GGRNA Home | Help | Advanced search

2024-03-28 19:57:10, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_004010              14083 bp    mRNA    linear   PRI 26-MAY-2013
DEFINITION  Homo sapiens dystrophin (DMD), transcript variant Dp427p2, mRNA.
ACCESSION   NM_004010
VERSION     NM_004010.3  GI:238018047
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 14083)
  AUTHORS   Suzuki,H., Kameyama,T., Ohe,K., Tsukahara,T. and Mayeda,A.
  TITLE     Nested introns in an intron: evidence of multi-step splicing in a
            large intron of the human dystrophin pre-mRNA
  JOURNAL   FEBS Lett. 587 (6), 555-561 (2013)
   PUBMED   23395799
  REMARK    GeneRIF: The evidence obtained for multi-step splicing in a large
            intron of the human dystrophin pre-mRNA.
REFERENCE   2  (bases 1 to 14083)
  AUTHORS   Singh,S.M. and Mallela,K.M.
  TITLE     The N-terminal actin-binding tandem calponin-homology (CH) domain
            of dystrophin is in a closed conformation in solution and when
            bound to F-actin
  JOURNAL   Biophys. J. 103 (9), 1970-1978 (2012)
   PUBMED   23199925
  REMARK    GeneRIF: In solution, dystrophin N-terminal actin-binding domain
            binds to F-actin in a closed conformation.
REFERENCE   3  (bases 1 to 14083)
  AUTHORS   Bovolenta,M., Erriquez,D., Valli,E., Brioschi,S., Scotton,C.,
            Neri,M., Falzarano,M.S., Gherardi,S., Fabris,M., Rimessi,P.,
            Gualandi,F., Perini,G. and Ferlini,A.
  TITLE     The DMD locus harbours multiple long non-coding RNAs which
            orchestrate and control transcription of muscle dystrophin mRNA
            isoforms
  JOURNAL   PLoS ONE 7 (9), E45328 (2012)
   PUBMED   23028937
  REMARK    GeneRIF: Findings reveal that DMD lncRNAs may contribute to the
            orchestration and homeostasis of the muscle dystrophin expression
            pattern by either selective targeting and down-modulating the
            dystrophin promoter transcriptional activity.
REFERENCE   4  (bases 1 to 14083)
  AUTHORS   Brioschi,S., Gualandi,F., Scotton,C., Armaroli,A., Bovolenta,M.,
            Falzarano,M.S., Sabatelli,P., Selvatici,R., D'Amico,A., Pane,M.,
            Ricci,G., Siciliano,G., Tedeschi,S., Pini,A., Vercelli,L., De
            Grandis,D., Mercuri,E., Bertini,E., Merlini,L., Mongini,T. and
            Ferlini,A.
  TITLE     Genetic characterization in symptomatic female DMD carriers: lack
            of relationship between X-inactivation, transcriptional DMD allele
            balancing and phenotype
  JOURNAL   BMC Med. Genet. 13, 73 (2012)
   PUBMED   22894145
  REMARK    GeneRIF: No relationship between X-inactivation pattern and
            transcriptional behaviour of DMD gene was observed in Duchenne
            muscular dystrophies.
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 14083)
  AUTHORS   Kapoor,S., Bindu,P.S., Taly,A.B., Sinha,S., Gayathri,N., Rani,S.V.,
            Chandak,G.R. and Kumar,A.
  TITLE     Genetic analysis of an Indian family with members affected with
            Waardenburg syndrome and Duchenne muscular dystrophy
  JOURNAL   Mol. Vis. 18, 2022-2032 (2012)
   PUBMED   22876130
  REMARK    GeneRIF: A novel missense mutation in EDN3 and a deletion mutation
            in DMD has been found in the same Indian family members affected
            with Waardenburg syndrome and Duchenne muscular dystrophy.
REFERENCE   6  (bases 1 to 14083)
  AUTHORS   Nigro,V., Politano,L., Nigro,G., Romano,S.C., Molinari,A.M. and
            Puca,G.A.
  TITLE     Detection of a nonsense mutation in the dystrophin gene by multiple
            SSCP
  JOURNAL   Hum. Mol. Genet. 1 (7), 517-520 (1992)
   PUBMED   1307253
REFERENCE   7  (bases 1 to 14083)
  AUTHORS   Gorecki,D.C., Monaco,A.P., Derry,J.M., Walker,A.P., Barnard,E.A.
            and Barnard,P.J.
  TITLE     Expression of four alternative dystrophin transcripts in brain
            regions regulated by different promoters
  JOURNAL   Hum. Mol. Genet. 1 (7), 505-510 (1992)
   PUBMED   1307251
REFERENCE   8  (bases 1 to 14083)
  AUTHORS   Lederfein,D., Levy,Z., Augier,N., Mornet,D., Morris,G., Fuchs,O.,
            Yaffe,D. and Nudel,U.
  TITLE     A 71-kilodalton protein is a major product of the Duchenne muscular
            dystrophy gene in brain and other nonmuscle tissues
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 89 (12), 5346-5350 (1992)
   PUBMED   1319059
REFERENCE   9  (bases 1 to 14083)
  AUTHORS   Rapaport,D., Lederfein,D., den Dunnen,J.T., Grootscholten,P.M., Van
            Ommen,G.J., Fuchs,O., Nudel,U. and Yaffe,D.
  TITLE     Characterization and cell type distribution of a novel, major
            transcript of the Duchenne muscular dystrophy gene
  JOURNAL   Differentiation 49 (3), 187-193 (1992)
   PUBMED   1377655
REFERENCE   10 (bases 1 to 14083)
  AUTHORS   Koenig,M., Monaco,A.P. and Kunkel,L.M.
  TITLE     The complete sequence of dystrophin predicts a rod-shaped
            cytoskeletal protein
  JOURNAL   Cell 53 (2), 219-228 (1988)
   PUBMED   3282674
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AL049643.12, S64152.1,
            M18533.1, AL109609.5 and BC028720.1.
            On May 24, 2009 this sequence version replaced gi:150036264.
            
            Summary: The dystrophin gene is the largest gene found in nature,
            measuring 2.4 Mb. The gene was identified through a positional
            cloning approach, targeted at the isolation of the gene responsible
            for Duchenne (DMD) and Becker (BMD) Muscular Dystrophies. DMD is a
            recessive, fatal, X-linked disorder occurring at a frequency of
            about 1 in 3,500 new-born males. BMD is a milder allelic form. In
            general, DMD patients carry mutations which cause premature
            translation termination (nonsense or frame shift mutations), while
            in BMD patients dystrophin is reduced either in molecular weight
            (derived from in-frame deletions) or in expression level. The
            dystrophin gene is highly complex, containing at least eight
            independent, tissue-specific promoters and two polyA-addition
            sites. Furthermore, dystrophin RNA is differentially spliced,
            producing a range of different transcripts, encoding a large set of
            protein isoforms. Dystrophin (as encoded by the Dp427 transcripts)
            is a large, rod-like cytoskeletal protein which is found at the
            inner surface of muscle fibers. Dystrophin is part of the
            dystrophin-glycoprotein complex (DGC), which bridges the inner
            cytoskeleton (F-actin) and the extra-cellular matrix. [provided by
            RefSeq, Jul 2008].
