNEGTVKELLQRGDNLQQRITDERKREEIKIKQQLLQTKHNALKDLRSQRRKKALEISHQWYQYKRQADDLLKCLDDIEKKLASLPEPRDERKIKEIDRELQKKKEELNAVRRQAEGLSEDGAAMAVEPTQIQLSKRWREIESKFAQFRRLNFAQIHTVREETMMVMTEDMPLEISYVPSTYLTEITHVSQALLEVEQLLNAPDLCAKDFEDLFKQEESLKNIKDSLQQSSGRIDIIHSKKTAALQSATPVERVKLQEALSQLDFQWEKVNKMYKDRQGRFDRSVEKWRRFHYDIKIFNQWLTEAEQFLRKTQIPENWEHAKYKWYLKELQDGIGQRQTVVRTLNATGEEIIQQSSKTDASILQEKLGSLNLRWQEVCKQLSDRKKRLEEQKNILSEFQRDLNEFVLWLEEADNIASIPLEPGKEQQLKEKLEQVKLLVEELPLRQGILKQLNETGGPVLVSAPISPEEQDKLENKLKQTNLQWIKVSRALPEKQGEIEAQIKDLGQLEKKLEDLEEQLNHLLLWLSPIRNQLEIYNQPNQEGPFDVQETEIAVQAKQPDVEEILSKGQHLYKEKPATQPVKRKLEDLSSEWKAVNRLLQELRAKQPDLAPGLTTIGASPTQTVTLVTQPVVTKETAISKLEMPSSLMLEVPALADFNRAWTELTDWLSLLDQVIKSQRVMVGDLEDINEMIIKQKATMQDLEQRRPQLEELITAAQNLKNKTSNQEARTIITDRIERIQNQWDEVQEHLQNRRQQLNEMLKDSTQWLEAKEEAEQVLGQARAKLESWKEGPYTVDAIQKKITETKQLAKDLRQWQTNVDVANDLALKLLRDYSADDTRKVHMITENINASWRSIHKRVSEREAALEETHRLLQQFPLDLEKFLAWLTEAETTANVLQDATRKERLLEDSKGVKELMKQWQDLQGEIEAHTDVYHNLDENSQKILRSLEGSDDAVLLQRRLDNMNFKWSELRKKSLNIRSHLEASSDQWKRLHLSLQELLVWLQLKDDELSRQAPIGGDFPAVQKQNDVHRAFKRELKTKEPVIMSTLETVRIFLTEQPLEGLEKLYQEPRELPPEERAQNVTRLLRKQAEEVNTEWEKLNLHSADWQRKIDETLERLQELQEATDELDLKLRQAEVIKGSWQPVGDLLIDSLQDHLEKVKALRGEIAPLKENVSHVNDLARQLTTLGIQLSPYNLSTLEDLNTRWKLLQVAVEDRVRQLHEAHRDFGPASQHFLSTSVQGPWERAISPNKVPYYINHETQTTCWDHPKMTELYQSLADLNNVRFSAYRTAMKLRRLQKALCLDLLSLSAACDALDQHNLKQNDQPMDILQIINCLTTIYDRLEQEHNNLVNVPLCVDMCLNWLLNVYDTGRTGRIRVLSFKTGIISLCKAHLEDKYRYLFKQVASSTGFCDQRRLGLLLHDSIQIPRQLGEVASFGGSNIEPSVRSCFQFANNKPEIEAALFLDWMRLEPQSMVWLPVLHRVAAAETAKHQAKCNICKECPIIGFRYRSLKHFNYDICQSCFFSGRVAKGHKMHYPMVEYCTPTTSGEDVRDFAKVLKNKFRTKRYFAKHPRMGYLPVQTVLEGDNMETPVTLINFWPVDSAPASSPQLSHDDTHSRIEHYASRLAEMENSNGSYLNDSISPNESIDDEHLLIQHYCQSLNQDSPLSQPRSPAQILISLESEERGELERILADLEEENRNLQAEYDRLKQQHEHKGLSPLPSPPEMMPTSPQSPRDAELIAEAKLLRQHKGRLEARMQILEDHNKQLESQLHRLRQLLEQPQAEAKVNGTTVSSPSTSLQRSDSSQPMLLRVVGSQTSDSMGEEDLLSPPQDTSTGLEEVMEQLNNSFPSSRGRNTPGKPMREDTM
" misc_feature 198..236 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: dystrophin Dp260-2 unique N-terminus" misc_feature <237..5285 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: central rod domain" misc_feature <237..266 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 9" misc_feature 267..554 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 10" misc_feature 546..869 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 11" misc_feature 564..1193 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 870..1193 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 12" misc_feature 870..887 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 1194..1499 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 13" misc_feature 1200..1493 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeat; Region: Spectrin; pfam00435" /db_xref="CDD:201223" misc_feature 1275..2102 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Uncharacterized archaeal coiled-coil protein [Function unknown]; Region: COG1340" /db_xref="CDD:31531" misc_feature 1500..1787 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 14" misc_feature 1503..2069 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 1788..2084 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 15" misc_feature 1791..1808 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 2139..2468 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 16" misc_feature 2163..2789 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 2469..2789 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 17" misc_feature 2469..2486 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 2478..3125 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 2790..3119 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 18" misc_feature order(2790..2798,2802..2810) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 