2024-04-19 03:18:36, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_004011 9771 bp mRNA linear PRI 26-MAY-2013 DEFINITION Homo sapiens dystrophin (DMD), transcript variant Dp260-1, mRNA. ACCESSION NM_004011 VERSION NM_004011.3 GI:238018048 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 9771) AUTHORS Suzuki,H., Kameyama,T., Ohe,K., Tsukahara,T. and Mayeda,A. TITLE Nested introns in an intron: evidence of multi-step splicing in a large intron of the human dystrophin pre-mRNA JOURNAL FEBS Lett. 587 (6), 555-561 (2013) PUBMED 23395799 REMARK GeneRIF: The evidence obtained for multi-step splicing in a large intron of the human dystrophin pre-mRNA. REFERENCE 2 (bases 1 to 9771) AUTHORS Singh,S.M. and Mallela,K.M. TITLE The N-terminal actin-binding tandem calponin-homology (CH) domain of dystrophin is in a closed conformation in solution and when bound to F-actin JOURNAL Biophys. J. 103 (9), 1970-1978 (2012) PUBMED 23199925 REMARK GeneRIF: In solution, dystrophin N-terminal actin-binding domain binds to F-actin in a closed conformation. REFERENCE 3 (bases 1 to 9771) AUTHORS Bovolenta,M., Erriquez,D., Valli,E., Brioschi,S., Scotton,C., Neri,M., Falzarano,M.S., Gherardi,S., Fabris,M., Rimessi,P., Gualandi,F., Perini,G. and Ferlini,A. TITLE The DMD locus harbours multiple long non-coding RNAs which orchestrate and control transcription of muscle dystrophin mRNA isoforms JOURNAL PLoS ONE 7 (9), E45328 (2012) PUBMED 23028937 REMARK GeneRIF: Findings reveal that DMD lncRNAs may contribute to the orchestration and homeostasis of the muscle dystrophin expression pattern by either selective targeting and down-modulating the dystrophin promoter transcriptional activity. REFERENCE 4 (bases 1 to 9771) AUTHORS Brioschi,S., Gualandi,F., Scotton,C., Armaroli,A., Bovolenta,M., Falzarano,M.S., Sabatelli,P., Selvatici,R., D'Amico,A., Pane,M., Ricci,G., Siciliano,G., Tedeschi,S., Pini,A., Vercelli,L., De Grandis,D., Mercuri,E., Bertini,E., Merlini,L., Mongini,T. and Ferlini,A. TITLE Genetic characterization in symptomatic female DMD carriers: lack of relationship between X-inactivation, transcriptional DMD allele balancing and phenotype JOURNAL BMC Med. Genet. 13, 73 (2012) PUBMED 22894145 REMARK GeneRIF: No relationship between X-inactivation pattern and transcriptional behaviour of DMD gene was observed in Duchenne muscular dystrophies. Publication Status: Online-Only REFERENCE 5 (bases 1 to 9771) AUTHORS Kapoor,S., Bindu,P.S., Taly,A.B., Sinha,S., Gayathri,N., Rani,S.V., Chandak,G.R. and Kumar,A. TITLE Genetic analysis of an Indian family with members affected with Waardenburg syndrome and Duchenne muscular dystrophy JOURNAL Mol. Vis. 18, 2022-2032 (2012) PUBMED 22876130 REMARK GeneRIF: A novel missense mutation in EDN3 and a deletion mutation in DMD has been found in the same Indian family members affected with Waardenburg syndrome and Duchenne muscular dystrophy. REFERENCE 6 (bases 1 to 9771) AUTHORS Nigro,V., Politano,L., Nigro,G., Romano,S.C., Molinari,A.M. and Puca,G.A. TITLE Detection of a nonsense mutation in the dystrophin gene by multiple SSCP JOURNAL Hum. Mol. Genet. 1 (7), 517-520 (1992) PUBMED 1307253 REFERENCE 7 (bases 1 to 9771) AUTHORS Gorecki,D.C., Monaco,A.P., Derry,J.M., Walker,A.P., Barnard,E.A. and Barnard,P.J. TITLE Expression of four alternative dystrophin transcripts in brain regions regulated by different promoters JOURNAL Hum. Mol. Genet. 1 (7), 505-510 (1992) PUBMED 1307251 REFERENCE 8 (bases 1 to 9771) AUTHORS Lederfein,D., Levy,Z., Augier,N., Mornet,D., Morris,G., Fuchs,O., Yaffe,D. and Nudel,U. TITLE A 71-kilodalton protein is a major product of the Duchenne muscular dystrophy gene in brain and other nonmuscle tissues JOURNAL Proc. Natl. Acad. Sci. U.S.A. 89 (12), 5346-5350 (1992) PUBMED 1319059 REFERENCE 9 (bases 1 to 9771) AUTHORS Rapaport,D., Lederfein,D., den Dunnen,J.T., Grootscholten,P.M., Van Ommen,G.J., Fuchs,O., Nudel,U. and Yaffe,D. TITLE Characterization and cell type distribution of a novel, major transcript of the Duchenne muscular dystrophy gene JOURNAL Differentiation 49 (3), 187-193 (1992) PUBMED 1377655 REFERENCE 10 (bases 1 to 9771) AUTHORS Koenig,M., Monaco,A.P. and Kunkel,L.M. TITLE The complete sequence of dystrophin predicts a rod-shaped cytoskeletal protein JOURNAL Cell 53 (2), 219-228 (1988) PUBMED 3282674 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL109609.5, M18533.1 and BC028720.1. On May 24, 2009 this sequence version replaced gi:150036267. Summary: The dystrophin gene is the largest gene found in nature, measuring 2.4 Mb. The gene was identified through a positional cloning approach, targeted at