            
            Transcript Variant: transcript Dp427p2 has an additional 82 nt
            directly after exon 1 which introduces a translational stop codon
            24 bp downstream of the same ATG codon included in the Dp427p1
            transcript. This transcript has unknown coding capacity.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support ERS025081, ERS025082
                              [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-365               AL049643.12        55870-56234         c
            366-412             S64152.1           274-320
            413-4739            M18533.1           287-4613
            4740-4740           AL109609.5         79506-79506         c
            4741-5863           M18533.1           4615-5737
            5864-5864           AL109609.5         35892-35892         c
            5865-12838          M18533.1           5739-12712
            12839-14083         BC028720.1         3398-4642
FEATURES             Location/Qualifiers
     source          1..14083
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="X"
                     /map="Xp21.2"
     gene            1..14083
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="dystrophin"
                     /db_xref="GeneID:1756"
                     /db_xref="HGNC:2928"
                     /db_xref="HPRD:02303"
                     /db_xref="MIM:300377"
     variation       44
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72470539"
     variation       176
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72470538"
     misc_feature    287..289
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="upstream in-frame stop codon"
     CDS             704..11392
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Dp427p2 isoform is encoded by transcript variant
                     Dp427p2"
                     /codon_start=1
                     /product="dystrophin Dp427p2 isoform"
                     /protein_id="NP_004001.1"
                     /db_xref="GI:5032315"
                     /db_xref="GeneID:1756"
                     /db_xref="HGNC:2928"
                     /db_xref="HPRD:02303"
                     /db_xref="MIM:300377"
                     /translation="
MKNIMAGLQQTNSEKILLSWVRQSTRNYPQVNVINFTTSWSDGLALNALIHSHRPDLFDWNSVVCQQSATQRLEHAFNIARYQLGIEKLLDPEDVDTTYPDKKSILMYITSLFQVLPQQVSIEAIQEVEMLPRPPKVTKEEHFQLHHQMHYSQQITVSLAQGYERTSSPKPRFKSYAYTQAAYVTTSDPTRSPFPSQHLEAPEDKSFGSSLMESEVNLDRYQTALEEVLSWLLSAEDTLQAQGEISNDVEVVKDQFHTHEGYMMDLTAHQGRVGNILQLGSKLIGTGKLSEDEETEVQEQMNLLNSRWECLRVASMEKQSNLHRVLMDLQNQKLKELNDWLTKTEERTRKMEEEPLGPDLEDLKRQVQQHKVLQEDLEQEQVRVNSLTHMVVVVDESSGDHATAALEEQLKVLGDRWANICRWTEDRWVLLQDILLKWQRLTEEQCLFSAWLSEKEDAVNKIHTTGFKDQNEMLSSLQKLAVLKADLEKKKQSMGKLYSLKQDLLSTLKNKSVTQKTEAWLDNFARCWDNLVQKLEKSTAQISQAVTTTQPSLTQTTVMETVTTVTTREQILVKHAQEELPPPPPQKKRQITVDSEIRKRLDVDITELHSWITRSEAVLQSPEFAIFRKEGNFSDLKEKVNAIEREKAEKFRKLQDASRSAQALVEQMVNEGVNADSIKQASEQLNSRWIEFCQLLSERLNWLEYQNNIIAFYNQLQQLEQMTTTAENWLKIQPTTPSEPTAIKSQLKICKDEVNRLSGLQPQIERLKIQSIALKEKGQGPMFLDADFVAFTNHFKQVFSDVQAREKELQTIFDTLPPMRYQETMSAIRTWVQQSETKLSIPQLSVTDYEIMEQRLGELQALQSSLQEQQSGLYYLSTTVKEMSKKAPSEISRKYQSEFEEIEGRWKKLSSQLVEHCQKLEEQMNKLRKIQNHIQTLKKWMAEVDVFLKEEWPALGDSEILKKQLKQCRLLVSDIQTIQPSLNSVNEGGQKIKNEAEPEFASRLETELKELNTQWDHMCQQVYARKEALKGGLEKTVSLQKDLSEMHEWMTQAEEEYLERDFEYKTPDELQKAVEEMKRAKEEAQQKEAKVKLLTESVNSVIAQAPPVAQEALKKELETLTTNYQWLCTRLNGKCKTLEEVWACWHELLSYLEKANKWLNEVEFKLKTTENIPGGAEEISEVLDSLENLMRHSEDNPNQIRILAQTLTDGGVMDELINEELETFNSRWRELHEEAVRRQKLLEQSIQSAQETEKSLHLIQESLTFIDKQLAAYIADKVDAAQMPQEAQKIQSDLTSHEISLEEMKKHNQGKEAAQRVLSQIDVAQKKLQDVSMKFRLFQKPANFEQRLQESKMILDEVKMHLPALETKSVEQEVVQSQLNHCVNLYKSLSEVKSEVEMVIKTGRQIVQKKQTENPKELDERVTALKLHYNELGAKVTERKQQLEKCLKLSRKMRKEMNVLTEWLAATDMELTKRSAVEGMPSNLDSEVAWGKATQKEIEKQKVHLKSITEVGEALKTVLGKKETLVEDKLSLLNSNWIAVTSRAEEWLNLLLEYQKHMETFDQNVDHITKWIIQADTLLDESEKKKPQQKEDVLKRLKAELNDIRPKVDSTRDQAANLMANRGDHCRKLVEPQISELNHRFAAISHRIKTGKASIPLKELEQFNSDIQKLLEPLEAEIQQGVNLKEEDFNKDMNEDNEGTVKELLQRGDNLQQRITDERKREEIKIKQQLLQTKHNALKDLRSQRRKKALEISHQWYQYKRQADDLLKCLDDIEKKLASLPEPRDERKIKEIDRELQKKKEELNAVRRQAEGLSEDGAAMAVEPTQIQLSKRWREIESKFAQFRRLNFAQIHTVREETMMVMTEDMPLEISYVPSTYLTEITHVSQALLEVEQLLNAPDLCAKDFEDLFKQEESLKNIKDSLQQSSGRIDIIHSKKTAALQSATPVERVKLQEALSQLDFQWEKVNKMYKDRQGRFDRSVEKWRRFHYDIKIFNQWLTEAEQFLRKTQIPENWEHAKYKWYLKELQDGIGQRQTVVRTLNATGEEIIQQSSKTDASILQEKLGSLNLRWQEVCKQLSDRKKRLEEQKNILSEFQRDLNEFVLWLEEADNIASIPLEPGKEQQLKEKLEQVKLLVEELPLRQGILKQLNETGGPVLVSAPISPEEQDKLENKLKQTNLQWIKVSRALPEKQGEIEAQIKDLGQLEKKLEDLEEQLNHLLLWLSPIRNQLEIYNQPNQEGPFDVQETEIAVQAKQPDVEEILSKGQHLYKEKPATQPVKRKLEDLSSEWKAVNRLLQELRAKQPDLAPGLTTIGASPTQTVTLVTQPVVTKETAISKLEMPSSLMLEVPALADFNRAWTELTDWLSLLDQVIKSQRVMVGDLEDINEMIIKQKATMQDLEQRRPQLEELITAAQNLKNKTSNQEARTIITDRIERIQNQWDEVQEHLQNRRQQLNEMLKDSTQWLEAKEEAEQVLGQARAKLESWKEGPYTVDAIQKKITETKQLAKDLRQWQTNVDVANDLALKLLRDYSADDTRKVHMITENINASWRSIHKRVSEREAALEETHRLLQQFPLDLEKFLAWLTEAETTANVLQDATRKERLLEDSKGVKELMKQWQDLQGEIEAHTDVYHNLDENSQKILRSLEGSDDAVLLQRRLDNMNFKWSELRKKSLNIRSHLEASSDQWKRLHLSLQELLVWLQLKDDELSRQAPIGGDFPAVQKQNDVHRAFKRELKTKEPVIMSTLETVRIFLTEQPLEGLEKLYQEPRELPPEERAQNVTRLLRKQAEEVNTEWEKLNLHSADWQRKIDETLERLQELQEATDELDLKLRQAEVIKGSWQPVGDLLIDSLQDHLEKVKALRGEIAPLKENVSHVNDLARQLTTLGIQLSPYNLSTLEDLNTRWKLLQVAVEDRVRQLHEAHRDFGPASQHFLSTSVQGPWERAISPNKVPYYINHETQTTCWDHPKMTELYQSLADLNNVRFSAYRTAMKLRRLQKALCLDLLSLSAACDALDQHNLKQNDQPMDILQIINCLTTIYDRLEQEHNNLVNVPLCVDMCLNWLLNVYDTGRTGRIRVLSFKTGIISLCKAHLEDKYRYLFKQVASSTGFCDQRRLGLLLHDSIQIPRQLGEVASFGGSNIEPSVRSCFQFANNKPEIEAALFLDWMRLEPQSMVWLPVLHRVAAAETAKHQAKCNICKECPIIGFRYRSLKHFNYDICQSCFFSGRVAKGHKMHYPMVEYCTPTTSGEDVRDFAKVLKNKFRTKRYFAKHPRMGYLPVQTVLEGDNMETPVTLINFWPVDSAPASSPQLSHDDTHSRIEHYASRLAEMENSNGSYLNDSISPNESIDDEHLLIQHYCQSLNQDSPLSQPRSPAQILISLESEERGELERILADLEEENRNLQAEYDRLKQQHEHKGLSPLPSPPEMMPTSPQSPRDAELIAEAKLLRQHKGRLEARMQILEDHNKQLESQLHRLRQLLEQPQAEAKVNGTTVSSPSTSLQRSDSSQPMLLRVVGSQTSDSMGEEDLLSPPQDTSTGLEEVMEQLNNSFPSSRGRNTPGKPMREDTM
"
     misc_feature    737..1054
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Calponin homology domain; actin-binding domain
                     which may be present as a single copy or in tandem repeats
                     (which increases binding affinity). The CH domain is found
                     in cytoskeletal and signal transduction proteins,