3120..3434 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 19" misc_feature 3435..3575 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: hinge region 3" misc_feature 3576..3896 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 20" misc_feature 3579..4229 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 3897..4223 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 21" misc_feature 3897..3914 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 4224..4571 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 22" misc_feature 4233..4964 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 4572..4958 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 23" misc_feature 4572..4589 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 4959..5285 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 24" misc_feature 4968..>5300 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 5205..5501 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: hinge region 4" misc_feature 5286..5300 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 5331..5441 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: WW-domain" misc_feature 5340..5429 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Two conserved tryptophans domain; also known as the WWP or rsp5 domain; around 40 amino acids; functions as an interaction module in a diverse set of signalling proteins; binds specific proline-rich sequences but at low affinities compared to other...; Region: WW; cd00201" /db_xref="CDD:29258" misc_feature order(5379..5381,5412..5414) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="binding pocket" /db_xref="CDD:29258" misc_feature 5403..6389 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="dystroglycan binding site" misc_feature 5424..5786 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="EF hand; Region: efhand_1; pfam09068" /db_xref="CDD:149945" misc_feature 5463..6065 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: Cysteine-rich domain" misc_feature 5553..5636 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: EF-hand 1" misc_feature 5697..5783 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: EF-hand 2" misc_feature 5796..6071 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="EF-hand; Region: efhand_2; pfam09069" /db_xref="CDD:149946" misc_feature 6063..7220 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: Carboxy-terminal region" misc_feature 6084..6227 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: ZZ-domain" misc_feature 6096..6242 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Zinc finger, ZZ type. Zinc finger present in dystrophin and dystrobrevin. The ZZ motif coordinates two zinc ions and most likely participates in ligand binding or molecular scaffolding. Dystrophin attaches actin filaments to an integral membrane...; Region: ZZ_dystrophin; cd02334" /db_xref="CDD:30238" misc_feature order(6102..6104,6111..6113,6147..6149,6156..6158, 6174..6176,6183..6185,6213..6215,6225..6227) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Zinc-binding sites [ion binding]; other site" /db_xref="CDD:30238" misc_feature order(6102..6104,6111..6113,6174..6176,6183..6185) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="zinc cluster 1 [ion binding]; other site" /db_xref="CDD:30238" misc_feature order(6105..6107,6138..6140,6144..6146,6162..6164, 6168..6170) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="putative charged binding surface; other site" /db_xref="CDD:30238" misc_feature order(6141..6143,6186..6188,6231..6233,6240..6242) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="putative hydrophobic binding surface; other site" /db_xref="CDD:30238" misc_feature