the isolation of the gene responsible for Duchenne (DMD) and Becker (BMD) Muscular Dystrophies. DMD is a recessive, fatal, X-linked disorder occurring at a frequency of about 1 in 3,500 new-born males. BMD is a milder allelic form. In general, DMD patients carry mutations which cause premature translation termination (nonsense or frame shift mutations), while in BMD patients dystrophin is reduced either in molecular weight (derived from in-frame deletions) or in expression level. The dystrophin gene is highly complex, containing at least eight independent, tissue-specific promoters and two polyA-addition sites. Furthermore, dystrophin RNA is differentially spliced, producing a range of different transcripts, encoding a large set of protein isoforms. Dystrophin (as encoded by the Dp427 transcripts) is a large, rod-like cytoskeletal protein which is found at the inner surface of muscle fibers. Dystrophin is part of the dystrophin-glycoprotein complex (DGC), which bridges the inner cytoskeleton (F-actin) and the extra-cellular matrix. [provided by RefSeq, Jul 2008]. Transcript Variant: transcript Dp260-1 uses exons 30-79, and originates from a promoter/exon 1 sequence located in intron 29 of the dystrophin gene. As a result, Dp260-1 contains a 95 bp exon 1 encoding a unique N-terminal 16 aa MTEIILLIFFPAYFLN-sequence that replaces amino acids 1-1357 of the full-length dystrophin product (Dp427m isoform). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## RNAseq introns :: mixed/partial sample support ERS025081, ERS025082 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: full length. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-93 AL109609.5 102055-102147 c 94-427 M18533.1 4280-4613 428-428 AL109609.5 79506-79506 c 429-1551 M18533.1 4615-5737 1552-1552 AL109609.5 35892-35892 c 1553-8526 M18533.1 5739-12712 8527-9771 BC028720.1 3398-4642 FEATURES Location/Qualifiers source 1..9771 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="X" /map="Xp21.2" gene 1..9771 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="dystrophin" /db_xref="GeneID:1756" /db_xref="HGNC:2928" /db_xref="MIM:300377" variation 23 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:72468651" misc_feature 28..30 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="upstream in-frame stop codon" CDS 46..7080 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Dp260-1 isoform is encoded by transcript variant Dp260-1" /codon_start=1 /product="dystrophin Dp260-1 isoform" /protein_id="NP_004002.2" /db_xref="GI:150036268" /db_xref="GeneID:1756" /db_xref="HGNC:2928" /db_xref="MIM:300377" /translation="
MTEMILLIFFPAYFLNAVRRQKLLEQSIQSAQETEKSLHLIQESLTFIDKQLAAYIADKVDAAQMPQEAQKIQSDLTSHEISLEEMKKHNQGKEAAQRVLSQIDVAQKKLQDVSMKFRLFQKPANFEQRLQESKMILDEVKMHLPALETKSVEQEVVQSQLNHCVNLYKSLSEVKSEVEMVIKTGRQIVQKKQTENPKELDERVTALKLHYNELGAKVTERKQQLEKCLKLSRKMRKEMNVLTEWLAATDMELTKRSAVEGMPSNLDSEVAWGKATQKEIEKQKVHLKSITEVGEALKTVLGKKETLVEDKLSLLNSNWIAVTSRAEEWLNLLLEYQKHMETFDQNVDHITKWIIQADTLLDESEKKKPQQKEDVLKRLKAELNDIRPKVDSTRDQAANLMANRGDHCRKLVEPQISELNHRFAAISHRIKTGKASIPLKELEQFNSDIQKLLEPLEAEIQQGVNLKEEDFNKDMNEDNEGTVKELLQRGDNLQQRITDERKREEIKIKQQLLQTKHNALKDLRSQRRKKALEISHQWYQYKRQADDLLKCLDDIEKKLASLPEPRDERKIKEIDRELQKKKEELNAVRRQAEGLSEDGAAMAVEPTQIQLSKRWREIESKFAQFRRLNFAQIHTVREETMMVMTEDMPLEISYVPSTYLTEITHVSQALLEVEQLLNAPDLCAKDFEDLFKQEESLKNIKDSLQQSSGRIDIIHSKKTAALQSATPVERVKLQEALSQLDFQWEKVNKMYKDRQGRFDRSVEKWRRFHYDIKIFNQWLTEAEQFLRKTQIPENWEHAKYKWYLKELQDGIGQRQTVVRTLNATGEEIIQQSSKTDASILQEKLGSLNLRWQEVCKQLSDRKKRLEEQKNILSEFQRDLNEFVLWLEEADNIASIPLEPGKEQQLKEKLEQVKLLVEELPLRQGILKQLNETGGPVLVSAPISPEEQDKLENKLKQTNLQWIKVSRALPEKQGEIEAQIKDLGQLEKKLEDLEEQLNHLLLWLSPIRNQLEIYNQPNQEGPFDVQETEIAVQAKQPDVEEILSKGQHLYKEKPATQPVKRKLEDLSSEWKAVNRLLQELRAKQPDLAPGLTTIGASPTQTVTLVTQPVVTKETAISKLEMPSSLMLEVPALADFNRAWTELTDWLSLLDQVIKSQRVMVGDLEDINEMIIKQKATMQDLEQRRPQLEELITAAQNLKNKTSNQEARTIITDRIERIQNQWDEVQEHLQNRRQQLNEMLKDSTQWLEAKEEAEQVLGQARAKLESWKEGPYTVDAIQKKITETKQLAKDLRQWQTNVDVANDLALKLLRDYSADDTRKVHMITENINASWRSIHKRVSEREAALEETHRLLQQFPLDLEKFLAWLTEAETTANVLQDATRKERLLEDSKGVKELMKQWQDLQGEIEAHTDVYHNLDENSQKILRSLEGSDDAVLLQRRLDNMNFKWSELRKKSLNIRSHLEASSDQWKRLHLSLQELLVWLQLKDDELSRQAPIGGDFPAVQKQNDVHRAFKRELKTKEPVIMSTLETVRIFLTEQPLEGLEKLYQEPRELPPEERAQNVTRLLRKQAEEVNTEWEKLNLHSADWQRKIDETLERLQELQEATDELDLKLRQAEVIKGSWQPVGDLLIDSLQDHLEKVKALRGEIAPLKENVSHVNDLARQLTTLGIQLSPYNLSTLEDLNTRWKLLQVAVEDRVRQLHEAHRDFGPASQHFLSTSVQGPWERAISPNKVPYYINHETQTTCWDHPKMTELYQSLADLNNVRFSAYRTAMKLRRLQKALCLDLLSLSAACDALDQHNLKQNDQPMDILQIINCLTTIYDRLEQEHNNLVNVPLCVDMCLNWLLNVYDTGRTGRIRVLSFKTGIISLCKAHLEDKYRYLFKQVASSTGFCDQRRLGLLLHDSIQIPRQLGEVASFGGSNIEPSVRSCFQFANNKPEIEAALFLDWMRLEPQSMVWLPVLHRVAAAETAKHQAKCNICKECPIIGFRYRSLKHFNYDICQSCFFSGRVAKGHKMHYPMVEYCTPTTSGEDVRDFAKVLKNKFRTKRYFAKHPRMGYLPVQTVLEGDNMETPVTLINFWPVDSAPASSPQLSHDDTHSRIEHYASRLAEMENSNGSYLNDSISPNESIDDEHLLIQHYCQSLNQDSPLSQPRSPAQILISLESEERGELERILADLEEENRNLQAEYDRLKQQHEHKGLSPLPSPPEMMPTSPQSPRDAELIAEAKLLRQHKGRLEARMQILEDHNKQLESQLHRLRQLLEQPQAEAKVNGTTVSSPSTSLQRSDSSQPMLLRVVGSQTSDSMGEEDLLSPPQDTSTGLEEVMEQLNNSFPSSRGRNTPGKPMREDTM
