2024-03-28 19:57:10, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_004010 14083 bp mRNA linear PRI 26-MAY-2013 DEFINITION Homo sapiens dystrophin (DMD), transcript variant Dp427p2, mRNA. ACCESSION NM_004010 VERSION NM_004010.3 GI:238018047 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 14083) AUTHORS Suzuki,H., Kameyama,T., Ohe,K., Tsukahara,T. and Mayeda,A. TITLE Nested introns in an intron: evidence of multi-step splicing in a large intron of the human dystrophin pre-mRNA JOURNAL FEBS Lett. 587 (6), 555-561 (2013) PUBMED 23395799 REMARK GeneRIF: The evidence obtained for multi-step splicing in a large intron of the human dystrophin pre-mRNA. REFERENCE 2 (bases 1 to 14083) AUTHORS Singh,S.M. and Mallela,K.M. TITLE The N-terminal actin-binding tandem calponin-homology (CH) domain of dystrophin is in a closed conformation in solution and when bound to F-actin JOURNAL Biophys. J. 103 (9), 1970-1978 (2012) PUBMED 23199925 REMARK GeneRIF: In solution, dystrophin N-terminal actin-binding domain binds to F-actin in a closed conformation. REFERENCE 3 (bases 1 to 14083) AUTHORS Bovolenta,M., Erriquez,D., Valli,E., Brioschi,S., Scotton,C., Neri,M., Falzarano,M.S., Gherardi,S., Fabris,M., Rimessi,P., Gualandi,F., Perini,G. and Ferlini,A. TITLE The DMD locus harbours multiple long non-coding RNAs which orchestrate and control transcription of muscle dystrophin mRNA isoforms JOURNAL PLoS ONE 7 (9), E45328 (2012) PUBMED 23028937 REMARK GeneRIF: Findings reveal that DMD lncRNAs may contribute to the orchestration and homeostasis of the muscle dystrophin expression pattern by either selective targeting and down-modulating the dystrophin promoter transcriptional activity. REFERENCE 4 (bases 1 to 14083) AUTHORS Brioschi,S., Gualandi,F., Scotton,C., Armaroli,A., Bovolenta,M., Falzarano,M.S., Sabatelli,P., Selvatici,R., D'Amico,A., Pane,M., Ricci,G., Siciliano,G., Tedeschi,S., Pini,A., Vercelli,L., De Grandis,D., Mercuri,E., Bertini,E., Merlini,L., Mongini,T. and Ferlini,A. TITLE Genetic characterization in symptomatic female DMD carriers: lack of relationship between X-inactivation, transcriptional DMD allele balancing and phenotype JOURNAL BMC Med. Genet. 13, 73 (2012) PUBMED 22894145 REMARK GeneRIF: No relationship between X-inactivation pattern and transcriptional behaviour of DMD gene was observed in Duchenne muscular dystrophies. Publication Status: Online-Only REFERENCE 5 (bases 1 to 14083) AUTHORS Kapoor,S., Bindu,P.S., Taly,A.B., Sinha,S., Gayathri,N., Rani,S.V., Chandak,G.R. and Kumar,A. TITLE Genetic analysis of an Indian family with members affected with Waardenburg syndrome and Duchenne muscular dystrophy JOURNAL Mol. Vis. 18, 2022-2032 (2012) PUBMED 22876130 REMARK GeneRIF: A novel missense mutation in EDN3 and a deletion mutation in DMD has been found in the same Indian family members affected with Waardenburg syndrome and Duchenne muscular dystrophy. REFERENCE 6 (bases 1 to 14083) AUTHORS Nigro,V., Politano,L., Nigro,G., Romano,S.C., Molinari,A.M. and Puca,G.A. TITLE Detection of a nonsense mutation in the dystrophin gene by multiple SSCP JOURNAL Hum. Mol. Genet. 1 (7), 517-520 (1992) PUBMED 1307253 REFERENCE 7 (bases 1 to 14083) AUTHORS Gorecki,D.C., Monaco,A.P., Derry,J.M., Walker,A.P., Barnard,E.A. and Barnard,P.J. TITLE Expression of four alternative dystrophin transcripts in brain regions regulated by different promoters JOURNAL Hum. Mol. Genet. 1 (7), 505-510 (1992) PUBMED 1307251 REFERENCE 8 (bases 1 to 14083) AUTHORS Lederfein,D., Levy,Z., Augier,N., Mornet,D., Morris,G., Fuchs,O., Yaffe,D. and Nudel,U. TITLE A 71-kilodalton protein is a major product of the Duchenne muscular dystrophy gene in brain and other nonmuscle tissues JOURNAL Proc. Natl. Acad. Sci. U.S.A. 89 (12), 5346-5350 (1992) PUBMED 1319059 REFERENCE 9 (bases 1 to 14083) AUTHORS Rapaport,D., Lederfein,D., den Dunnen,J.T., Grootscholten,P.M., Van Ommen,G.J., Fuchs,O., Nudel,U. and Yaffe,D. TITLE Characterization and cell type distribution of a novel, major transcript of the Duchenne muscular dystrophy gene JOURNAL Differentiation 49 (3), 187-193 (1992) PUBMED 1377655 REFERENCE 10 (bases 1 to 14083) AUTHORS Koenig,M., Monaco,A.P. and Kunkel,L.M. TITLE The complete sequence of dystrophin predicts a rod-shaped cytoskeletal protein JOURNAL Cell 53 (2), 219-228 (1988) PUBMED 3282674 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL049643.12, S64152.1, M18533.1, AL109609.5 and BC028720.1. On May 24, 2009 this sequence version replaced gi:150036264. Summary: The dystrophin gene is the largest gene found in nature, measuring 2.4 Mb. The gene was identified through a positional cloning approach, targeted at the isolation of the gene responsible for Duchenne (DMD) and Becker (BMD) Muscular Dystrophies. DMD is a recessive, fatal, X-linked disorder occurring at a frequency of about 1 in 3,500 new-born males. BMD is a milder allelic form. In general, DMD patients carry mutations which cause premature translation termination (nonsense or frame shift mutations), while in BMD patients dystrophin is reduced either in molecular weight (derived from in-frame deletions) or in expression level. The dystrophin gene is highly complex, containing at least eight independent, tissue-specific promoters and two polyA-addition sites. Furthermore, dystrophin RNA is differentially spliced, producing a range of different transcripts, encoding a large set of protein isoforms. Dystrophin (as encoded by the Dp427 transcripts) is a large, rod-like cytoskeletal protein which is found at the inner surface of muscle fibers. Dystrophin is part of the dystrophin-glycoprotein complex (DGC), which bridges the inner cytoskeleton (F-actin) and the extra-cellular matrix. [provided by RefSeq, Jul 2008]. Transcript Variant: transcript Dp427p2 has an additional 82 nt directly after exon 1 which introduces a translational stop codon 24 bp downstream of the same ATG codon included in the Dp427p1 transcript. This transcript has unknown coding capacity. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## RNAseq introns :: mixed/partial sample support ERS025081, ERS025082 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: full length. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-365 AL049643.12 55870-56234 c 366-412 S64152.1 274-320 413-4739 M18533.1 287-4613 4740-4740 AL109609.5 79506-79506 c 4741-5863 M18533.1 4615-5737 5864-5864 AL109609.5 35892-35892 c 5865-12838 M18533.1 5739-12712 12839-14083 BC028720.1 3398-4642 FEATURES Location/Qualifiers source 1..14083 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="X" /map="Xp21.2" gene 1..14083 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="dystrophin" /db_xref="GeneID:1756" /db_xref="HGNC:2928" /db_xref="HPRD:02303" /db_xref="MIM:300377" variation 44 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:72470539" variation 176 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:72470538" misc_feature 287..289 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="upstream in-frame stop codon" CDS 704..11392 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Dp427p2 isoform is encoded by transcript variant Dp427p2" /codon_start=1 /product="dystrophin Dp427p2 isoform" /protein_id="NP_004001.1" /db_xref="GI:5032315" /db_xref="GeneID:1756" /db_xref="HGNC:2928" /db_xref="HPRD:02303" /db_xref="MIM:300377" /translation="
MKNIMAGLQQTNSEKILLSWVRQSTRNYPQVNVINFTTSWSDGLALNALIHSHRPDLFDWNSVVCQQSATQRLEHAFNIARYQLGIEKLLDPEDVDTTYPDKKSILMYITSLFQVLPQQVSIEAIQEVEMLPRPPKVTKEEHFQLHHQMHYSQQITVSLAQGYERTSSPKPRFKSYAYTQAAYVTTSDPTRSPFPSQHLEAPEDKSFGSSLMESEVNLDRYQTALEEVLSWLLSAEDTLQAQGEISNDVEVVKDQFHTHEGYMMDLTAHQGRVGNILQLGSKLIGTGKLSEDEETEVQEQMNLLNSRWECLRVASMEKQSNLHRVLMDLQNQKLKELNDWLTKTEERTRKMEEEPLGPDLEDLKRQVQQHKVLQEDLEQEQVRVNSLTHMVVVVDESSGDHATAALEEQLKVLGDRWANICRWTEDRWVLLQDILLKWQRLTEEQCLFSAWLSEKEDAVNKIHTTGFKDQNEMLSSLQKLAVLKADLEKKKQSMGKLYSLKQDLLSTLKNKSVTQKTEAWLDNFARCWDNLVQKLEKSTAQISQAVTTTQPSLTQTTVMETVTTVTTREQILVKHAQEELPPPPPQKKRQITVDSEIRKRLDVDITELHSWITRSEAVLQSPEFAIFRKEGNFSDLKEKVNAIEREKAEKFRKLQDASRSAQALVEQMVNEGVNADSIKQASEQLNSRWIEFCQLLSERLNWLEYQNNIIAFYNQLQQLEQMTTTAENWLKIQPTTPSEPTAIKSQLKICKDEVNRLSGLQPQIERLKIQSIALKEKGQGPMFLDADFVAFTNHFKQVFSDVQAREKELQTIFDTLPPMRYQETMSAIRTWVQQSETKLSIPQLSVTDYEIMEQRLGELQALQSSLQEQQSGLYYLSTTVKEMSKKAPSEISRKYQSEFEEIEGRWKKLSSQLVEHCQKLEEQMNKLRKIQNHIQTLKKWMAEVDVFLKEEWPALGDSEILKKQLKQCRLLVSDIQTIQPSLNSVNEGGQKIKNEAEPEFASRLETELKELNTQWDHMCQQVYARKEALKGGLEKTVSLQKDLSEMHEWMTQAEEEYLERDFEYKTPDELQKAVEEMKRAKEEAQQKEAKVKLLTESVNSVIAQAPPVAQEALKKELETLTTNYQWLCTRLNGKCKTLEEVWACWHELLSYLEKANKWLNEVEFKLKTTENIPGGAEEISEVLDSLENLMRHSEDNPNQIRILAQTLTDGGVMDELINEELETFNSRWRELHEEAVRRQKLLEQSIQSAQETEKSLHLIQESLTFIDKQLAAYIADKVDAAQMPQEAQKIQSDLTSHEISLEEMKKHNQGKEAAQRVLSQIDVAQKKLQDVSMKFRLFQKPANFEQRLQESKMILDEVKMHLPALETKSVEQEVVQSQLNHCVNLYKSLSEVKSEVEMVIKTGRQIVQKKQTENPKELDERVTALKLHYNELGAKVTERKQQLEKCLKLSRKMRKEMNVLTEWLAATDMELTKRSAVEGMPSNLDSEVAWGKATQKEIEKQKVHLKSITEVGEALKTVLGKKETLVEDKLSLLNSNWIAVTSRAEEWLNLLLEYQKHMETFDQNVDHITKWIIQADTLLDESEKKKPQQKEDVLKRLKAELNDIRPKVDSTRDQAANLMANRGDHCRKLVEPQISELNHRFAAISHRIKTGKASIPLKELEQFNSDIQKLLEPLEAEIQQGVNLKEEDFNKDMNEDNEGTVKELLQRGDNLQQRITDERKREEIKIKQQLLQTKHNALKDLRSQRRKKALEISHQWYQYKRQADDLLKCLDDIEKKLASLPEPRDERKIKEIDRELQKKKEELNAVRRQAEGLSEDGAAMAVEPTQIQLSKRWREIESKFAQFRRLNFAQIHTVREETMMVMTEDMPLEISYVPSTYLTEITHVSQALLEVEQLLNAPDLCAKDFEDLFKQEESLKNIKDSLQQSSGRIDIIHSKKTAALQSATPVERVKLQEALSQLDFQWEKVNKMYKDRQGRFDRSVEKWRRFHYDIKIFNQWLTEAEQFLRKTQIPENWEHAKYKWYLKELQDGIGQRQTVVRTLNATGEEIIQQSSKTDASILQEKLGSLNLRWQEVCKQLSDRKKRLEEQKNILSEFQRDLNEFVLWLEEADNIASIPLEPGKEQQLKEKLEQVKLLVEELPLRQGILKQLNETGGPVLVSAPISPEEQDKLENKLKQTNLQWIKVSRALPEKQGEIEAQIKDLGQLEKKLEDLEEQLNHLLLWLSPIRNQLEIYNQPNQEGPFDVQETEIAVQAKQPDVEEILSKGQHLYKEKPATQPVKRKLEDLSSEWKAVNRLLQELRAKQPDLAPGLTTIGASPTQTVTLVTQPVVTKETAISKLEMPSSLMLEVPALADFNRAWTELTDWLSLLDQVIKSQRVMVGDLEDINEMIIKQKATMQDLEQRRPQLEELITAAQNLKNKTSNQEARTIITDRIERIQNQWDEVQEHLQNRRQQLNEMLKDSTQWLEAKEEAEQVLGQARAKLESWKEGPYTVDAIQKKITETKQLAKDLRQWQTNVDVANDLALKLLRDYSADDTRKVHMITENINASWRSIHKRVSEREAALEETHRLLQQFPLDLEKFLAWLTEAETTANVLQDATRKERLLEDSKGVKELMKQWQDLQGEIEAHTDVYHNLDENSQKILRSLEGSDDAVLLQRRLDNMNFKWSELRKKSLNIRSHLEASSDQWKRLHLSLQELLVWLQLKDDELSRQAPIGGDFPAVQKQNDVHRAFKRELKTKEPVIMSTLETVRIFLTEQPLEGLEKLYQEPRELPPEERAQNVTRLLRKQAEEVNTEWEKLNLHSADWQRKIDETLERLQELQEATDELDLKLRQAEVIKGSWQPVGDLLIDSLQDHLEKVKALRGEIAPLKENVSHVNDLARQLTTLGIQLSPYNLSTLEDLNTRWKLLQVAVEDRVRQLHEAHRDFGPASQHFLSTSVQGPWERAISPNKVPYYINHETQTTCWDHPKMTELYQSLADLNNVRFSAYRTAMKLRRLQKALCLDLLSLSAACDALDQHNLKQNDQPMDILQIINCLTTIYDRLEQEHNNLVNVPLCVDMCLNWLLNVYDTGRTGRIRVLSFKTGIISLCKAHLEDKYRYLFKQVASSTGFCDQRRLGLLLHDSIQIPRQLGEVASFGGSNIEPSVRSCFQFANNKPEIEAALFLDWMRLEPQSMVWLPVLHRVAAAETAKHQAKCNICKECPIIGFRYRSLKHFNYDICQSCFFSGRVAKGHKMHYPMVEYCTPTTSGEDVRDFAKVLKNKFRTKRYFAKHPRMGYLPVQTVLEGDNMETPVTLINFWPVDSAPASSPQLSHDDTHSRIEHYASRLAEMENSNGSYLNDSISPNESIDDEHLLIQHYCQSLNQDSPLSQPRSPAQILISLESEERGELERILADLEEENRNLQAEYDRLKQQHEHKGLSPLPSPPEMMPTSPQSPRDAELIAEAKLLRQHKGRLEARMQILEDHNKQLESQLHRLRQLLEQPQAEAKVNGTTVSSPSTSLQRSDSSQPMLLRVVGSQTSDSMGEEDLLSPPQDTSTGLEEVMEQLNNSFPSSRGRNTPGKPMREDTM