order(6147..6149,6156..6158,6213..6215,6225..6227) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="zinc cluster 2 [ion binding]; other site" /db_xref="CDD:30238" misc_feature 6438..6440 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 6495..6647 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="alpha1-syntrophin binding site" misc_feature 6648..6770 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="beta1-syntrophin binding site" misc_feature 6837..6944 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: (Leu)6-heptad repeat" variation 206 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:72468649" variation 296 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:1800263" variation 440 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:72468647" variation 571 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="t" /db_xref="dbSNP:1057872" variation 694 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:72468638" STS 697..809 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99582" variation 1042 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="t" /db_xref="dbSNP:72468634" variation 1142 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:1801185" variation 1205 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:72468632" variation 1328 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="g" /db_xref="dbSNP:72468630" variation 1399 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1801187" STS 1576..2133 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="MARC_84357-84358:1278016549:1" /db_xref="UniSTS:532591" variation 1624 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1800271" variation 1695 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:1064325" variation 1697 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:1801186" STS 1801..1895 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99541" variation 1940 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1800272" variation 2193 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="g" /replace="t" /db_xref="dbSNP:72468613" STS 2457..2581 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99225" variation 2628 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:1800273" STS 2831..2913 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99066" variation 2993 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:72466595" variation 3245 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1800274" variation 3261 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:1800275" variation 3348 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:72466590" STS 3529..3640 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DXS7499" /db_xref="UniSTS:30753" variation 3893 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:1801188" variation 3985 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="t" /db_xref="dbSNP:72466581" STS 4050..4185 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99382" variation 4220 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1801189" STS 4392..4491 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99545" variation 4487 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:72466575" variation 4661 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:72466574" variation 4736 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:72466570" variation 4744 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:72466569" variation 4975 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1800280" STS 4986..5088 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99400" variation 5017 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:72466567" variation 5258 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:72466563" variation 5259 