" misc_feature 46..93 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: dystrophin Dp260-1 unique N-terminus" misc_feature <94..5142 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: central rod domain" misc_feature <94..123 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 9" misc_feature 124..411 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 10" misc_feature 403..726 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 11" misc_feature 421..1050 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 727..1050 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 12" misc_feature 727..744 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 1051..1356 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 13" misc_feature 1132..1959 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Uncharacterized archaeal coiled-coil protein [Function unknown]; Region: COG1340" /db_xref="CDD:31531" misc_feature 1357..1644 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 14" misc_feature 1360..1926 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 1645..1941 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 15" misc_feature 1648..1665 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 1996..2325 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 16" misc_feature 2020..2646 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 2326..2646 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 17" misc_feature 2326..2343 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 2335..2982 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 2647..2976 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 18" misc_feature order(2647..2655,2659..2667) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 2977..3291 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 19" misc_feature 3292..3432 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: hinge region 3" misc_feature 3433..3753 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 20" misc_feature 3436..4086 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 3754..4080 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 21" misc_feature 3754..3771 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 4081..4428 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 22" misc_feature 4090..4821 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 4429..4815 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 23" misc_feature 4429..4446 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 4816..5142 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: repeat region 24" misc_feature 4825..>5157 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 5062..5358 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: hinge region 4" misc_feature 5143..5157 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 5188..5298 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: WW-domain" misc_feature 5197..5286 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Two conserved tryptophans domain; also known as the WWP or rsp5 domain; around 40 amino acids; functions as an interaction module in a diverse set of signalling proteins; binds specific proline-rich sequences but at low affinities compared to other...; Region: WW; cd00201" /db_xref="CDD:29258" misc_feature order(5236..5238,5269..5271) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="binding pocket" /db_xref="CDD:29258" misc_feature 5260..6246 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="dystroglycan binding site" misc_feature 5320..5922 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: Cysteine-rich domain" misc_feature 5410..5493 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: EF-hand 1" misc_feature 5554..5640 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: EF-hand 2" misc_feature 5920..7077 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: Carboxy-terminal region" misc_feature 5941..6084 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: ZZ-domain" misc_feature 5953..6099 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Zinc finger, ZZ type. Zinc finger present in dystrophin and dystrobrevin. The ZZ motif coordinates two zinc ions and most likely participates in ligand binding or molecular scaffolding. Dystrophin attaches actin filaments