" misc_feature 737..1054 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Calponin homology domain; actin-binding domain which may be present as a single copy or in tandem repeats (which increases binding affinity). The CH domain is found in cytoskeletal and signal transduction proteins, including actin-binding proteins like...; Region: CH; cd00014" /db_xref="CDD:28898" misc_feature order(737..742,746..754,761..763,770..772,932..937, 944..946,956..958,962..964,1010..1015,1022..1027, 1031..1036,1043..1048) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="putative actin binding surface [polypeptide binding]; other site" /db_xref="CDD:28898" misc_feature 1355..2008 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 1676..1693 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 1793..2341 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 2006..2023 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 2513..3133 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 2819..2836 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 3479..4123 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 3797..3814 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 4136..4756 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 4436..4453 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 4733..5362 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 5039..5056 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 5369..5662 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeat; Region: Spectrin; pfam00435" /db_xref="CDD:201223" misc_feature 5444..6271 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Uncharacterized archaeal coiled-coil protein [Function unknown]; Region: COG1340" /db_xref="CDD:31531" misc_feature 5672..6238 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 5960..5977 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 6332..6958 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 6638..6655 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 6647..7294 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature order(6959..6967,6971..6979) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 7748..8398 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 8066..8083 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 8402..9133 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 8741..8758 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 9137..>9469 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Spectrin repeats, found in several proteins involved in cytoskeletal structure; family members include spectrin, alpha-actinin and dystrophin; the spectrin repeat forms a three helix bundle with the second helix interrupted by proline in some sequences; Region: SPEC; cd00176" /db_xref="CDD:29138" misc_feature 9455..9469 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="linker region; other site" /db_xref="CDD:29138" misc_feature 9509..9598 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Two conserved tryptophans domain; also known as the WWP or rsp5 domain; around 40 amino acids; functions as an interaction module in a diverse set of signalling proteins; binds specific proline-rich sequences but at low affinities compared to other...; Region: WW; cd00201" /db_xref="CDD:29258" misc_feature order(9548..9550,9581..9583) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="binding pocket" /db_xref="CDD:29258" misc_feature 9593..9955 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="EF hand; Region: efhand_1; pfam09068" /db_xref="CDD:149945" misc_feature 9965..10240 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="EF-hand; Region: efhand_2; pfam09069" /db_xref="CDD:149946" misc_feature 10265..10411 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Zinc finger, ZZ type. Zinc finger present in dystrophin and dystrobrevin. The ZZ motif coordinates two zinc ions and most likely participates in ligand binding or molecular scaffolding. Dystrophin attaches actin filaments to an integral membrane...; Region: ZZ_dystrophin; cd02334" /db_xref="CDD:30238" misc_feature order(10271..10273,10280..10282,10316..10318,10325..10327, 10343..10345,10352..10354,10382..10384,10394..10396) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="Zinc-binding sites [ion binding]; other site" /db_xref="CDD:30238" misc_feature order(10271..10273,10280..10282,10343..10345,10352..10354) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="zinc cluster 1 [ion binding]; other site" /db_xref="CDD:30238" misc_feature order(10274..10276,10307..10309,10313..10315,10331..10333, 10337..10339) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="putative charged binding surface; other site" /db_xref="CDD:30238" misc_feature order(10310..10312,10355..10357,10400..10402,10409..10411) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="putative hydrophobic binding surface; other site" /db_xref="CDD:30238" misc_feature order(10316..10318,10325..10327,10382..10384,10394..10396) /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /note="zinc cluster 2 [ion binding]; other site" /db_xref="CDD:30238" misc_feature 10607..10609 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" variation 732 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:1800256" STS 872..980 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99269" variation 1136 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:1800264" variation 1171 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1800265" variation 1429 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:1800266" variation 1432 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="t" /db_xref="dbSNP:72470507" STS 1612..2186 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="MARC_84337-84338:1278013457:1" /db_xref="UniSTS:532589" variation 1671 