                     including actin-binding proteins like...; Region: CH;
                     cd00014"
                     /db_xref="CDD:28898"
     misc_feature    order(737..742,746..754,761..763,770..772,932..937,
                     944..946,956..958,962..964,1010..1015,1022..1027,
                     1031..1036,1043..1048)
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="putative actin binding surface [polypeptide
                     binding]; other site"
                     /db_xref="CDD:28898"
     misc_feature    1355..2008
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    1676..1693
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    1793..2341
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    2006..2023
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    2513..3133
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    2819..2836
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    3479..4123
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    3797..3814
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    4136..4756
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    4436..4453
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    4733..5362
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    5039..5056
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    5369..5662
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Spectrin repeat; Region: Spectrin; pfam00435"
                     /db_xref="CDD:201223"
     misc_feature    5444..6271
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Uncharacterized archaeal coiled-coil protein
                     [Function unknown]; Region: COG1340"
                     /db_xref="CDD:31531"
     misc_feature    5672..6238
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    5960..5977
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    6332..6958
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    6638..6655
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    6647..7294
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    order(6959..6967,6971..6979)
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    7748..8398
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    8066..8083
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    8402..9133
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    8741..8758
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    9137..>9469
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Spectrin repeats, found in several proteins
                     involved in cytoskeletal structure; family members include
                     spectrin, alpha-actinin and dystrophin; the spectrin
                     repeat forms a three helix bundle with the second helix
                     interrupted by proline in some sequences; Region: SPEC;
                     cd00176"
                     /db_xref="CDD:29138"
     misc_feature    9455..9469
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="linker region; other site"
                     /db_xref="CDD:29138"
     misc_feature    9509..9598
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Two conserved tryptophans domain; also known as the
                     WWP or rsp5 domain; around 40 amino acids; functions as an
                     interaction module in a diverse set of signalling
                     proteins; binds specific proline-rich sequences but at low
                     affinities compared to other...; Region: WW; cd00201"
                     /db_xref="CDD:29258"
     misc_feature    order(9548..9550,9581..9583)
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="binding pocket"
                     /db_xref="CDD:29258"
     misc_feature    9593..9955
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="EF hand; Region: efhand_1; pfam09068"
                     /db_xref="CDD:149945"
     misc_feature    9965..10240
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="EF-hand; Region: efhand_2; pfam09069"
                     /db_xref="CDD:149946"
     misc_feature    10265..10411
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Zinc finger, ZZ type. Zinc finger present in
                     dystrophin and dystrobrevin. The ZZ motif coordinates two
                     zinc ions and most likely participates in ligand binding
                     or molecular scaffolding. Dystrophin attaches actin
                     filaments to an integral membrane...; Region:
                     ZZ_dystrophin; cd02334"
                     /db_xref="CDD:30238"
     misc_feature    order(10271..10273,10280..10282,10316..10318,10325..10327,
                     10343..10345,10352..10354,10382..10384,10394..10396)
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="Zinc-binding sites [ion binding]; other site"
                     /db_xref="CDD:30238"
     misc_feature    order(10271..10273,10280..10282,10343..10345,10352..10354)
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="zinc cluster 1 [ion binding]; other site"
                     /db_xref="CDD:30238"
     misc_feature    order(10274..10276,10307..10309,10313..10315,10331..10333,
                     10337..10339)
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="putative charged binding surface; other site"
                     /db_xref="CDD:30238"
     misc_feature    order(10310..10312,10355..10357,10400..10402,10409..10411)
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="putative hydrophobic binding surface; other site"
                     /db_xref="CDD:30238"
     misc_feature    order(10316..10318,10325..10327,10382..10384,10394..10396)
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /note="zinc cluster 2 [ion binding]; other site"
                     /db_xref="CDD:30238"
     misc_feature    10607..10609
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     variation       732
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1800256"
     STS             872..980
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="DMD"
                     /db_xref="UniSTS:99269"
     variation       1136
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1800264"
     variation       1171