to an integral membrane...; Region: ZZ_dystrophin; cd02334" /db_xref="CDD:30238" misc_feature order(5959..5961,5968..5970,6004..6006,6013..6015, 6031..6033,6040..6042,6070..6072,6082..6084) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Zinc-binding sites [ion binding]; other site" /db_xref="CDD:30238" misc_feature order(5959..5961,5968..5970,6031..6033,6040..6042) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="zinc cluster 1 [ion binding]; other site" /db_xref="CDD:30238" misc_feature order(5962..5964,5995..5997,6001..6003,6019..6021, 6025..6027) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="putative charged binding surface; other site" /db_xref="CDD:30238" misc_feature order(5998..6000,6043..6045,6088..6090,6097..6099) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="putative hydrophobic binding surface; other site" /db_xref="CDD:30238" misc_feature order(6004..6006,6013..6015,6070..6072,6082..6084) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="zinc cluster 2 [ion binding]; other site" /db_xref="CDD:30238" misc_feature 6352..6504 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="alpha1-syntrophin binding site" misc_feature 6505..6627 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="beta1-syntrophin binding site" misc_feature 6694..6801 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Region: (Leu)6-heptad repeat" variation 153 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:1800263" variation 297 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:72468647" variation 428 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="t" /db_xref="dbSNP:1057872" variation 551 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:72468638" STS 554..666 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99582" variation 899 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="t" /db_xref="dbSNP:72468634" variation 999 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:1801185" variation 1062 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:72468632" variation 1185 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="g" /db_xref="dbSNP:72468630" variation 1256 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1801187" STS 1433..1990 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="MARC_84357-84358:1278016549:1" /db_xref="UniSTS:532591" variation 1481 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1800271" variation 1552 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:1064325" variation 1554 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:1801186" STS 1658..1752 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99541" variation 1797 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1800272" variation 2050 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="g" /replace="t" /db_xref="dbSNP:72468613" STS 2314..2438 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99225" variation 2485 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:1800273" STS 2688..2770 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99066" variation 2850 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:72466595" variation 3102 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1800274" variation 3118 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:1800275" variation 3205 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:72466590" STS 3386..3497 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DXS7499" /db_xref="UniSTS:30753" variation 3750 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:1801188" variation 3842 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="t" /db_xref="dbSNP:72466581" STS 3907..4042 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99382" variation 4077 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1801189" STS 4249..4348 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99545" variation 4344 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:72466575" variation 4518 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:72466574" variation 4593 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:72466570" variation 4601 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:72466569" variation 4832 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1800280" STS 4843..4945 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99400" variation 4874 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:72466567" variation 5115 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:72466563" variation 5116 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:72466562" STS 5594..5661 