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:72466562" STS 5737..5804 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99128" variation 6785 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:72466538" variation 6954 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:1800281" variation 7183 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1795743" STS 7305..7498 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="PMC316713P2" /db_xref="UniSTS:273040" STS 7573..7761 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="G15848" /db_xref="UniSTS:3168" STS 7614..7746 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DXS1234" /db_xref="UniSTS:146800" variation 7703..7704 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="acac" /replace="taca" /db_xref="dbSNP:3833413" variation 8147 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="acaa" /db_xref="dbSNP:72466531" variation 8191 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="t" /db_xref="dbSNP:72466530" STS 8229..8297 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DXS503" /db_xref="UniSTS:99031" variation 8271 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="gat" /db_xref="dbSNP:72466529" variation 8468 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="cttt" /db_xref="dbSNP:72466527" STS 8535..8685 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DXS6988E" /db_xref="UniSTS:32060" variation 8670 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:3361" STS 8691..8791 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="A002S20" /db_xref="UniSTS:57879" variation 8788 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="aaag" /db_xref="dbSNP:72466526" variation 8814 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="tgtt" /db_xref="dbSNP:72466525" variation 8954 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:3198427" variation 8981 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="ttcat" /db_xref="dbSNP:72466524" variation 9262 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:72466523" variation 9376 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="atgtgacgctggacctt" /db_xref="dbSNP:72466522" variation 9408 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="t" /db_xref="dbSNP:11550191" variation 9460 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="aagt" /db_xref="dbSNP:72466521" STS 9541..9732 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:506537" variation 9650 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1057915" STS 9798..9882 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="PMC108984P1" /db_xref="UniSTS:270148" variation 9804 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="actt" /db_xref="dbSNP:72466520" polyA_signal 9892..9897 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" polyA_site 9914 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" ORIGIN
taatgagatcaggaggaacattcgacctgagaaagacagattgcaatgactgagatgattttgctaattttttttccagcctatttccttaatgtacgtgatattgtgattgattttcatgcagagatccctgatcctatagttttgtttgctatttatttttctccttcacattttttttctatcaacagagctgaatgagtgccaggaagctgcgaaatctgtcttacaaaaaggctgtaaggaggcaaaagttgcttgaacagagcatccagtctgcccaggagactgaaaaatccttacacttaatccaggagtccctcacattcattgacaagcagttggcagcttatattgcagacaaggtggacgcagctcaaatgcctcaggaagcccagaaaatccaatctgatttgacaagtcatgagatcagtttagaagaaatgaagaaacataatcaggggaaggaggctgcccaaagagtcctgtctcagattgatgttgcacagaaaaaattacaagatgtctccatgaagtttcgattattccagaaaccagccaattttgagcagcgtctacaagaaagtaagatgattttagatgaagtgaagatgcacttgcctgcattggaaacaaagagtgtggaacaggaagtagtacagtcacagctaaatcattgtgtgaacttgtataaaagtctgagtgaagtgaagtctgaagtggaaatggtgataaagactggacgtcagattgtacagaaaaagcagacggaaaatcccaaagaacttgatgaaagagtaacagctttgaaattgcattataatgagctgggagcaaaggtaacagaaagaaagcaacagttggagaaatgcttgaaattgtcccgtaagatgcgaaaggaaatgaatgtcttgacagaatggctggcagctacagatatggaattgacaaagagatcagcagttgaaggaatgcctagtaatttggattctgaagttgcctggggaaaggctactcaaaaagagattgagaaacagaaggtgcacctgaagagtatcacagaggtaggagaggccttgaaaacagttttgggcaagaaggagacgttggtggaagataaactcagtcttctgaatagtaactggatagctgtcacctcccgagcagaagagtggttaaatcttttgttggaataccagaaacacatggaaacttttgaccagaatgtggaccacatcacaaagtggatcattcaggctgacacacttttggatgaatcagagaaaaagaaaccccagcaaaaagaagacgtgcttaagcgtttaaaggcagaactgaatgacatacgcccaaaggtggactctacacgtgaccaagcagcaaacttgatggcaaaccgcggtgaccactgcaggaaattagtagagccccaaatctcagagctcaaccatcgatttgcagccatttcacacagaattaagactggaaaggcctccattcctttgaaggaattggagcagtttaactcagatatacaaaaattgcttgaaccactggaggctgaaattcagcagggggtgaatctgaaagaggaagacttcaataaagatatgaatgaagacaatgagggtactgtaaaagaattgttgcaaagaggagacaacttacaacaaagaatcacagatgagagaaagcgagaggaaataaagataaaacagcagctgttacagacaaaacataatgctctcaaggatttgaggtctcaaagaagaaaaaaggctctagaaatttctcatcagtggtatcagtacaagaggcaggctgatgatctcctgaaatgcttggatgacattgaaaaaaaattagccagcctacctgagcccagagatgaaaggaaaataaaggaaattgatcgggaattgcagaagaagaaagaggagctgaatgcagtgcgtaggcaagctgagggcttgtctgaggatggggccgcaatggcagtggagccaactcagatccagctcagcaagcgctggcgggaaattgagagcaaatttgctcagtttcgaagactcaactttgcacaaattcacactgtccgtgaagaaacgatgatggtgatgactgaagacatgcctttggaaatttcttatgtgccttctacttatttgactgaaatcactcatgtctcacaagccctattagaagtggaacaacttctcaatgctcctgacctctgtgctaaggactttgaagatctctttaagcaagaggagtctctgaagaatataaaagatagtctacaacaaagctcaggtcggattgacattattcatagcaagaagacagcagcattgcaaagtgcaacgcctgtggaaagggtgaagctacaggaagctctctcccagcttgatttccaatgggaaaaagttaacaaaatgtacaaggaccgacaagggcgatttgacagatctgttgagaaatggcggcgttttcattatgatataaagatatttaatcagtggctaacagaagctgaacagtttctcagaaagacacaaattcctgagaattgggaacatgctaaatacaaatggtatcttaaggaactccaggatggcattgggcagcggcaaactgttgtcagaacattgaatgcaactggggaagaaataattcagcaatcctcaaaaacagatgccagtattctacaggaaaaattgggaagcctgaatctgcggtggcaggaggtctgcaaacagctgtcagacagaaaaaagaggctagaagaacaaaagaatatcttgtcagaatttcaaagagatttaaatgaatttgttttatggttggaggaagcagataacattgctagtatcccacttgaacctggaaaagagcagcaactaaaagaaaagcttgagcaagtcaagttactggtggaagagttgcccctgcgccagggaattctcaaacaattaaatgaaactggaggacccgtgcttgtaagtgctcccataagcccagaagagcaagataaacttgaaaataagctcaagcagacaaatctccagtggataaaggtttccagagctttacctgagaaacaaggagaaattgaagctcaaataaaagaccttgggcagcttgaaaaaaagcttgaagaccttgaagagcagttaaatcatctgctgctgtggttatctcctattaggaatcagttggaaatttataaccaaccaaaccaagaaggaccatttgacgttcaggaaactgaaatagcagttcaagctaaacaaccggatgtggaagagattttgtctaaagggcagcatttgtacaaggaaaaaccagccactcagccagtgaagaggaagttagaagatctgagctctgagtggaaggcggtaaaccgtttacttcaagagctgagggcaaagcagcctgacctagctcctggactgaccactattggagcctctcctactcagactgttactctggtgacacaacctgtggttactaaggaaactgccatctccaaactagaaatgccatcttccttgatgttggaggtacctgctctggcagatttcaaccgggcttggacagaacttaccgactggctttctctgcttgatcaagttataaaatcacagagggtgatggtgggtgaccttgaggatatcaacgagatgatcatcaagcagaaggcaacaatgcaggatttggaacagaggcgtccccagttggaagaactcattaccgctgcccaaaatttgaaaaacaagaccagcaatcaagaggctagaacaatcattacggatcgaattgaaagaattcagaatcagtgggatgaagtacaagaacaccttcagaaccggaggcaacagttgaatgaaatgttaaaggattcaacacaatggctggaagctaaggaagaagctgagcaggtcttaggacaggccagagccaagcttgagtcatggaaggagggtccctatacagtagatgcaatccaaaagaaaatcacagaaaccaagcagttggccaaagacctccgccagtggcagacaaatgtagatgtggcaaatgacttggccctgaaacttctccgggattattctgcagatgataccagaaaagtccacatgataacagagaatatcaatgcctcttggagaagcattcataaaagggtgagtgagcgagaggctgctttggaagaaactcatagattactgcaacagttccccctggacctggaaaagtttcttgcctggcttacagaagctgaaacaactgccaatgtcctacaggatgctacccgtaaggaaaggctcctagaagactccaagggagtaaaagagctgatgaaacaatggcaagacctccaaggtgaaattgaagctcacacagatgtttatcacaacctggatgaaaacagccaaaaaatcctgagatccctggaaggttccgatgatgcagtcctgttacaaagacgtttggataacatgaacttcaagtggagtgaacttcggaaaaagtctctcaacattaggtcccatttggaagccagttctgaccagtggaagcgtctgcacctttctctgcaggaacttctggtgtggctacagctgaaagatgatgaattaagccggcaggcacctattggaggcgactttccagcagttcagaagcagaacgatgtacatagggccttcaagagggaattgaaaactaaagaacctgtaatcatgagtactcttgagactgtacgaatatttctgacagagcagcctttggaaggactagagaaactctaccaggagcccagagagctgcctcctgaggagagagcccagaatgtcactcggcttctacgaaagcaggctgaggaggtcaatactgagtgggaaaaattgaacctgcactccgctgactggcagagaaaaatagatgagacccttgaaagactccaggaacttcaagaggccacggatgagctggacctcaagctgcgccaagctgaggtgatcaagggatcctggcagcccgtgggcgatctcctcattgactctctccaagatcacctcgagaaagtcaaggcacttcgaggagaaattgcgcctctgaaagagaacgtgagccacgtcaatgaccttgctcgccagcttaccactttgggcattcagctctcaccgtataacctcagcactctggaagacctgaacaccagatggaagcttctgcaggtggccgtcgaggaccgagtcaggcagctgcatgaagcccacagggactttggtccagcatctcagcactttctttccacgtctgtccagggtccctgggagagagccatctcgccaaacaaagtgccctactatatcaaccacgagactcaaacaacttgctgggaccatcccaaaatgacagagctctaccagtctttagctgacctgaataatgtcagattctcagcttataggactgccatgaaactccgaagactgcagaaggccctttgcttggatctcttgagcctgtcagctgcatgtgatgccttggaccagcacaacctcaagcaaaatgaccagcccatggatatcctgcagattattaattgtttgaccactatttatgaccgcctggagcaagagcacaacaatttggtcaacgtccctctctgcgtggatatgtgtctgaactggctgctgaatgtttatgatacgggacgaacagggaggatccgtgtcctgtcttttaaaactggcatcatttccctgtgtaaagcacatttggaagacaagtacagataccttttcaagcaagtggcaagttcaacaggattttgtgaccagcgcaggctgggcctccttctgcatgattctatccaaattccaagacagttgggtgaagttgcatcctttgggggcagtaacattgagccaagtgtccggagctgcttccaatttgctaataataagccagagatcgaagcggccctcttcctagactggatgagactggaaccccagtccatggtgtggctgcccgtcctgcacagagtggctgctgcagaaactgccaagcatcaggccaaatgtaacatctgcaaagagtgtccaatcattggattcaggtacaggagtctaaagcactttaattatgacatctgccaaagctgctttttttctggtcgagttgcaaaaggccataaaatgcactatcccatggtggaatattgcactccgactacatcaggagaagatgttcgagactttgccaaggtactaaaaaacaaatttcgaaccaaaaggtattttgcgaagcatccccgaatgggctacctgccagtgcagactgtcttagagggggacaacatggaaactcccgttactctgatcaacttctggccagtagattctgcgcctgcctcgtcccctcagctttcacacgatgatactcattcacgcattgaacattatgctagcaggctagcagaaatggaaaacagcaatggatcttatctaaatgatagcatctctcctaatgagagcatagatgatgaacatttgttaatccagcattactgccaaagtttgaaccaggactcccccctgagccagcctcgtagtcctgcccagatcttgatttccttagagagtgaggaaagaggggagctagagagaatcctagcagatcttgaggaagaaaacaggaatctgcaagcagaatatgaccgtctaaagcagcagcacgaacataaaggcctgtccccactgccgtcccctcctgaaatgatgcccacctctccccagagtccccgggatgctgagctcattgctgaggccaagctactgcgtcaacacaaaggccgcctggaagccaggatgcaaatcctggaagaccacaataaacagctggagtcacagttacacaggctaaggcagctgctggagcaaccccaggcagaggccaaagtgaatggcacaacggtgtcctctccttctacctctctacagaggtccgacagcagtcagcctatgctgctccgagtggttggcagtcaaacttcggactccatgggtgaggaagatcttctcagtcctccccaggacacaagcacagggttagaggaggtgatggagcaactcaacaactccttccctagttcaagaggaagaaatacccctggaaagccaatgagagaggacacaatgtaggaagtcttttccacatggcagatgatttgggcagagcgatggagtccttagtatcagtcatgacagatgaagaaggagcagaataaatgttttacaactcctgattcccgcatggtttttataatattcatacaacaaagaggattagacagtaagagtttacaagaaataaatctatatttttgtgaagggtagtggtattatactgtagatttcagtagtttctaagtctgttattgttttgttaacaatggcaggttttacacgtctatgcaattgtacaaaaaagttataagaaaactacatgtaaaatcttgatagctaaataacttgccatttctttatatggaacgcattttgggttgtttaaaaatttataacagttataaagaaagattgtaaactaaagtgtgctttataaaaaaaagttgtttataaaaacccctaaaaacaaaacaaacacacacacacacacatacacacacacacacaaaactttgaggcagcgcattgttttgcatccttttggcgtgatatccatatgaaattcatggctttttctttttttgcatattaaagataagacttcctctaccaccacaccaaatgactactacacactgctcatttgagaactgtcagctgagtggggcaggcttgagttttcatttcatatatctatatgtctataagtatataaatactatagttatatagataaagagatacgaatttctatagactgactttttccattttttaaatgttcatgtcacatcctaatagaaagaaattacttctagtcagtcatccaggcttacctgcttggtctagaatggatttttcccggagccggaagccaggaggaaactacaccacactaaaacattgtctacagctccagatgtttctcattttaaacaactttccactgacaacgaaagtaaagtaaagtattggatttttttaaagggaacatgtgaatgaatacacaggacttattatatcagagtgagtaatcggttggttggttgattgattgattgattgatacattcagcttcctgctgctagcaatgccacgatttagatttaatgatgcttcagtggaaatcaatcagaaggtattctgaccttgtgaacatcagaaggtattttttaactcccaagcagtagcaggacgatgatagggctggagggctatggattcccagcccatccctgtgaaggagtaggccactctttaagtgaaggattggatgattgttcataatacataaagttctctgtaattacaactaaattattatgccctcttctcacagtcaaaaggaactgggtggtttggtttttgttgcttttttagatttattgtcccatgtgggatgagtttttaaatgccacaagacataatttaaaataaataaactttgggaaaaggtgtaaaacagtagccccatcacatttgtgatactgacaggtatcaacccagaagcccatgaactgtgtttccatcctttgcatttctctgcgagtagttccacacaggtttgtaagtaagtaagaaagaaggcaaattgattcaaatgttacaaaaaaacccttcttggtggattagacaggttaaatatataaacaaacaaacaaaaattgctcaaaaaagaggagaaaagctcaagaggaaaagctaaggactggtaggaaaaagctttactctttcatgccattttatttctttttgatttttaaatcattcattcaatagataccaccgtgtgacctataattttgcaaatctgttacctctgacatcaagtgtaattagcttttggagagtgggctgacatcaagtgtaattagcttttggagagtgggttttgtccattattaataattaattaattaacatcaaacacggcttctcatgctatttctacctcactttggttttggggtgttcctgataattgtgcacacctgagttcacagcttcaccacttgtccattgcgttattttctttttcctttataattctttctttttccttcataattttcaaaagaaaacccaaagctctaaggtaacaaattaccaaattacatgaagatttggtttttgtcttgcatttttttcctttatgtgacgctggaccttttctttacccaaggatttttaaaactcagatttaaaacaaggggttactttacatcctactaagaagtttaagtaagtaagtttcattctaaaatcagaggtaaatagagtgcataaataattttgttttaatctttttgtttttcttttagacacattagctctggagtgagtctgtcataatatttgaacaaaaattgagagctttattgctgcattttaagcataattaatttggacattatttcgtgttgtgttctttataaccaccaagtattaaactgtaaatcataatgtaactgaagcataaacatcacatggcatgttttgtcattgttttcaggtactgagttcttacttgagtatcataatatattgtgttttaacaccaacactgtaacatttacgaattatttttttaaacttcagttttactgcattttcacaacatatcagacttcaccaaatatatgccttactattgtattatagtactgctttactgtgtatctcaataaagcacgcagttatgttac
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:1756 -> Molecular function: GO:0002162 [dystroglycan binding] evidence: IPI GeneID:1756 -> Molecular function: GO:0003779 [actin binding] evidence: IDA GeneID:1756 -> Molecular function: GO:0003779 [actin binding] evidence: TAS GeneID:1756 -> Molecular function: GO:0005200 [structural constituent of cytoskeleton] evidence: TAS GeneID:1756 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA GeneID:1756 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:1756 -> Molecular function: GO:0008270 [zinc ion binding] evidence: IEA GeneID:1756 -> Molecular function: GO:0008307 [structural constituent of muscle] evidence: IDA GeneID:1756 -> Molecular function: GO:0008307 [structural constituent of muscle] evidence: TAS GeneID:1756 -> Molecular function: GO:0017022 [myosin binding] evidence: IDA GeneID:1756 -> Molecular function: GO:0017166 [vinculin binding] evidence: IPI GeneID:1756 -> Molecular function: GO:0050998 [nitric-oxide synthase binding] evidence: ISS GeneID:1756 -> Biological process: GO:0001954 [positive regulation of cell-matrix adhesion] evidence: IEA GeneID:1756 -> Biological process: GO:0002027 [regulation of heart rate] evidence: IMP GeneID:1756 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: IEA GeneID:1756 -> Biological process: GO:0007517 [muscle organ development] evidence: NAS GeneID:1756 -> Biological process: GO:0008065 [establishment of blood-nerve barrier] evidence: IEA GeneID:1756 -> Biological process: GO:0010880 [regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum] evidence: ISS GeneID:1756 -> Biological process: GO:0010881 [regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion] evidence: ISS GeneID:1756 -> Biological process: GO:0010976 [positive regulation of neuron projection development] evidence: IMP GeneID:1756 -> Biological process: GO:0014809 [regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion] evidence: ISS GeneID:1756 -> Biological process: GO:0014819 [regulation of skeletal muscle contraction] evidence: ISS GeneID:1756 -> Biological process: GO:0014904 [myotube cell development] evidence: IEA GeneID:1756 -> Biological process: GO:0021629 [olfactory nerve structural organization] evidence: IEA GeneID:1756 -> Biological process: GO:0030049 [muscle filament sliding] evidence: TAS GeneID:1756 -> Biological process: GO:0030198 [extracellular matrix organization] evidence: TAS GeneID:1756 -> Biological process: GO:0033137 [negative regulation of peptidyl-serine phosphorylation] evidence: ISS GeneID:1756 -> Biological process: GO:0034613 [cellular protein localization] evidence: IMP GeneID:1756 -> Biological process: GO:0043043 [peptide biosynthetic process] evidence: IDA GeneID:1756 -> Biological process: GO:0043623 [cellular protein complex assembly] evidence: ISS GeneID:1756 -> Biological process: GO:0044458 [motile cilium assembly] evidence: TAS GeneID:1756 -> Biological process: GO:0045213 [neurotransmitter receptor metabolic process] evidence: IEA GeneID:1756 -> Biological process: GO:0045666 [positive regulation of neuron differentiation] evidence: IMP GeneID:1756 -> Biological process: GO:0046716 [muscle cell homeostasis] evidence: IEA GeneID:1756 -> Biological process: GO:0048747 [muscle fiber development] evidence: IEA GeneID:1756 -> Biological process: GO:0051647 [nucleus localization] evidence: IEA GeneID:1756 -> Biological process: GO:0060048 [cardiac muscle contraction] evidence: IMP GeneID:1756 -> Biological process: GO:0060314 [regulation of ryanodine-sensitive calcium-release channel activity] evidence: ISS GeneID:1756 -> Biological process: GO:0060857 [establishment of glial blood-brain barrier] evidence: IEA GeneID:1756 -> Biological process: GO:0086001 [regulation of cardiac muscle cell action potential] evidence: ISS GeneID:1756 -> Biological process: GO:0090287 [regulation of cellular response to growth factor stimulus] evidence: IMP GeneID:1756 -> Biological process: GO:1901385 [regulation of voltage-gated calcium channel activity] evidence: ISS GeneID:1756 -> Biological process: GO:2000169 [regulation of peptidyl-cysteine S-nitrosylation] evidence: ISS GeneID:1756 -> Biological process: GO:2000651 [positive regulation of sodium ion transmembrane transporter activity] evidence: ISS GeneID:1756 -> Cellular component: GO:0005634 [nucleus] evidence: IDA GeneID:1756 -> Cellular component: GO:0005634 [nucleus] evidence: TAS GeneID:1756 -> Cellular component: GO:0005829 [cytosol] evidence: TAS GeneID:1756 -> Cellular component: GO:0005856 [cytoskeleton] evidence: IEA GeneID:1756 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA GeneID:1756 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS GeneID:1756 -> Cellular component: GO:0009986 [cell surface] evidence: IDA GeneID:1756 -> Cellular component: GO:0015629 [actin cytoskeleton] evidence: TAS GeneID:1756 -> Cellular component: GO:0016010 [dystrophin-associated glycoprotein complex] evidence: IDA GeneID:1756 -> Cellular component: GO:0016010 [dystrophin-associated glycoprotein complex] evidence: NAS GeneID:1756 -> Cellular component: GO:0016010 [dystrophin-associated glycoprotein complex] evidence: TAS GeneID:1756 -> Cellular component: GO:0030018 [Z disc] evidence: IEA GeneID:1756 -> Cellular component: GO:0030055 [cell-substrate junction] evidence: IEA GeneID:1756 -> Cellular component: GO:0030175 [filopodium] evidence: IDA GeneID:1756 -> Cellular component: GO:0042383 [sarcolemma] evidence: IDA GeneID:1756 -> Cellular component: GO:0043034 [costamere] evidence: IDA GeneID:1756 -> Cellular component: GO:0043234 [protein complex] evidence: IDA GeneID:1756 -> Cellular component: GO:0044306 [neuron projection terminus] evidence: IEA GeneID:1756 -> Cellular component: GO:0045121 [membrane raft] evidence: IEA GeneID:1756 -> Cellular component: GO:0045121 [membrane raft] evidence: TAS GeneID:1756 -> Cellular component: GO:0045211 [postsynaptic membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.