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:72468699" variation 2004 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:1800257" variation 2008 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="g" /replace="t" /db_xref="dbSNP:1800258" STS 2074..2660 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="MARC_84339-84340:1278014518:1" /db_xref="UniSTS:532590" variation 2201 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:1800259" variation 2203 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:1800267" variation 2222 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:72468692" variation 2685 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="g" /db_xref="dbSNP:1800260" variation 2725 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="g" /replace="t" /db_xref="dbSNP:72468681" variation 2791 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:72468680" variation 2824 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:72468679" variation 3305 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="g" /db_xref="dbSNP:72468667" variation 3355 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1800268" variation 3364 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:72468666" variation 3454 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:1800261" variation 3923 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="g" /replace="t" /db_xref="dbSNP:1800262" STS 3941..4039 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99474" variation 4068 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:1800269" variation 4166 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="g" /db_xref="dbSNP:1800270" variation 4465 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:1800263" variation 4609 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:72468647" variation 4740 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="t" /db_xref="dbSNP:1057872" variation 4863 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:72468638" STS 4866..4978 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99582" variation 5211 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="t" /db_xref="dbSNP:72468634" variation 5311 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:1801185" variation 5374 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:72468632" variation 5497 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="g" /db_xref="dbSNP:72468630" variation 5568 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1801187" STS 5745..6302 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="MARC_84357-84358:1278016549:1" /db_xref="UniSTS:532591" variation 5793 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1800271" variation 5864 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:1064325" variation 5866 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:1801186" STS 5970..6064 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99541" variation 6109 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1800272" variation 6362 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="g" /replace="t" /db_xref="dbSNP:72468613" STS 6626..6750 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99225" variation 6797 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:1800273" STS 7000..7082 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99066" variation 7162 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:72466595" variation 7414 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1800274" variation 7430 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:1800275" variation 7517 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:72466590" STS 7698..7809 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DXS7499" /db_xref="UniSTS:30753" variation 8062 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:1801188" variation 8154 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="t" /db_xref="dbSNP:72466581" STS 8219..8354 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99382" variation 8389 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1801189" STS 8561..8660 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99545" variation 8656 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:72466575" variation 8830 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:72466574" variation 8905 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:72466570" variation 8913 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:72466569" variation 9144 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1800280" STS 9155..9257 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99400" variation 9186 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:72466567" variation 9427 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:72466563" variation 9428 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:72466562" STS 9906..9973 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:99128" variation 10954 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:72466538" variation 11123 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="c" /replace="t" /db_xref="dbSNP:1800281" variation 11352 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1795743" STS 11474..11667 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="PMC316713P2" /db_xref="UniSTS:273040" STS 11742..11930 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="G15848" /db_xref="UniSTS:3168" STS 11783..11915 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DXS1234" /db_xref="UniSTS:146800" variation 11872..11873 