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99128" variation 6642 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:72466538" variation 6811 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:1800281" variation 7040 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1795743" STS 7162..7355 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="PMC316713P2" /db_xref="UniSTS:273040" STS 7430..7618 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="G15848" /db_xref="UniSTS:3168" STS 7471..7603 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DXS1234" /db_xref="UniSTS:146800" variation 7560..7561 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="acac" /replace="taca" /db_xref="dbSNP:3833413" variation 8004 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="acaa" /db_xref="dbSNP:72466531" variation 8048 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="t" /db_xref="dbSNP:72466530" STS 8086..8154 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DXS503" /db_xref="UniSTS:99031" variation 8128 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="gat" /db_xref="dbSNP:72466529" variation 8325 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="cttt" /db_xref="dbSNP:72466527" STS 8392..8542 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DXS6988E" /db_xref="UniSTS:32060" variation 8527 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:3361" STS 8548..8648 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="A002S20" /db_xref="UniSTS:57879" variation 8645 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="aaag" /db_xref="dbSNP:72466526" variation 8671 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="tgtt" /db_xref="dbSNP:72466525" variation 8811 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:3198427" variation 8838 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="ttcat" /db_xref="dbSNP:72466524" variation 9119 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:72466523" variation 9233 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="atgtgacgctggacctt" /db_xref="dbSNP:72466522" variation 9265 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="t" /db_xref="dbSNP:11550191" variation 9317 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="aagt" /db_xref="dbSNP:72466521" STS 9398..9589 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:506537" variation 9507 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1057915" STS 9655..9739 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="PMC108984P1" /db_xref="UniSTS:270148" variation 9661 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="actt" /db_xref="dbSNP:72466520" polyA_signal 9749..9754 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" polyA_site 9771 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" ORIGIN
taatgagatcaggaggaacattcgacctgagaaagacagattgcaatgactgagatgattttgctaattttttttccagcctatttccttaatgctgtaaggaggcaaaagttgcttgaacagagcatccagtctgcccaggagactgaaaaatccttacacttaatccaggagtccctcacattcattgacaagcagttggcagcttatattgcagacaaggtggacgcagctcaaatgcctcaggaagcccagaaaatccaatctgatttgacaagtcatgagatcagtttagaagaaatgaagaaacataatcaggggaaggaggctgcccaaagagtcctgtctcagattgatgttgcacagaaaaaattacaagatgtctccatgaagtttcgattattccagaaaccagccaattttgagcagcgtctacaagaaagtaagatgattttagatgaagtgaagatgcacttgcctgcattggaaacaaagagtgtggaacaggaagtagtacagtcacagctaaatcattgtgtgaacttgtataaaagtctgagtgaagtgaagtctgaagtggaaatggtgataaagactggacgtcagattgtacagaaaaagcagacggaaaatcccaaagaacttgatgaaagagtaacagctttgaaattgcattataatgagctgggagcaaaggtaacagaaagaaagcaacagttggagaaatgcttgaaattgtcccgtaagatgcgaaaggaaatgaatgtcttgacagaatggctggcagctacagatatggaattgacaaagagatcagcagttgaaggaatgcctagtaatttggattctgaagttgcctggggaaaggctactcaaaaagagattgagaaacagaaggtgcacctgaagagtatcacagaggtaggagaggccttgaaaacagttttgggcaagaaggagacgttggtggaagataaactcagtcttctgaatagtaactggatagctgtcacctcccgagcagaagagtggttaaatcttttgttggaataccagaaacacatggaaacttttgaccagaatgtggaccacatcacaaagtggatcattcaggctgacacacttttggatgaatcagagaaaaagaaaccccagcaaaaagaagacgtgcttaagcgtttaaaggcagaactgaatgacatacgcccaaaggtggactctacacgtgaccaagcagcaaacttgatggcaaaccgcggtgaccactgcaggaaattagtagagccccaaatctcagagctcaaccatcgatttgcagccatttcacacagaattaagactggaaaggcctccattcctttgaaggaattggagcagtttaactcagatatacaaaaattgcttgaaccactggaggctgaaattcagcagggggtgaatctgaaagaggaagacttcaataaagatatgaatgaagacaatgagggtactgtaaaagaattgttgcaaagaggagacaacttacaacaaagaatcacagatgagagaaagcgagaggaaataaagataaaacagcagctgttacagacaaaacataatgctctcaaggatttgaggtctcaaagaagaaaaaaggctctagaaatttctcatcagtggtatcagtacaagaggcaggctgatgatctcctgaaatgcttggatgacattgaaaaaaaattagccagcctacctgagcccagagatgaaaggaaaataaaggaaattgatcgggaattgcagaagaagaaagaggagctgaatgcagtgcgtaggcaagctgagggcttgtctgaggatggggccgcaatggcagtggagccaactcagatccagctcagcaagcgctggcgggaaattgagagcaaatttgctcagtttcgaagactcaactttgcacaaattcacactgtccgtgaagaaacgatgatggtgatgactgaagacatgcctttggaaatttcttatgtgccttctacttatttgactgaaatcactcatgtctcacaagccctattagaagtggaacaacttctcaatgctcctgacctctgtgctaaggactttgaagatctctttaagcaagaggagtctctgaagaatataaaagatagtctacaacaaagctcaggtcggattgacattattcatagcaagaagacagcagcattgcaaagtgcaacgcctgtggaaagggtgaagctacaggaagctctctcccagcttgatttccaatgggaaaaagttaacaaaatgtacaaggaccgacaagggcgatttgacagatctgttgagaaatggcggcgttttcattatgatataaagatatttaatcagtggctaacagaagctgaacagtttctcagaaagacacaaattcctgagaattgggaacatgctaaatacaaatggtatcttaaggaactccaggatggcattgggcagcggcaaactgttgtcagaacattgaatgcaactggggaagaaataattcagcaatcctcaaaaacagatgccagtattctacaggaaaaattgggaagcctgaatctgcggtggcaggaggtctgcaaacagctgtcagacagaaaaaagaggctagaagaacaaaagaatatcttgtcagaatttcaaagagatttaaatgaatttgttttatggttggaggaagcagataacattgctagtatcccacttgaacctggaaaagagcagcaactaaaagaaaagcttgagcaagtcaagttactggtggaagagttgcccctgcgccagggaattctcaaacaattaaatgaaactggaggacccgtgcttgtaagtgctcccataagcccagaagagcaagataaacttgaaaataagctcaagcagacaaatctccagtggataaaggtttccagagctttacctgagaaacaaggagaaattgaagctcaaataaaagaccttgggcagcttgaaaaaaagcttgaagaccttgaagagcagttaaatcatctgctgctgtggttatctcctattaggaatcagttggaaatttataaccaaccaaaccaagaaggaccatttgacgttcaggaaactgaaatagcagttcaagctaaacaaccggatgtggaagagattttgtctaaagggcagcatttgtacaaggaaaaaccagccactcagccagtgaagaggaagttagaagatctgagctctgagtggaaggcggtaaaccgtttacttcaagagctgagggcaaagcagcctgacctagctcctggactgaccactattggagcctctcctactcagactgttactctggtgacacaacctgtggttactaaggaaactgccatctccaaactagaaatgccatcttccttgatgttggaggtacctgctctggcagatttcaaccgggcttggacagaacttaccgactggctttctctgcttgatcaagttataaaatcacagagggtgatggtgggtgaccttgaggatatcaacgagatgatcatcaagcagaaggcaacaatgcaggatttggaacagaggcgtccccagttggaagaactcattaccgctgcccaaaatttgaaaaacaagaccagcaatcaagaggctagaacaatcattacggatcgaattgaaagaattcagaatcagtgggatgaagtacaagaacaccttcagaaccggaggcaacagttgaatgaaatgttaaaggattcaacacaatggctggaagctaaggaagaagctgagcaggtcttaggacaggccagagccaagcttgagtcatggaaggagggtccctatacagtagatgcaatccaaaagaaaatcacagaaaccaagcagttggccaaagacctccgccagtggcagacaaatgtagatgtggcaaatgacttggccctgaaacttctccgggattattctgcagatgataccagaaaagtccacatgataacagagaatatcaatgcctcttggagaagcattcataaaagggtgagtgagcgagaggctgctttggaagaaactcatagattactgcaacagttccccctggacctggaaaagtttcttgcctggcttacagaagctgaaacaactgccaatgtcctacaggatgctacccgtaaggaaaggctcctagaagactccaagggagtaaaagagctgatgaaacaatggcaagacctccaaggtgaaattgaagctcacacagatgtttatcacaacctggatgaaaacagccaaaaaatcctgagatccctggaaggttccgatgatgcagtcctgttacaaagacgtttggataacatgaacttcaagtggagtgaacttcggaaaaagtctctcaacattaggtcccatttggaagccagttctgaccagtggaagcgtctgcacctttctctgcaggaacttctggtgtggctacagctgaaagatgatgaattaagccggcaggcacctattggaggcgactttccagcagttcagaagcagaacgatgtacatagggccttcaagagggaattgaaaactaaagaacctgtaatcatgagtactcttgagactgtacgaatatttctgacagagcagcctttggaaggactagagaaactctaccaggagcccagagagctgcctcctgaggagagagcccagaatgtcactcggcttctacgaaagcaggctgaggaggtcaatactgagtgggaaaaattgaacctgcactccgctgactggcagagaaaaatagatgagacccttgaaagactccaggaacttcaagaggccacggatgagctggacctcaagctgcgccaagctgaggtgatcaagggatcctggcagcccgtgggcgatctcctcattgactctctccaagatcacctcgagaaagtcaaggcacttcgaggagaaattgcgcctctgaaagagaacgtgagccacgtcaatgaccttgctcgccagcttaccactttgggcattcagctctcaccgtataacctcagcactctggaagacctgaacaccagatggaagcttctgcaggtggccgtcgaggaccgagtcaggcagctgcatgaagcccacagggactttggtccagcatctcagcactttctttccacgtctgtccagggtccctgggagagagccatctcgccaaacaaagtgccctactatatcaaccacgagactcaaacaacttgctgggaccatcccaaaatgacagagctctaccagtctttagctgacctgaataatgtcagattctcagcttataggactgccatgaaactccgaagactgcagaaggccctttgcttggatctcttgagcctgtcagctgcatgtgatgccttggaccagcacaacctcaagcaaaatgaccagcccatggatatcctgcagattattaattgtttgaccactatttatgaccgcctggagcaagagcacaacaatttggtcaacgtccctctctgcgtggatatgtgtctgaactggctgctgaatgtttatgatacgggacgaacagggaggatccgtgtcctgtcttttaaaactggcatcatttccctgtgtaaagcacatttggaagacaagtacagataccttttcaagcaagtggcaagttcaacaggattttgtgaccagcgcaggctgggcctccttctgcatgattctatccaaattccaagacagttgggtgaagttgcatcctttgggggcagtaacattgagccaagtgtccggagctgcttccaatttgctaataataagccagagatcgaagcggccctcttcctagactggatgagactggaaccccagtccatggtgtggctgcccgtcctgcacagagtggctgctgcagaaactgccaagcatcaggccaaatgtaacatctgcaaagagtgtccaatcattggattcaggtacaggagtctaaagcactttaattatgacatctgccaaagctgctttttttctggtcgagttgcaaaaggccataaaatgcactatcccatggtggaatattgcactccgactacatcaggagaagatgttcgagactttgccaaggtactaaaaaacaaatttcgaaccaaaaggtattttgcgaagcatccccgaatgggctacctgccagtgcagactgtcttagagggggacaacatggaaactcccgttactctgatcaacttctggccagtagattctgcgcctgcctcgtcccctcagctttcacacgatgatactcattcacgcattgaacattatgctagcaggctagcagaaatggaaaacagcaatggatcttatctaaatgatagcatctctcctaatgagagcatagatgatgaacatttgttaatccagcattactgccaaagtttgaaccaggactcccccctgagccagcctcgtagtcctgcccagatcttgatttccttagagagtgaggaaagaggggagctagagagaatcctagcagatcttgaggaagaaaacaggaatctgcaagcagaatatgaccgtctaaagcagcagcacgaacataaaggcctgtccccactgccgtcccctcctgaaatgatgcccacctctccccagagtccccgggatgctgagctcattgctgaggccaagctactgcgtcaacacaaaggccgcctggaagccaggatgcaaatcctggaagaccacaataaacagctggagtcacagttacacaggctaaggcagctgctggagcaaccccaggcagaggccaaagtgaatggcacaacggtgtcctctccttctacctctctacagaggtccgacagcagtcagcctatgctgctccgagtggttggcagtcaaacttcggactccatgggtgaggaagatcttctcagtcctccccaggacacaagcacagggttagaggaggtgatggagcaactcaacaactccttccctagttcaagaggaagaaatacccctggaaagccaatgagagaggacacaatgtaggaagtcttttccacatggcagatgatttgggcagagcgatggagtccttagtatcagtcatgacagatgaagaaggagcagaataaatgttttacaactcctgattcccgcatggtttttataatattcatacaacaaagaggattagacagtaagagtttacaagaaataaatctatatttttgtgaagggtagtggtattatactgtagatttcagtagtttctaagtctgttattgttttgttaacaatggcaggttttacacgtctatgcaattgtacaaaaaagttataagaaaactacatgtaaaatcttgatagctaaataacttgccatttctttatatggaacgcattttgggttgtttaaaaatttataacagttataaagaaagattgtaaactaaagtgtgctttataaaaaaaagttgtttataaaaacccctaaaaacaaaacaaacacacacacacacacatacacacacacacacaaaactttgaggcagcgcattgttttgcatccttttggcgtgatatccatatgaaattcatggctttttctttttttgcatattaaagataagacttcctctaccaccacaccaaatgactactacacactgctcatttgagaactgtcagctgagtggggcaggcttgagttttcatttcatatatctatatgtctataagtatataaatactatagttatatagataaagagatacgaatttctatagactgactttttccattttttaaatgttcatgtcacatcctaatagaaagaaattacttctagtcagtcatccaggcttacctgcttggtctagaatggatttttcccggagccggaagccaggaggaaactacaccacactaaaacattgtctacagctccagatgtttctcattttaaacaactttccactgacaacgaaagtaaagtaaagtattggatttttttaaagggaacatgtgaatgaatacacaggacttattatatcagagtgagtaatcggttggttggttgattgattgattgattgatacattcagcttcctgctgctagcaatgccacgatttagatttaatgatgcttcagtggaaatcaatcagaaggtattctgaccttgtgaacatcagaaggtattttttaactcccaagcagtagcaggacgatgatagggctggagggctatggattcccagcccatccctgtgaaggagtaggccactctttaagtgaaggattggatgattgttcataatacataaagttctctgtaattacaactaaattattatgccctcttctcacagtcaaaaggaactgggtggtttggtttttgttgcttttttagatttattgtcccatgtgggatgagtttttaaatgccacaagacataatttaaaataaataaactttgggaaaaggtgtaaaacagtagccccatcacatttgtgatactgacaggtatcaacccagaagcccatgaactgtgtttccatcctttgcatttctctgcgagtagttccacacaggtttgtaagtaagtaagaaagaaggcaaattgattcaaatgttacaaaaaaacccttcttggtggattagacaggttaaatatataaacaaacaaacaaaaattgctcaaaaaagaggagaaaagctcaagaggaaaagctaaggactggtaggaaaaagctttactctttcatgccattttatttctttttgatttttaaatcattcattcaatagataccaccgtgtgacctataattttgcaaatctgttacctctgacatcaagtgtaattagcttttggagagtgggctgacatcaagtgtaattagcttttggagagtgggttttgtccattattaataattaattaattaacatcaaacacggcttctcatgctatttctacctcactttggttttggggtgttcctgataattgtgcacacctgagttcacagcttcaccacttgtccattgcgttattttctttttcctttataattctttctttttccttcataattttcaaaagaaaacccaaagctctaaggtaacaaattaccaaattacatgaagatttggtttttgtcttgcatttttttcctttatgtgacgctggaccttttctttacccaaggatttttaaaactcagatttaaaacaaggggttactttacatcctactaagaagtttaagtaagtaagtttcattctaaaatcagaggtaaatagagtgcataaataattttgttttaatctttttgtttttcttttagacacattagctctggagtgagtctgtcataatatttgaacaaaaattgagagctttattgctgcattttaagcataattaatttggacattatttcgtgttgtgttctttataaccaccaagtattaaactgtaaatcataatgtaactgaagcataaacatcacatggcatgttttgtcattgttttcaggtactgagttcttacttgagtatcataatatattgtgttttaacaccaacactgtaacatttacgaattatttttttaaacttcagttttactgcattttcacaacatatcagacttcaccaaatatatgccttactattgtattatagtactgctttactgtgtatctcaataaagcacgcagttatgttac
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:1756 -> Molecular function: GO:0002162 [dystroglycan binding] evidence: IPI GeneID:1756 -> Molecular function: GO:0003779 [actin binding] evidence: IDA GeneID:1756 -> Molecular function: GO:0003779 [actin binding] evidence: TAS GeneID:1756 -> Molecular function: GO:0005200 [structural constituent of cytoskeleton] evidence: TAS GeneID:1756 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA GeneID:1756 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:1756 -> Molecular function: GO:0008270 [zinc ion binding] evidence: IEA GeneID:1756 -> Molecular function: GO:0008307 [structural constituent of muscle] evidence: IDA GeneID:1756 -> Molecular function: GO:0008307 [structural constituent of muscle] evidence: TAS GeneID:1756 -> Molecular function: GO:0017022 [myosin binding] evidence: IDA GeneID:1756 -> Molecular function: GO:0017166 [vinculin binding] evidence: IPI GeneID:1756 -> Molecular function: GO:0050998 [nitric-oxide synthase binding] evidence: ISS GeneID:1756 -> Biological process: GO:0001954 [positive regulation of cell-matrix adhesion] evidence: IEA GeneID:1756 -> Biological process: GO:0002027 [regulation of heart rate] evidence: IMP GeneID:1756 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: IEA GeneID:1756 -> Biological process: GO:0007517 [muscle organ development] evidence: NAS GeneID:1756 -> Biological process: GO:0008065 [establishment of blood-nerve barrier] evidence: IEA GeneID:1756 -> Biological process: GO:0010880 [regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum] evidence: ISS GeneID:1756 -> Biological process: GO:0010881 [regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion] evidence: ISS GeneID:1756 -> Biological process: GO:0010976 [positive regulation of neuron projection development] evidence: IMP GeneID:1756 -> Biological process: GO:0014809 [regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion] evidence: ISS GeneID:1756 -> Biological process: GO:0014819 [regulation of skeletal muscle contraction] evidence: ISS GeneID:1756 -> Biological process: GO:0014904 [myotube cell development] evidence: IEA GeneID:1756 -> Biological process: GO:0021629 [olfactory nerve structural organization] evidence: IEA GeneID:1756 -> Biological process: GO:0030049 [muscle filament sliding] evidence: TAS GeneID:1756 -> Biological process: GO:0030198 [extracellular matrix organization] evidence: TAS GeneID:1756 -> Biological process: GO:0033137 [negative regulation of peptidyl-serine phosphorylation] evidence: ISS GeneID:1756 -> Biological process: GO:0034613 [cellular protein localization] evidence: IMP GeneID:1756 -> Biological process: GO:0043043 [peptide biosynthetic process] evidence: IDA GeneID:1756 -> Biological process: GO:0043623 [cellular protein complex assembly] evidence: ISS GeneID:1756 -> Biological process: GO:0044458 [motile cilium assembly] evidence: TAS GeneID:1756 -> Biological process: GO:0045213 [neurotransmitter receptor metabolic process] evidence: IEA GeneID:1756 -> Biological process: GO:0045666 [positive regulation of neuron differentiation] evidence: IMP GeneID:1756 -> Biological process: GO:0046716 [muscle cell homeostasis] evidence: IEA GeneID:1756 -> Biological process: GO:0048747 [muscle fiber development] evidence: IEA GeneID:1756 -> Biological process: GO:0051647 [nucleus localization] evidence: IEA GeneID:1756 -> Biological process: GO:0060048 [cardiac muscle contraction] evidence: IMP GeneID:1756 -> Biological process: GO:0060314 [regulation of ryanodine-sensitive calcium-release channel activity] evidence: ISS GeneID:1756 -> Biological process: GO:0060857 [establishment of glial blood-brain barrier] evidence: IEA GeneID:1756 -> Biological process: GO:0086001 [regulation of cardiac muscle cell action potential] evidence: ISS GeneID:1756 -> Biological process: GO:0090287 [regulation of cellular response to growth factor stimulus] evidence: IMP GeneID:1756 -> Biological process: GO:1901385 [regulation of voltage-gated calcium channel activity] evidence: ISS GeneID:1756 -> Biological process: GO:2000169 [regulation of peptidyl-cysteine S-nitrosylation] evidence: ISS GeneID:1756 -> Biological process: GO:2000651 [positive regulation of sodium ion transmembrane transporter activity] evidence: ISS GeneID:1756 -> Cellular component: GO:0005634 [nucleus] evidence: IDA GeneID:1756 -> Cellular component: GO:0005634 [nucleus] evidence: TAS GeneID:1756 -> Cellular component: GO:0005829 [cytosol] evidence: TAS GeneID:1756 -> Cellular component: GO:0005856 [cytoskeleton] evidence: IEA GeneID:1756 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA GeneID:1756 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS GeneID:1756 -> Cellular component: GO:0009986 [cell surface] evidence: IDA GeneID:1756 -> Cellular component: GO:0015629 [actin cytoskeleton] evidence: TAS GeneID:1756 -> Cellular component: GO:0016010 [dystrophin-associated glycoprotein complex] evidence: IDA GeneID:1756 -> Cellular component: GO:0016010 [dystrophin-associated glycoprotein complex] evidence: NAS GeneID:1756 -> Cellular component: GO:0016010 [dystrophin-associated glycoprotein complex] evidence: TAS GeneID:1756 -> Cellular component: GO:0030018 [Z disc] evidence: IEA GeneID:1756 -> Cellular component: GO:0030055 [cell-substrate junction] evidence: IEA GeneID:1756 -> Cellular component: GO:0030175 [filopodium] evidence: IDA GeneID:1756 -> Cellular component: GO:0042383 [sarcolemma] evidence: IDA GeneID:1756 -> Cellular component: GO:0043034 [costamere] evidence: IDA GeneID:1756 -> Cellular component: GO:0043234 [protein complex] evidence: IDA GeneID:1756 -> Cellular component: GO:0044306 [neuron projection terminus] evidence: IEA GeneID:1756 -> Cellular component: GO:0045121 [membrane raft] evidence: IEA GeneID:1756 -> Cellular component: GO:0045121 [membrane raft] evidence: TAS GeneID:1756 -> Cellular component: GO:0045211 [postsynaptic membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.