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1800265"
     variation       1429
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1800266"
     variation       1432
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72470507"
     STS             1612..2186
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="MARC_84337-84338:1278013457:1"
                     /db_xref="UniSTS:532589"
     variation       1671
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72468699"
     variation       2004
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1800257"
     variation       2008
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1800258"
     STS             2074..2660
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="MARC_84339-84340:1278014518:1"
                     /db_xref="UniSTS:532590"
     variation       2201
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1800259"
     variation       2203
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1800267"
     variation       2222
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72468692"
     variation       2685
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1800260"
     variation       2725
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72468681"
     variation       2791
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72468680"
     variation       2824
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72468679"
     variation       3305
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72468667"
     variation       3355
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1800268"
     variation       3364
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72468666"
     variation       3454
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1800261"
     variation       3923
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1800262"
     STS             3941..4039
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="DMD"
                     /db_xref="UniSTS:99474"
     variation       4068
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1800269"
     variation       4166
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1800270"
     variation       4465
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1800263"
     variation       4609
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72468647"
     variation       4740
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1057872"
     variation       4863
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72468638"
     STS             4866..4978
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="DMD"
                     /db_xref="UniSTS:99582"
     variation       5211
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72468634"
     variation       5311
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1801185"
     variation       5374
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72468632"
     variation       5497
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72468630"
     variation       5568
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1801187"
     STS             5745..6302
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="MARC_84357-84358:1278016549:1"
                     /db_xref="UniSTS:532591"
     variation       5793
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1800271"
     variation       5864
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1064325"
     variation       5866
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1801186"
     STS             5970..6064
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="DMD"
                     /db_xref="UniSTS:99541"
     variation       6109
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1800272"
     variation       6362
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72468613"
     STS             6626..6750
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="DMD"
                     /db_xref="UniSTS:99225"
     variation       6797
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1800273"
     STS             7000..7082
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="DMD"
                     /db_xref="UniSTS:99066"
     variation       7162
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72466595"
     variation       7414
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1800274"
     variation       7430
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1800275"
     variation       7517
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72466590"
     STS             7698..7809
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="DXS7499"
                     /db_xref="UniSTS:30753"
     variation       8062
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1801188"
     variation       8154
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72466581"
     STS             8219..8354
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="DMD"
                     /db_xref="UniSTS:99382"
     variation       8389
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1801189"
     STS             8561..8660
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="DMD"
                     /db_xref="UniSTS:99545"
     variation       8656
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72466575"
     variation       8830
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72466574"
     variation       8905
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72466570"
     variation       8913
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72466569"
     variation       9144
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1800280"
     STS             9155..9257
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="DMD"
                     /db_xref="UniSTS:99400"
     variation       9186
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72466567"
     variation       9427
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72466563"
     variation       9428
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72466562"
     STS             9906..9973
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="DMD"