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="acac" /replace="taca" /db_xref="dbSNP:3833413" variation 12316 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="acaa" /db_xref="dbSNP:72466531" variation 12360 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="t" /db_xref="dbSNP:72466530" STS 12398..12466 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DXS503" /db_xref="UniSTS:99031" variation 12440 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="gat" /db_xref="dbSNP:72466529" variation 12637 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="cttt" /db_xref="dbSNP:72466527" STS 12704..12854 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DXS6988E" /db_xref="UniSTS:32060" variation 12839 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:3361" STS 12860..12960 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="A002S20" /db_xref="UniSTS:57879" variation 12957 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="aaag" /db_xref="dbSNP:72466526" variation 12983 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="tgtt" /db_xref="dbSNP:72466525" variation 13123 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:3198427" variation 13150 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="ttcat" /db_xref="dbSNP:72466524" variation 13431 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="c" /db_xref="dbSNP:72466523" variation 13545 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="atgtgacgctggacctt" /db_xref="dbSNP:72466522" variation 13577 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="t" /db_xref="dbSNP:11550191" variation 13629 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="aagt" /db_xref="dbSNP:72466521" STS 13710..13901 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="DMD" /db_xref="UniSTS:506537" variation 13819 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="a" /replace="g" /db_xref="dbSNP:1057915" STS 13967..14051 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /standard_name="PMC108984P1" /db_xref="UniSTS:270148" variation 13973 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" /replace="" /replace="actt" /db_xref="dbSNP:72466520" polyA_signal 14061..14066 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" polyA_site 14083 /gene="DMD" /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272" ORIGIN
tgctgtctgtgaagctgaatctgtgagaacacctcactattcacggcaaccggagtggaagaaacaggtgcaaaaagattgtgtgtttgtctgcttttgtgaggctggtcagagattctgtgcctgctttatctgtgcttggctatgactctacctccaggtttaccataccccatagaatgtgtaagagaaaagtaccaacagggaaatcagcaaaaagctttcctatgaaggtgtgtagccagcctccgcagaatttgaaatgtctgaggtctcatctggtgagtaaaagctgcagataaatgcaacagccattcagaagaatgataaattccacaagcattcagaagcaggcttccctaaagatgaaagagaagatgttcaaaagaaaacattcacaaaatgggtaaatgcacaattttctaagtttgggaagcagcatattgagaacctcttcagtgacctacaggatgggaggcgcctcctagacctcctcgaaggcctgacagggcaaaaactgccaaaagaaaaaggatccacaagagttcatgccctgaacaatgtcaacaaggcactgcgggttttgcagaacaataatgttgatttagtgaatattggaagtactgacatcgtagatggaaatcataaactgactcttggtttgatttggaatataatcctccactggcaggtcaaaaatgtaatgaaaaatatcatggctggattgcaacaaaccaacagtgaaaagattctcctgagctgggtccgacaatcaactcgtaattatccacaggttaatgtaatcaacttcaccaccagctggtctgatggcctggctttgaatgctctcatccatagtcataggccagacctatttgactggaatagtgtggtttgccagcagtcagccacacaacgactggaacatgcattcaacatcgccagatatcaattaggcatagagaaactactcgatcctgaagatgttgataccacctatccagataagaagtccatcttaatgtacatcacatcactcttccaagttttgcctcaacaagtgagcattgaagccatccaggaagtggaaatgttgccaaggccacctaaagtgactaaagaagaacattttcagttacatcatcaaatgcactattctcaacagatcacggtcagtctagcacagggatatgagagaacttcttcccctaagcctcgattcaagagctatgcctacacacaggctgcttatgtcaccacctctgaccctacacggagcccatttccttcacagcatttggaagctcctgaagacaagtcatttggcagttcattgatggagagtgaagtaaacctggaccgttatcaaacagctttagaagaagtattatcgtggcttctttctgctgaggacacattgcaagcacaaggagagatttctaatgatgtggaagtggtgaaagaccagtttcatactcatgaggggtacatgatggatttgacagcccatcagggccgggttggtaatattctacaattgggaagtaagctgattggaacaggaaaattatcagaagatgaagaaactgaagtacaagagcagatgaatctcctaaattcaagatgggaatgcctcagggtagctagcatggaaaaacaaagcaatttacatagagttttaatggatctccagaatcagaaactgaaagagttgaatgactggctaacaaaaacagaagaaagaacaaggaaaatggaggaagagcctcttggacctgatcttgaagacctaaaacgccaagtacaacaacataaggtgcttcaagaagatctagaacaagaacaagtcagggtcaattctctcactcacatggtggtggtagttgatgaatctagtggagatcacgcaactgctgctttggaagaacaacttaaggtattgggagatcgatgggcaaacatctgtagatggacagaagaccgctgggttcttttacaagacatccttctcaaatggcaacgtcttactgaagaacagtgcctttttagtgcatggctttcagaaaaagaagatgcagtgaacaagattcacacaactggctttaaagatcaaaatgaaatgttatcaagtcttcaaaaactggccgttttaaaagcggatctagaaaagaaaaagcaatccatgggcaaactgtattcactcaaacaagatcttctttcaacactgaagaataagtcagtgacccagaagacggaagcatggctggataactttgcccggtgttgggataatttagtccaaaaacttgaaaagagtacagcacagatttcacaggctgtcaccaccactcagccatcactaacacagacaactgtaatggaaacagtaactacggtgaccacaagggaacagatcctggtaaagcatgctcaagaggaacttccaccaccacctccccaaaagaagaggcagattactgtggattctgaaattaggaaaaggttggatgttgatataactgaacttcacagctggattactcgctcagaagctgtgttgcagagtcctgaatttgcaatctttcggaaggaaggcaacttctcagacttaaaagaaaaagtcaatgccatagagcgagaaaaagctgagaagttcagaaaactgcaagatgccagcagatcagctcaggccctggtggaacagatggtgaatgagggtgttaatgcagatagcatcaaacaagcctcagaacaactgaacagccggtggatcgaattctgccagttgctaagtgagagacttaactggctggagtatcagaacaacatcatcgctttctataatcagctacaacaattggagcagatgacaactactgctgaaaactggttgaaaatccaacccaccaccccatcagagccaacagcaattaaaagtcagttaaaaatttgtaaggatgaagtcaaccggctatcaggtcttcaacctcaaattgaacgattaaaaattcaaagcatagccctgaaagagaaaggacaaggacccatgttcctggatgcagactttgtggcctttacaaatcattttaagcaagtcttttctgatgtgcaggccagagagaaagagctacagacaatttttgacactttgccaccaatgcgctatcaggagaccatgagtgccatcaggacatgggtccagcagtcagaaaccaaactctccatacctcaacttagtgtcaccgactatgaaatcatggagcagagactcggggaattgcaggctttacaaagttctctgcaagagcaacaaagtggcctatactatctcagcaccactgtgaaagagatgtcgaagaaagcgccctctgaaattagccggaaatatcaatcagaatttgaagaaattgagggacgctggaagaagctctcctcccagctggttgagcattgtcaaaagctagaggagcaaatgaataaactccgaaaaattcagaatcacatacaaaccctgaagaaatggatggctgaagttgatgtttttctgaaggaggaatggcctgcccttggggattcagaaattctaaaaaagcagctgaaacagtgcagacttttagtcagtgatattcagacaattcagcccagtctaaacagtgtcaatgaaggtgggcagaagataaagaatgaagcagagccagagtttgcttcgagacttgagacagaactcaaagaacttaacactcagtgggatcacatgtgccaacaggtctatgccagaaaggaggccttgaagggaggtttggagaaaactgtaagcctccagaaagatctatcagagatgcacgaatggatgacacaagctgaagaagagtatcttgagagagattttgaatataaaactccagatgaattacagaaagcagttgaagagatgaagagagctaaagaagaggcccaacaaaaagaagcgaaagtgaaactccttactgagtctgtaaatagtgtcatagctcaagctccacctgtagcacaagaggccttaaaaaaggaacttgaaactctaaccaccaactaccagtggctctgcactaggctgaatgggaaatgcaagactttggaagaagtttgggcatgttggcatgagttattgtcatacttggagaaagcaaacaagtggctaaatgaagtagaatttaaacttaaaaccactgaaaacattcctggcggagctgaggaaatctctgaggtgctagattcacttgaaaatttgatgcgacattcagaggataacccaaatcagattcgcatattggcacagaccctaacagatggcggagtcatggatgagctaatcaatgaggaacttgagacatttaattctcgttggagggaactacatgaagaggctgtaaggaggcaaaagttgcttgaacagagcatccagtctgcccaggagactgaaaaatccttacacttaatccaggagtccctcacattcattgacaagcagttggcagcttatattgcagacaaggtggacgcagctcaaatgcctcaggaagcccagaaaatccaatctgatttgacaagtcatgagatcagtttagaagaaatgaagaaacataatcaggggaaggaggctgcccaaagagtcctgtctcagattgatgttgcacagaaaaaattacaagatgtctccatgaagtttcgattattccagaaaccagccaattttgagcagcgtctacaagaaagtaagatgattttagatgaagtgaagatgcacttgcctgcattggaaacaaagagtgtggaacaggaagtagtacagtcacagctaaatcattgtgtgaacttgtataaaagtctgagtgaagtgaagtctgaagtggaaatggtgataaagactggacgtcagattgtacagaaaaagcagacggaaaatcccaaagaacttgatgaaagagtaacagctttgaaattgcattataatgagctgggagcaaaggtaacagaaagaaagcaacagttggagaaatgcttgaaattgtcccgtaagatgcgaaaggaaatgaatgtcttgacagaatggctggcagctacagatatggaattgacaaagagatcagcagttgaaggaatgcctagtaatttggattctgaagttgcctggggaaaggctactcaaaaagagattgagaaacagaaggtgcacctgaagagtatcacagaggtaggagaggccttgaaaacagttttgggcaagaaggagacgttggtggaagataaactcagtcttctgaatagtaactggatagctgtcacctcccgagcagaagagtggttaaatcttttgttggaataccagaaacacatggaaacttttgaccagaatgtggaccacatcacaaagtggatcattcaggctgacacacttttggatgaatcagagaaaaagaaaccccagcaaaaagaagacgtgcttaagcgtttaaaggcagaactgaatgacatacgcccaaaggtggactctacacgtgaccaagcagcaaacttgatggcaaaccgcggtgaccactgcaggaaattagtagagccccaaatctcagagctcaaccatcgatttgcagccatttcacacagaattaagactggaaaggcctccattcctttgaaggaattggagcagtttaactcagatatacaaaaattgcttgaaccactggaggctgaaattcagcagggggtgaatctgaaagaggaagacttcaataaagatatgaatgaagacaatgagggtactgtaaaagaattgttgcaaagaggagacaacttacaacaaagaatcacagatgagagaaagcgagaggaaataaagataaaacagcagctgttacagacaaaacataatgctctcaaggatttgaggtctcaaagaagaaaaaaggctctagaaatttctcatcagtggtatcagtacaagaggcaggctgatgatctcctgaaatgcttggatgacattgaaaaaaaattagccagcctacctgagcccagagatgaaaggaaaataaaggaaattgatcgggaattgcagaagaagaaagaggagctgaatgcagtgcgtaggcaagctgagggcttgtctgaggatggggccgcaatggcagtggagccaactcagatccagctcagcaagcgctggcgggaaattgagagcaaatttgctcagtttcgaagactcaactttgcacaaattcacactgtccgtgaagaaacgatgatggtgatgactgaagacatgcctttggaaatttcttatgtgccttctacttatttgactgaaatcactcatgtctcacaagccctattagaagtggaacaacttctcaatgctcctgacctctgtgctaaggactttgaagatctctttaagcaagaggagtctctgaagaatataaaagatagtctacaacaaagctcaggtcggattgacattattcatagcaagaagacagcagcattgcaaagtgcaacgcctgtggaaagggtgaagctacaggaagctctctcccagcttgatttccaatgggaaaaagttaacaaaatgtacaaggaccgacaagggcgatttgacagatctgttgagaaatggcggcgttttcattatgatataaagatatttaatcagtggctaacagaagctgaacagtttctcagaaagacacaaattcctgagaattgggaacatgctaaatacaaatggtatcttaaggaactccaggatggcattgggcagcggcaaactgttgtcagaacattgaatgcaactggggaagaaataattcagcaatcctcaaaaacagatgccagtattctacaggaaaaattgggaagcctgaatctgcggtggcaggaggtctgcaaacagctgtcagacagaaaaaagaggctagaagaacaaaagaatatcttgtcagaatttcaaagagatttaaatgaatttgttttatggttggaggaagcagataacattgctagtatcccacttgaacctggaaaagagcagcaactaaaagaaaagcttgagcaagtcaagttactggtggaagagttgcccctgcgccagggaattctcaaacaattaaatgaaactggaggacccgtgcttgtaagtgctcccataagcccagaagagcaagataaacttgaaaataagctcaagcagacaaatctccagtggataaaggtttccagagctttacctgagaaacaaggagaaattgaagctcaaataaaagaccttgggcagcttgaaaaaaagcttgaagaccttgaagagcagttaaatcatctgctgctgtggttatctcctattaggaatcagttggaaatttataaccaaccaaaccaagaaggaccatttgacgttcaggaaactgaaatagcagttcaagctaaacaaccggatgtggaagagattttgtctaaagggcagcatttgtacaaggaaaaaccagccactcagccagtgaagaggaagttagaagatctgagctctgagtggaaggcggtaaaccgtttacttcaagagctgagggcaaagcagcctgacctagctcctggactgaccactattggagcctctcctactcagactgttactctggtgacacaacctgtggttactaaggaaactgccatctccaaactagaaatgccatcttccttgatgttggaggtacctgctctggcagatttcaaccgggcttggacagaacttaccgactggctttctctgcttgatcaagttataaaatcacagagggtgatggtgggtgaccttgaggatatcaacgagatgatcatcaagcagaaggcaacaatgcaggatttggaacagaggcgtccccagttggaagaactcattaccgctgcccaaaatttgaaaaacaagaccagcaatcaagaggctagaacaatcattacggatcgaattgaaagaattcagaatcagtgggatgaagtacaagaacaccttcagaaccggaggcaacagttgaatgaaatgttaaaggattcaacacaatggctggaagctaaggaagaagctgagcaggtcttaggacaggccagagccaagcttgagtcatggaaggagggtccctatacagtagatgcaatccaaaagaaaatcacagaaaccaagcagttggccaaagacctccgccagtggcagacaaatgtagatgtggcaaatgacttggccctgaaacttctccgggattattctgcagatgataccagaaaagtccacatgataacagagaatatcaatgcctcttggagaagcattcataaaagggtgagtgagcgagaggctgctttggaagaaactcatagattactgcaacagttccccctggacctggaaaagtttcttgcctggcttacagaagctgaaacaactgccaatgtcctacaggatgctacccgtaaggaaaggctcctagaagactccaagggagtaaaagagctgatgaaacaatggcaagacctccaaggtgaaattgaagctcacacagatgtttatcacaacctggatgaaaacagccaaaaaatcctgagatccctggaaggttccgatgatgcagtcctgttacaaagacgtttggataacatgaacttcaagtggagtgaacttcggaaaaagtctctcaacattaggtcccatttggaagccagttctgaccagtggaagcgtctgcacctttctctgcaggaacttctggtgtggctacagctgaaagatgatgaattaagccggcaggcacctattggaggcgactttccagcagttcagaagcagaacgatgtacatagggccttcaagagggaattgaaaactaaagaacctgtaatcatgagtactcttgagactgtacgaatatttctgacagagcagcctttggaaggactagagaaactctaccaggagcccagagagctgcctcctgaggagagagcccagaatgtcactcggcttctacgaaagcaggctgaggaggtcaatactgagtgggaaaaattgaacctgcactccgctgactggcagagaaaaatagatgagacccttgaaagactccaggaacttcaagaggccacggatgagctggacctcaagctgcgccaagctgaggtgatcaagggatcctggcagcccgtgggcgatctcctcattgactctctccaagatcacctcgagaaagtcaaggcacttcgaggagaaattgcgcctctgaaagagaacgtgagccacgtcaatgaccttgctcgccagcttaccactttgggcattcagctctcaccgtataacctcagcactctggaagacctgaacaccagatggaagcttctgcaggtggccgtcgaggaccgagtcaggcagctgcatgaagcccacagggactttggtccagcatctcagcactttctttccacgtctgtccagggtccctgggagagagccatctcgccaaacaaagtgccctactatatcaaccacgagactcaaacaacttgctgggaccatcccaaaatgacagagctctaccagtctttagctgacctgaataatgtcagattctcagcttataggactgccatgaaactccgaagactgcagaaggccctttgcttggatctcttgagcctgtcagctgcatgtgatgccttggaccagcacaacctcaagcaaaatgaccagcccatggatatcctgcagattattaattgtttgaccactatttatgaccgcctggagcaagagcacaacaatttggtcaacgtccctctctgcgtggatatgtgtctgaactggctgctgaatgtttatgatacgggacgaacagggaggatccgtgtcctgtcttttaaaactggcatcatttccctgtgtaaagcacatttggaagacaagtacagataccttttcaagcaagtggcaagttcaacaggattttgtgaccagcgcaggctgggcctccttctgcatgattctatccaaattccaagacagttgggtgaagttgcatcctttgggggcagtaacattgagccaagtgtccggagctgcttccaatttgctaataataagccagagatcgaagcggccctcttcctagactggatgagactggaaccccagtccatggtgtggctgcccgtcctgcacagagtggctgctgcagaaactgccaagcatcaggccaaatgtaacatctgcaaagagtgtccaatcattggattcaggtacaggagtctaaagcactttaattatgacatctgccaaagctgctttttttctggtcgagttgcaaaaggccataaaatgcactatcccatggtggaatattgcactccgactacatcaggagaagatgttcgagactttgccaaggtactaaaaaacaaatttcgaaccaaaaggtattttgcgaagcatccccgaatgggctacctgccagtgcagactgtcttagagggggacaacatggaaactcccgttactctgatcaacttctggccagtagattctgcgcctgcctcgtcccctcagctttcacacgatgatactcattcacgcattgaacattatgctagcaggctagcagaaatggaaaacagcaatggatcttatctaaatgatagcatctctcctaatgagagcatagatgatgaacatttgttaatccagcattactgccaaagtttgaaccaggactcccccctgagccagcctcgtagtcctgcccagatcttgatttccttagagagtgaggaaagaggggagctagagagaatcctagcagatcttgaggaagaaaacaggaatctgcaagcagaatatgaccgtctaaagcagcagcacgaacataaaggcctgtccccactgccgtcccctcctgaaatgatgcccacctctccccagagtccccgggatgctgagctcattgctgaggccaagctactgcgtcaacacaaaggccgcctggaagccaggatgcaaatcctggaagaccacaataaacagctggagtcacagttacacaggctaaggcagctgctggagcaaccccaggcagaggccaaagtgaatggcacaacggtgtcctctccttctacctctctacagaggtccgacagcagtcagcctatgctgctccgagtggttggcagtcaaacttcggactccatgggtgaggaagatcttctcagtcctccccaggacacaagcacagggttagaggaggtgatggagcaactcaacaactccttccctagttcaagaggaagaaatacccctggaaagccaatgagagaggacacaatgtaggaagtcttttccacatggcagatgatttgggcagagcgatggagtccttagtatcagtcatgacagatgaagaaggagcagaataaatgttttacaactcctgattcccgcatggtttttataatattcatacaacaaagaggattagacagtaagagtttacaagaaataaatctatatttttgtgaagggtagtggtattatactgtagatttcagtagtttctaagtctgttattgttttgttaacaatggcaggttttacacgtctatgcaattgtacaaaaaagttataagaaaactacatgtaaaatcttgatagctaaataacttgccatttctttatatggaacgcattttgggttgtttaaaaatttataacagttataaagaaagattgtaaactaaagtgtgctttataaaaaaaagttgtttataaaaacccctaaaaacaaaacaaacacacacacacacacatacacacacacacacaaaactttgaggcagcgcattgttttgcatccttttggcgtgatatccatatgaaattcatggctttttctttttttgcatattaaagataagacttcctctaccaccacaccaaatgactactacacactgctcatttgagaactgtcagctgagtggggcaggcttgagttttcatttcatatatctatatgtctataagtatataaatactatagttatatagataaagagatacgaatttctatagactgactttttccattttttaaatgttcatgtcacatcctaatagaaagaaattacttctagtcagtcatccaggcttacctgcttggtctagaatggatttttcccggagccggaagccaggaggaaactacaccacactaaaacattgtctacagctccagatgtttctcattttaaacaactttccactgacaacgaaagtaaagtaaagtattggatttttttaaagggaacatgtgaatgaatacacaggacttattatatcagagtgagtaatcggttggttggttgattgattgattgattgatacattcagcttcctgctgctagcaatgccacgatttagatttaatgatgcttcagtggaaatcaatcagaaggtattctgaccttgtgaacatcagaaggtattttttaactcccaagcagtagcaggacgatgatagggctggagggctatggattcccagcccatccctgtgaaggagtaggccactctttaagtgaaggattggatgattgttcataatacataaagttctctgtaattacaactaaattattatgccctcttctcacagtcaaaaggaactgggtggtttggtttttgttgcttttttagatttattgtcccatgtgggatgagtttttaaatgccacaagacataatttaaaataaataaactttgggaaaaggtgtaaaacagtagccccatcacatttgtgatactgacaggtatcaacccagaagcccatgaactgtgtttccatcctttgcatttctctgcgagtagttccacacaggtttgtaagtaagtaagaaagaaggcaaattgattcaaatgttacaaaaaaacccttcttggtggattagacaggttaaatatataaacaaacaaacaaaaattgctcaaaaaagaggagaaaagctcaagaggaaaagctaaggactggtaggaaaaagctttactctttcatgccattttatttctttttgatttttaaatcattcattcaatagataccaccgtgtgacctataattttgcaaatctgttacctctgacatcaagtgtaattagcttttggagagtgggctgacatcaagtgtaattagcttttggagagtgggttttgtccattattaataattaattaattaacatcaaacacggcttctcatgctatttctacctcactttggttttggggtgttcctgataattgtgcacacctgagttcacagcttcaccacttgtccattgcgttattttctttttcctttataattctttctttttccttcataattttcaaaagaaaacccaaagctctaaggtaacaaattaccaaattacatgaagatttggtttttgtcttgcatttttttcctttatgtgacgctggaccttttctttacccaaggatttttaaaactcagatttaaaacaaggggttactttacatcctactaagaagtttaagtaagtaagtttcattctaaaatcagaggtaaatagagtgcataaataattttgttttaatctttttgtttttcttttagacacattagctctggagtgagtctgtcataatatttgaacaaaaattgagagctttattgctgcattttaagcataattaatttggacattatttcgtgttgtgttctttataaccaccaagtattaaactgtaaatcataatgtaactgaagcataaacatcacatggcatgttttgtcattgttttcaggtactgagttcttacttgagtatcataatatattgtgttttaacaccaacactgtaacatttacgaattatttttttaaacttcagttttactgcattttcacaacatatcagacttcaccaaatatatgccttactattgtattatagtactgctttactgtgtatctcaataaagcacgcagttatgttac
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:1756 -> Molecular function: GO:0002162 [dystroglycan binding] evidence: IPI GeneID:1756 -> Molecular function: GO:0003779 [actin binding] evidence: IDA GeneID:1756 -> Molecular function: GO:0003779 [actin binding] evidence: TAS GeneID:1756 -> Molecular function: GO:0005200 [structural constituent of cytoskeleton] evidence: TAS GeneID:1756 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA GeneID:1756 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:1756 -> Molecular function: GO:0008270 [zinc ion binding] evidence: IEA GeneID:1756 -> Molecular function: GO:0008307 [structural constituent of muscle] evidence: IDA GeneID:1756 -> Molecular function: GO:0008307 [structural constituent of muscle] evidence: TAS GeneID:1756 -> Molecular function: GO:0017022 [myosin binding] evidence: IDA GeneID:1756 -> Molecular function: GO:0017166 [vinculin binding] evidence: IPI GeneID:1756 -> Molecular function: GO:0050998 [nitric-oxide synthase binding] evidence: ISS GeneID:1756 -> Biological process: GO:0001954 [positive regulation of cell-matrix adhesion] evidence: IEA GeneID:1756 -> Biological process: GO:0002027 [regulation of heart rate] evidence: IMP GeneID:1756 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: IEA GeneID:1756 -> Biological process: GO:0007517 [muscle organ development] evidence: NAS GeneID:1756 -> Biological process: GO:0008065 [establishment of blood-nerve barrier] evidence: IEA GeneID:1756 -> Biological process: GO:0010880 [regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum] evidence: ISS GeneID:1756 -> Biological process: GO:0010881 [regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion] evidence: ISS GeneID:1756 -> Biological process: GO:0010976 [positive regulation of neuron projection development] evidence: IMP GeneID:1756 -> Biological process: GO:0014809 [regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion] evidence: ISS GeneID:1756 -> Biological process: GO:0014819 [regulation of skeletal muscle contraction] evidence: ISS GeneID:1756 -> Biological process: GO:0014904 [myotube cell development] evidence: IEA GeneID:1756 -> Biological process: GO:0021629 [olfactory nerve structural organization] evidence: IEA GeneID:1756 -> Biological process: GO:0030049 [muscle filament sliding] evidence: TAS GeneID:1756 -> Biological process: GO:0030198 [extracellular matrix organization] evidence: TAS GeneID:1756 -> Biological process: GO:0033137 [negative regulation of peptidyl-serine phosphorylation] evidence: ISS GeneID:1756 -> Biological process: GO:0034613 [cellular protein localization] evidence: IMP GeneID:1756 -> Biological process: GO:0043043 [peptide biosynthetic process] evidence: IDA GeneID:1756 -> Biological process: GO:0043623 [cellular protein complex assembly] evidence: ISS GeneID:1756 -> Biological process: GO:0044458 [motile cilium assembly] evidence: TAS GeneID:1756 -> Biological process: GO:0045213 [neurotransmitter receptor metabolic process] evidence: IEA GeneID:1756 -> Biological process: GO:0045666 [positive regulation of neuron differentiation] evidence: IMP GeneID:1756 -> Biological process: GO:0046716 [muscle cell homeostasis] evidence: IEA GeneID:1756 -> Biological process: GO:0048747 [muscle fiber development] evidence: IEA GeneID:1756 -> Biological process: GO:0051647 [nucleus localization] evidence: IEA GeneID:1756 -> Biological process: GO:0060048 [cardiac muscle contraction] evidence: IMP GeneID:1756 -> Biological process: GO:0060314 [regulation of ryanodine-sensitive calcium-release channel activity] evidence: ISS GeneID:1756 -> Biological process: GO:0060857 [establishment of glial blood-brain barrier] evidence: IEA GeneID:1756 -> Biological process: GO:0086001 [regulation of cardiac muscle cell action potential] evidence: ISS GeneID:1756 -> Biological process: GO:0090287 [regulation of cellular response to growth factor stimulus] evidence: IMP GeneID:1756 -> Biological process: GO:1901385 [regulation of voltage-gated calcium channel activity] evidence: ISS GeneID:1756 -> Biological process: GO:2000169 [regulation of peptidyl-cysteine S-nitrosylation] evidence: ISS GeneID:1756 -> Biological process: GO:2000651 [positive regulation of sodium ion transmembrane transporter activity] evidence: ISS GeneID:1756 -> Cellular component: GO:0005634 [nucleus] evidence: IDA GeneID:1756 -> Cellular component: GO:0005634 [nucleus] evidence: TAS GeneID:1756 -> Cellular component: GO:0005829 [cytosol] evidence: TAS GeneID:1756 -> Cellular component: GO:0005856 [cytoskeleton] evidence: IEA GeneID:1756 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA GeneID:1756 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS GeneID:1756 -> Cellular component: GO:0009986 [cell surface] evidence: IDA GeneID:1756 -> Cellular component: GO:0015629 [actin cytoskeleton] evidence: TAS GeneID:1756 -> Cellular component: GO:0016010 [dystrophin-associated glycoprotein complex] evidence: IDA GeneID:1756 -> Cellular component: GO:0016010 [dystrophin-associated glycoprotein complex] evidence: NAS GeneID:1756 -> Cellular component: GO:0016010 [dystrophin-associated glycoprotein complex] evidence: TAS GeneID:1756 -> Cellular component: GO:0030018 [Z disc] evidence: IEA GeneID:1756 -> Cellular component: GO:0030055 [cell-substrate junction] evidence: IEA GeneID:1756 -> Cellular component: GO:0030175 [filopodium] evidence: IDA GeneID:1756 -> Cellular component: GO:0042383 [sarcolemma] evidence: IDA GeneID:1756 -> Cellular component: GO:0043034 [costamere] evidence: IDA GeneID:1756 -> Cellular component: GO:0043234 [protein complex] evidence: IDA GeneID:1756 -> Cellular component: GO:0044306 [neuron projection terminus] evidence: IEA GeneID:1756 -> Cellular component: GO:0045121 [membrane raft] evidence: IEA GeneID:1756 -> Cellular component: GO:0045121 [membrane raft] evidence: TAS GeneID:1756 -> Cellular component: GO:0045211 [postsynaptic membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.