                     /db_xref="UniSTS:99128"
     variation       10954
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72466538"
     variation       11123
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1800281"
     variation       11352
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1795743"
     STS             11474..11667
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="PMC316713P2"
                     /db_xref="UniSTS:273040"
     STS             11742..11930
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="G15848"
                     /db_xref="UniSTS:3168"
     STS             11783..11915
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="DXS1234"
                     /db_xref="UniSTS:146800"
     variation       11872..11873
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace=""
                     /replace="acac"
                     /replace="taca"
                     /db_xref="dbSNP:3833413"
     variation       12316
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace=""
                     /replace="acaa"
                     /db_xref="dbSNP:72466531"
     variation       12360
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:72466530"
     STS             12398..12466
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="DXS503"
                     /db_xref="UniSTS:99031"
     variation       12440
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace=""
                     /replace="gat"
                     /db_xref="dbSNP:72466529"
     variation       12637
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace=""
                     /replace="cttt"
                     /db_xref="dbSNP:72466527"
     STS             12704..12854
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="DXS6988E"
                     /db_xref="UniSTS:32060"
     variation       12839
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3361"
     STS             12860..12960
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="A002S20"
                     /db_xref="UniSTS:57879"
     variation       12957
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace=""
                     /replace="aaag"
                     /db_xref="dbSNP:72466526"
     variation       12983
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace=""
                     /replace="tgtt"
                     /db_xref="dbSNP:72466525"
     variation       13123
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3198427"
     variation       13150
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace=""
                     /replace="ttcat"
                     /db_xref="dbSNP:72466524"
     variation       13431
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72466523"
     variation       13545
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace=""
                     /replace="atgtgacgctggacctt"
                     /db_xref="dbSNP:72466522"
     variation       13577
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:11550191"
     variation       13629
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace=""
                     /replace="aagt"
                     /db_xref="dbSNP:72466521"
     STS             13710..13901
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="DMD"
                     /db_xref="UniSTS:506537"
     variation       13819
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1057915"
     STS             13967..14051
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /standard_name="PMC108984P1"
                     /db_xref="UniSTS:270148"
     variation       13973
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
                     /replace=""
                     /replace="actt"
                     /db_xref="dbSNP:72466520"
     polyA_signal    14061..14066
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
     polyA_site      14083
                     /gene="DMD"
                     /gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
                     DXS239; DXS268; DXS269; DXS270; DXS272"
ORIGIN      
tgctgtctgtgaagctgaatctgtgagaacacctcactattcacggcaaccggagtggaagaaacaggtgcaaaaagattgtgtgtttgtctgcttttgtgaggctggtcagagattctgtgcctgctttatctgtgcttggctatgactctacctccaggtttaccataccccatagaatgtgtaagagaaaagtaccaacagggaaatcagcaaaaagctttcctatgaaggtgtgtagccagcctccgcagaatttgaaatgtctgaggtctcatctggtgagtaaaagctgcagataaatgcaacagccattcagaagaatgataaattccacaagcattcagaagcaggcttccctaaagatgaaagagaagatgttcaaaagaaaacattcacaaaatgggtaaatgcacaattttctaagtttgggaagcagcatattgagaacctcttcagtgacctacaggatgggaggcgcctcctagacctcctcgaaggcctgacagggcaaaaactgccaaaagaaaaaggatccacaagagttcatgccctgaacaatgtcaacaaggcactgcgggttttgcagaacaataatgttgatttagtgaatattggaagtactgacatcgtagatggaaatcataaactgactcttggtttgatttggaatataatcctccactggcaggtcaaaaatgtaatgaaaaatatcatggctggattgcaacaaaccaacagtgaaaagattctcctgagctgggtccgacaatcaactcgtaattatccacaggttaatgtaatcaacttcaccaccagctggtctgatggcctggctttgaatgctctcatccatagtcataggccagacctatttgactggaatagtgtggtttgccagcagtcagccacacaacgactggaacatgcattcaacatcgccagatatcaattaggcatagagaaactactcgatcctgaagatgttgataccacctatccagataagaagtccatcttaatgtacatcacatcactcttccaagttttgcctcaacaagtgagcattgaagccatccaggaagtggaaatgttgccaaggccacctaaagtgactaaagaagaacattttcagttacatcatcaaatgcactattctcaacagatcacggtcagtctagcacagggatatgagagaacttcttcccctaagcctcgattcaagagctatgcctacacacaggctgcttatgtcaccacctctgaccctacacggagcccatttccttcacagcatttggaagctcctgaagacaagtcatttggcagttcattgatggagagtgaagtaaacctggaccgttatcaaacagctttagaagaagtattatcgtggcttctttctgctgaggacacattgcaagcacaaggagagatttctaatgatgtggaagtggtgaaagaccagtttcatactcatgaggggtacatgatggatttgacagcccatcagggccgggttggtaatattctacaattgggaagtaagctgattggaacaggaaaattatcagaagatgaagaaactgaagtacaagagcagatgaatctcctaaattcaagatgggaatgcctcagggtagctagcatggaaaaacaaagcaatttacatagagttttaatggatctccagaatcagaaactgaaagagttgaatgactggctaacaaaaacagaagaaagaacaaggaaaatggaggaagagcctcttggacctgatcttgaagacctaaaacgccaagtacaacaacataaggtgcttcaagaagatctagaacaagaacaagtcagggtcaattctctcactcacatggtggtggtagttgatgaatctagtggagatcacgcaactgctgctttggaagaacaacttaaggtattgggagatcgatgggcaaacatctgtagatggacagaagaccgctgggttcttttacaagacatccttctcaaatggcaacgtcttactgaagaacagtgcctttttagtgcatggctttcagaaaaagaagatgcagtgaacaagattcacacaactggctttaaagatcaaaatgaaatgttatcaagtcttcaaaaactggccgttttaaaagcggatctagaaaagaaaaagcaatccatgggcaaactgtattcactcaaacaagatcttctttcaacactgaagaataagtcagtgacccagaagacggaagcatggctggataactttgcccggtgttgggataatttagtccaaaaacttgaaaagagtacagcacagatttcacaggctgtcaccaccactcagccatcactaacacagacaactgtaatggaaacagtaactacggtgaccacaagggaacagatcctggtaaagcatgctcaagaggaacttccaccaccacctccccaaaagaagaggcagattactgtggattctgaaattaggaaaaggttggatgttgatataactgaacttcacagctggattactcgctcagaagctgtgttgcagagtcctgaatttgcaatctttcggaaggaaggcaacttctcagacttaaaagaaaaagtcaatgccatagagcgagaaaaagctgagaagttcagaaaactgcaagatgccagcagatcagctcaggccctggtggaacagatggtgaatgagggtgttaatgcagatagcatcaaacaagcctcagaacaactgaacagccggtggatcgaattctgccagttgctaagtgagagacttaactggctggagtatcagaacaacatcatcgctttctataatcagctacaacaattggagcagatgacaactactgctgaaaactggttgaaaatccaacccaccaccccatcagagccaacagcaattaaaagtcagttaaaaatttgtaaggatgaagtcaaccggctatcaggtcttcaacctcaaattgaacgattaaaaattcaaagcatagccctgaaagagaaaggacaaggacccatgttcctggatgcagactttgtggcctttacaaatcattttaagcaagtcttttctgatgtgcaggccagagagaaagagctacagacaatttttgacactttgccaccaatgcgctatcaggagaccatgagtgccatcaggacatgggtccagcagtcagaaaccaaactctccatacctcaacttagtgtcaccgactatgaaatcatggagcagagactcggggaattgcaggctttacaaagttctctgcaagagcaacaaagtggcctatactatctcagcaccactgtgaaagagatgtcgaagaaagcgccctctgaaattagccggaaatatcaatcagaatttgaagaaattgagggacgctggaagaagctctcctcccagctggttgagcattgtcaaaagctagaggagcaaatgaataaactccgaaaaattcagaatcacatacaaaccctgaagaaatggatggctgaagttgatgtttttctgaaggaggaatggcctgcccttggggattcagaaattctaaaaaagcagctgaaacagtgcagacttttagtcagtgatattcagacaattcagcccagtctaaacagtgtcaatgaaggtgggcagaagataaagaatgaagcagagccagagtttgcttcgagacttgagacagaactcaaagaacttaacactcagtgggatcacatgtgccaacaggtctatgccagaaaggaggccttgaagggaggtttggagaaaactgtaagcctccagaaagatctatcagagatgcacgaatggatgacacaagctgaagaagagtatcttgagagagattttgaatataaaactccagatgaattacagaaagcagttgaagagatgaagagagctaaagaagaggcccaacaaaaagaagcgaaagtgaaactccttactgagtctgtaaatagtgtcatagctcaagctccacctgtagcacaagaggccttaaaaaaggaacttgaaactctaaccaccaactaccagtggctctgcactaggctgaatgggaaatgcaagactttggaagaagtttgggcatgttggcatgagttattgtcatacttggagaaagcaaacaagtggctaaatgaagtagaatttaaacttaaaaccactgaaaacattcctggcggagctgaggaaatctctgaggtgctagattcacttgaaaatttgatgcgacattcagaggataacccaaatcagattcgcatattggcacagaccctaacagatggcggagtcatggatgagctaatcaatgaggaacttgagacatttaattctcgttggagggaactacatgaagaggctgtaaggaggcaaaagttgcttgaacagagcatccagtctgcccaggagactgaaaaatccttacacttaatccaggagtccctcacattcattgacaagcagttggcagcttatattgcagacaaggtggacgcagctcaaatgcctcaggaagcccagaaaatccaatctgatttgacaagtcatgagatcagtttagaagaaatgaagaaacataatcaggggaaggaggctgcccaaagagtcctgtctcagattgatgttgcacagaaaaaattacaagatgtctccatgaagtttcgattattccagaaaccagccaattttgagcagcgtctacaagaaagtaagatgattttagatgaagtgaagatgcacttgcctgcattggaaacaaagagtgtggaacaggaagtagtacagtcacagctaaatcattgtgtgaacttgtataaaagtctgagtgaagtgaagtctgaagtggaaatggtgataaagactggacgtcagattgtacagaaaaagcagacggaaaatcccaaagaacttgatgaaagagtaacagctttgaaattgcattataatgagctgggagcaaaggtaacagaaagaaagcaacagttggagaaatgcttgaaattgtcccgtaagatgcgaaaggaaatgaatgtcttgacagaatggctggcagctacagatatggaattgacaaagagatcagcagttgaaggaatgcctagtaatttggattctgaagttgcctggggaaaggctactcaaaaagagattgagaaacagaaggtgcacctgaagagtatcacagaggtaggagaggccttgaaaacagttttgggcaagaaggagacgttggtggaagataaactcagtcttctgaatagtaactggatagctgtcacctcccgagcagaagagtggttaaatcttttgttggaataccagaaacacatggaaacttttgaccagaatgtggaccacatcacaaagtggatcattcaggctgacacacttttggatgaatcagagaaaaagaaaccccagcaaaaagaagacgtgcttaagcgtttaaaggcagaactgaatgacatacgcccaaaggtggactctacacgtgaccaagcagcaaacttgatggcaaaccgcggtgaccactgcaggaaattagtagagccccaaatctcagagctcaaccatcgatttgcagccatttcacacagaattaagactggaaaggcctccattcctttgaaggaattggagcagtttaactcagatatacaaaaattgcttgaaccactggaggctgaaattcagcagggggtgaatctgaaagaggaagacttcaataaagatatgaatgaagacaatgagggtactgtaaaagaattgttgcaaagaggagacaacttacaacaaagaatcacagatgagagaaagcgagaggaaataaagataaaacagcagctgttacagacaaaacataatgctctcaaggatttgaggtctcaaagaagaaaaaaggctctagaaatttctcatcagtggtatcagtacaagaggcaggctgatgatctcctgaaatgcttggatgacattgaaaaaaaattagccagcctacctgagcccagagatgaaaggaaaataaaggaaattgatcgggaattgcagaagaagaaagaggagctgaatgcagtgcgtaggcaagctgagggcttgtctgaggatggggccgcaatggcagtggagccaactcagatccagctcagcaagcgctggcgggaaattgagagcaaatttgctcagtttcgaagactcaactttgcacaaattcacactgtccgtgaagaaacgatgatggtgatgactgaagacatgcctttggaaatttcttatgtgccttctacttatttgactgaaatcactcatgtctcacaagccctattagaagtggaacaacttctcaatgctcctgacctctgtgctaaggactttgaagatctctttaagcaagaggagtctctgaagaatataaaagatagtctacaacaaagctcaggtcggattgacattattcatagcaagaagacagcagcattgcaaagtgcaacgcctgtggaaagggtgaagctacaggaagctctctcccagcttgatttccaatgggaaaaagttaacaaaatgtacaaggaccgacaagggcgatttgacagatctgttgagaaatggcggcgttttcattatgatataaagatatttaatcagtggctaacagaagctgaacagtttctcagaaagacacaaattcctgagaattgggaacatgctaaatacaaatggtatcttaaggaactccaggatggcattgggcagcggcaaactgttgtcagaacattgaatgcaactggggaagaaataattcagcaatcctcaaaaacagatgccagtattctacaggaaaaattgggaagcctgaatctgcggtggcaggaggtctgcaaacagctgtcagacagaaaaaagaggctagaagaacaaaagaatatcttgtcagaatttcaaagagatttaaatgaatttgttttatggttggaggaagcagataacattgctagtatcccacttgaacctggaaaagagcagcaactaaaagaaaagcttgagcaagtcaagttactggtggaagagttgcccctgcgccagggaattctcaaacaattaaatgaaactggaggacccgtgcttgtaagtgctcccataagcccagaagagcaagataaacttgaaaataagctcaagcagacaaatctccagtggataaaggtttccagagctttacctgagaaacaaggagaaattgaagctcaaataaaagaccttgggcagcttgaaaaaaagcttgaagaccttgaagagcagttaaatcatctgctgctgtggttatctcctattaggaatcagttggaaatttataaccaaccaaaccaagaaggaccatttgacgttcaggaaactgaaatagcagttcaagctaaacaaccggatgtggaagagattttgtctaaagggcagcatttgtacaaggaaaaaccagccactcagccagtgaagaggaagttagaagatctgagctctgagtggaaggcggtaaaccgtttacttcaagagctgagggcaaagcagcctgacctagctcctggactgaccactattggagcctctcctactcagactgttactctggtgacacaacctgtggttactaaggaaactgccatctccaaactagaaatgccatcttccttgatgttggaggtacctgctctggcagatttcaaccgggcttggacagaacttaccgactggctttctctgcttgatcaagttataaaatcacagagggtgatggtgggtgaccttgaggatatcaacgagatgatcatcaagcagaaggcaacaatgcaggatttggaacagaggcgtccccagttggaagaactcattaccgctgcccaaaatttgaaaaacaagaccagcaatcaagaggctagaacaatcattacggatcgaattgaaagaattcagaatcagtgggatgaagtacaagaacaccttcagaaccggaggcaacagttgaatgaaatgttaaaggattcaacacaatggctggaagctaaggaagaagctgagcaggtcttaggacaggccagagccaagcttgagtcatggaaggagggtccctatacagtagatgcaatccaaaagaaaatcacagaaaccaagcagttggccaaagacctccgccagtggcagacaaatgtagatgtggcaaatgacttggccctgaaacttctccgggattattctgcagatgataccagaaaagtccacatgataacagagaatatcaatgcctcttggagaagcattcataaaagggtgagtgagcgagaggctgctttggaagaaactcatagattactgcaacagttccccctggacctggaaaagtttcttgcctggcttacagaagctgaaacaactgccaatgtcctacaggatgctacccgtaaggaaaggctcctagaagactccaagggagtaaaagagctgatgaaacaatggcaagacctccaaggtgaaattgaagctcacacagatgtttatcacaacctggatgaaaacagccaaaaaatcctgagatccctggaaggttccgatgatgcagtcctgttacaaagacgtttggataacatgaacttcaagtggagtgaacttcggaaaaagtctctcaacattaggtcccatttggaagccagttctgaccagtggaagcgtctgcacctttctctgcaggaacttctggtgtggctacagctgaaagatgatgaattaagccggcaggcacctattggaggcgactttccagcagttcagaagcagaacgatgtacatagggccttcaagagggaattgaaaactaaagaacctgtaatcatgagtactcttgagactgtacgaatatttctgacagagcagcctttggaaggactagagaaactctaccaggagcccagagagctgcctcctgaggagagagcccagaatgtcactcggcttctacgaaagcaggctgaggaggtcaatactgagtgggaaaaattgaacctgcactccgctgactggcagagaaaaatagatgagacccttgaaagactccaggaacttcaagaggccacggatgagctggacctcaagctgcgccaagctgaggtgatcaagggatcctggcagcccgtgggcgatctcctcattgactctctccaagatcacctcgagaaagtcaaggcacttcgaggagaaattgcgcctctgaaagagaacgtgagccacgtcaatgaccttgctcgccagcttaccactttgggcattcagctctcaccgtataacctcagcactctggaagacctgaacaccagatggaagcttctgcaggtggccgtcgaggaccgagtcaggcagctgcatgaagcccacagggactttggtccagcatctcagcactttctttccacgtctgtccagggtccctgggagagagccatctcgccaaacaaagtgccctactatatcaaccacgagactcaaacaacttgctgggaccatcccaaaatgacagagctctaccagtctttagctgacctgaataatgtcagattctcagcttataggactgccatgaaactccgaagactgcagaaggccctttgcttggatctcttgagcctgtcagctgcatgtgatgccttggaccagcacaacctcaagcaaaatgaccagcccatggatatcctgcagattattaattgtttgaccactatttatgaccgcctggagcaagagcacaacaatttggtcaacgtccctctctgcgtggatatgtgtctgaactggctgctgaatgtttatgatacgggacgaacagggaggatccgtgtcctgtcttttaaaactggcatcatttccctgtgtaaagcacatttggaagacaagtacagataccttttcaagcaagtggcaagttcaacaggattttgtgaccagcgcaggctgggcctccttctgcatgattctatccaaattccaagacagttgggtgaagttgcatcctttgggggcagtaacattgagccaagtgtccggagctgcttccaatttgctaataataagccagagatcgaagcggccctcttcctagactggatgagactggaaccccagtccatggtgtggctgcccgtcctgcacagagtggctgctgcagaaactgccaagcatcaggccaaatgtaacatctgcaaagagtgtccaatcattggattcaggtacaggagtctaaagcactttaattatgacatctgccaaagctgctttttttctggtcgagttgcaaaaggccataaaatgcactatcccatggtggaatattgcactccgactacatcaggagaagatgttcgagactttgccaaggtactaaaaaacaaatttcgaaccaaaaggtattttgcgaagcatccccgaatgggctacctgccagtgcagactgtcttagagggggacaacatggaaactcccgttactctgatcaacttctggccagtagattctgcgcctgcctcgtcccctcagctttcacacgatgatactcattcacgcattgaacattatgctagcaggctagcagaaatggaaaacagcaatggatcttatctaaatgatagcatctctcctaatgagagcatagatgatgaacatttgttaatccagcattactgccaaagtttgaaccaggactcccccctgagccagcctcgtagtcctgcccagatcttgatttccttagagagtgaggaaagaggggagctagagagaatcctagcagatcttgaggaagaaaacaggaatctgcaagcagaatatgaccgtctaaagcagcagcacgaacataaaggcctgtccccactgccgtcccctcctgaaatgatgcccacctctccccagagtccccgggatgctgagctcattgctgaggccaagctactgcgtcaacacaaaggccgcctggaagccaggatgcaaatcctggaagaccacaataaacagctggagtcacagttacacaggctaaggcagctgctggagcaaccccaggcagaggccaaagtgaatggcacaacggtgtcctctccttctacctctctacagaggtccgacagcagtcagcctatgctgctccgagtggttggcagtcaaacttcggactccatgggtgaggaagatcttctcagtcctccccaggacacaagcacagggttagaggaggtgatggagcaactcaacaactccttccctagttcaagaggaagaaatacccctggaaagccaatgagagaggacacaatgtaggaagtcttttccacatggcagatgatttgggcagagcgatggagtccttagtatcagtcatgacagatgaagaaggagcagaataaatgttttacaactcctgattcccgcatggtttttataatattcatacaacaaagaggattagacagtaagagtttacaagaaataaatctatatttttgtgaagggtagtggtattatactgtagatttcagtagtttctaagtctgttattgttttgttaacaatggcaggttttacacgtctatgcaattgtacaaaaaagttataagaaaactacatgtaaaatcttgatagctaaataacttgccatttctttatatggaacgcattttgggttgtttaaaaatttataacagttataaagaaagattgtaaactaaagtgtgctttataaaaaaaagttgtttataaaaacccctaaaaacaaaacaaacacacacacacacacatacacacacacacacaaaactttgaggcagcgcattgttttgcatccttttggcgtgatatccatatgaaattcatggctttttctttttttgcatattaaagataagacttcctctaccaccacaccaaatgactactacacactgctcatttgagaactgtcagctgagtggggcaggcttgagttttcatttcatatatctatatgtctataagtatataaatactatagttatatagataaagagatacgaatttctatagactgactttttccattttttaaatgttcatgtcacatcctaatagaaagaaattacttctagtcagtcatccaggcttacctgcttggtctagaatggatttttcccggagccggaagccaggaggaaactacaccacactaaaacattgtctacagctccagatgtttctcattttaaacaactttccactgacaacgaaagtaaagtaaagtattggatttttttaaagggaacatgtgaatgaatacacaggacttattatatcagagtgagtaatcggttggttggttgattgattgattgattgatacattcagcttcctgctgctagcaatgccacgatttagatttaatgatgcttcagtggaaatcaatcagaaggtattctgaccttgtgaacatcagaaggtattttttaactcccaagcagtagcaggacgatgatagggctggagggctatggattcccagcccatccctgtgaaggagtaggccactctttaagtgaaggattggatgattgttcataatacataaagttctctgtaattacaactaaattattatgccctcttctcacagtcaaaaggaactgggtggtttggtttttgttgcttttttagatttattgtcccatgtgggatgagtttttaaatgccacaagacataatttaaaataaataaactttgggaaaaggtgtaaaacagtagccccatcacatttgtgatactgacaggtatcaacccagaagcccatgaactgtgtttccatcctttgcatttctctgcgagtagttccacacaggtttgtaagtaagtaagaaagaaggcaaattgattcaaatgttacaaaaaaacccttcttggtggattagacaggttaaatatataaacaaacaaacaaaaattgctcaaaaaagaggagaaaagctcaagaggaaaagctaaggactggtaggaaaaagctttactctttcatgccattttatttctttttgatttttaaatcattcattcaatagataccaccgtgtgacctataattttgcaaatctgttacctctgacatcaagtgtaattagcttttggagagtgggctgacatcaagtgtaattagcttttggagagtgggttttgtccattattaataattaattaattaacatcaaacacggcttctcatgctatttctacctcactttggttttggggtgttcctgataattgtgcacacctgagttcacagcttcaccacttgtccattgcgttattttctttttcctttataattctttctttttccttcataattttcaaaagaaaacccaaagctctaaggtaacaaattaccaaattacatgaagatttggtttttgtcttgcatttttttcctttatgtgacgctggaccttttctttacccaaggatttttaaaactcagatttaaaacaaggggttactttacatcctactaagaagtttaagtaagtaagtttcattctaaaatcagaggtaaatagagtgcataaataattttgttttaatctttttgtttttcttttagacacattagctctggagtgagtctgtcataatatttgaacaaaaattgagagctttattgctgcattttaagcataattaatttggacattatttcgtgttgtgttctttataaccaccaagtattaaactgtaaatcataatgtaactgaagcataaacatcacatggcatgttttgtcattgttttcaggtactgagttcttacttgagtatcataatatattgtgttttaacaccaacactgtaacatttacgaattatttttttaaacttcagttttactgcattttcacaacatatcagacttcaccaaatatatgccttactattgtattatagtactgctttactgtgtatctcaataaagcacgcagttatgttac
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:1756 -> Molecular function: GO:0002162 [dystroglycan binding] evidence: IPI
            GeneID:1756 -> Molecular function: GO:0003779 [actin binding] evidence: IDA
            GeneID:1756 -> Molecular function: GO:0003779 [actin binding] evidence: TAS
            GeneID:1756 -> Molecular function: GO:0005200 [structural constituent of cytoskeleton] evidence: TAS
            GeneID:1756 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA
            GeneID:1756 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:1756 -> Molecular function: GO:0008270 [zinc ion binding] evidence: IEA
            GeneID:1756 -> Molecular function: GO:0008307 [structural constituent of muscle] evidence: IDA
            GeneID:1756 -> Molecular function: GO:0008307 [structural constituent of muscle] evidence: TAS
            GeneID:1756 -> Molecular function: GO:0017022 [myosin binding] evidence: IDA
            GeneID:1756 -> Molecular function: GO:0017166 [vinculin binding] evidence: IPI
            GeneID:1756 -> Molecular function: GO:0050998 [nitric-oxide synthase binding] evidence: ISS
            GeneID:1756 -> Biological process: GO:0001954 [positive regulation of cell-matrix adhesion] evidence: IEA
            GeneID:1756 -> Biological process: GO:0002027 [regulation of heart rate] evidence: IMP
            GeneID:1756 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: IEA
            GeneID:1756 -> Biological process: GO:0007517 [muscle organ development] evidence: NAS
            GeneID:1756 -> Biological process: GO:0008065 [establishment of blood-nerve barrier] evidence: IEA
            GeneID:1756 -> Biological process: GO:0010880 [regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum] evidence: ISS
            GeneID:1756 -> Biological process: GO:0010881 [regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion] evidence: ISS
            GeneID:1756 -> Biological process: GO:0010976 [positive regulation of neuron projection development] evidence: IMP
            GeneID:1756 -> Biological process: GO:0014809 [regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion] evidence: ISS
            GeneID:1756 -> Biological process: GO:0014819 [regulation of skeletal muscle contraction] evidence: ISS
            GeneID:1756 -> Biological process: GO:0014904 [myotube cell development] evidence: IEA
            GeneID:1756 -> Biological process: GO:0021629 [olfactory nerve structural organization] evidence: IEA
            GeneID:1756 -> Biological process: GO:0030049 [muscle filament sliding] evidence: TAS
            GeneID:1756 -> Biological process: GO:0030198 [extracellular matrix organization] evidence: TAS
            GeneID:1756 -> Biological process: GO:0033137 [negative regulation of peptidyl-serine phosphorylation] evidence: ISS
            GeneID:1756 -> Biological process: GO:0034613 [cellular protein localization] evidence: IMP
            GeneID:1756 -> Biological process: GO:0043043 [peptide biosynthetic process] evidence: IDA
            GeneID:1756 -> Biological process: GO:0043623 [cellular protein complex assembly] evidence: ISS
            GeneID:1756 -> Biological process: GO:0044458 [motile cilium assembly] evidence: TAS
            GeneID:1756 -> Biological process: GO:0045213 [neurotransmitter receptor metabolic process] evidence: IEA
            GeneID:1756 -> Biological process: GO:0045666 [positive regulation of neuron differentiation] evidence: IMP
            GeneID:1756 -> Biological process: GO:0046716 [muscle cell homeostasis] evidence: IEA
            GeneID:1756 -> Biological process: GO:0048747 [muscle fiber development] evidence: IEA
            GeneID:1756 -> Biological process: GO:0051647 [nucleus localization] evidence: IEA
            GeneID:1756 -> Biological process: GO:0060048 [cardiac muscle contraction] evidence: IMP
            GeneID:1756 -> Biological process: GO:0060314 [regulation of ryanodine-sensitive calcium-release channel activity] evidence: ISS
            GeneID:1756 -> Biological process: GO:0060857 [establishment of glial blood-brain barrier] evidence: IEA
            GeneID:1756 -> Biological process: GO:0086001 [regulation of cardiac muscle cell action potential] evidence: ISS
            GeneID:1756 -> Biological process: GO:0090287 [regulation of cellular response to growth factor stimulus] evidence: IMP
            GeneID:1756 -> Biological process: GO:1901385 [regulation of voltage-gated calcium channel activity] evidence: ISS
            GeneID:1756 -> Biological process: GO:2000169 [regulation of peptidyl-cysteine S-nitrosylation] evidence: ISS
            GeneID:1756 -> Biological process: GO:2000651 [positive regulation of sodium ion transmembrane transporter activity] evidence: ISS
            GeneID:1756 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:1756 -> Cellular component: GO:0005634 [nucleus] evidence: TAS
            GeneID:1756 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
            GeneID:1756 -> Cellular component: GO:0005856 [cytoskeleton] evidence: IEA
            GeneID:1756 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
            GeneID:1756 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS
            GeneID:1756 -> Cellular component: GO:0009986 [cell surface] evidence: IDA
            GeneID:1756 -> Cellular component: GO:0015629 [actin cytoskeleton] evidence: TAS
            GeneID:1756 -> Cellular component: GO:0016010 [dystrophin-associated glycoprotein complex] evidence: IDA
            GeneID:1756 -> Cellular component: GO:0016010 [dystrophin-associated glycoprotein complex] evidence: NAS
            GeneID:1756 -> Cellular component: GO:0016010 [dystrophin-associated glycoprotein complex] evidence: TAS
            GeneID:1756 -> Cellular component: GO:0030018 [Z disc] evidence: IEA
            GeneID:1756 -> Cellular component: GO:0030055 [cell-substrate junction] evidence: IEA
            GeneID:1756 -> Cellular component: GO:0030175 [filopodium] evidence: IDA
            GeneID:1756 -> Cellular component: GO:0042383 [sarcolemma] evidence: IDA
            GeneID:1756 -> Cellular component: GO:0043034 [costamere] evidence: IDA
            GeneID:1756 -> Cellular component: GO:0043234 [protein complex] evidence: IDA
            GeneID:1756 -> Cellular component: GO:0044306 [neuron projection terminus] evidence: IEA
            GeneID:1756 -> Cellular component: GO:0045121 [membrane raft] evidence: IEA
            GeneID:1756 -> Cellular component: GO:0045121 [membrane raft] evidence: TAS
            GeneID:1756 -> Cellular component: GO:0045211 [postsynaptic membrane] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.