Home |
Help |
Advanced search
2024-04-19 18:57:37, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_004009 14000 bp mRNA linear PRI 26-MAY-2013
DEFINITION Homo sapiens dystrophin (DMD), transcript variant Dp427p1, mRNA.
ACCESSION NM_004009
VERSION NM_004009.3 GI:238018046
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 14000)
AUTHORS Suzuki,H., Kameyama,T., Ohe,K., Tsukahara,T. and Mayeda,A.
TITLE Nested introns in an intron: evidence of multi-step splicing in a
large intron of the human dystrophin pre-mRNA
JOURNAL FEBS Lett. 587 (6), 555-561 (2013)
PUBMED 23395799
REMARK GeneRIF: The evidence obtained for multi-step splicing in a large
intron of the human dystrophin pre-mRNA.
REFERENCE 2 (bases 1 to 14000)
AUTHORS Singh,S.M. and Mallela,K.M.
TITLE The N-terminal actin-binding tandem calponin-homology (CH) domain
of dystrophin is in a closed conformation in solution and when
bound to F-actin
JOURNAL Biophys. J. 103 (9), 1970-1978 (2012)
PUBMED 23199925
REMARK GeneRIF: In solution, dystrophin N-terminal actin-binding domain
binds to F-actin in a closed conformation.
REFERENCE 3 (bases 1 to 14000)
AUTHORS Bovolenta,M., Erriquez,D., Valli,E., Brioschi,S., Scotton,C.,
Neri,M., Falzarano,M.S., Gherardi,S., Fabris,M., Rimessi,P.,
Gualandi,F., Perini,G. and Ferlini,A.
TITLE The DMD locus harbours multiple long non-coding RNAs which
orchestrate and control transcription of muscle dystrophin mRNA
isoforms
JOURNAL PLoS ONE 7 (9), E45328 (2012)
PUBMED 23028937
REMARK GeneRIF: Findings reveal that DMD lncRNAs may contribute to the
orchestration and homeostasis of the muscle dystrophin expression
pattern by either selective targeting and down-modulating the
dystrophin promoter transcriptional activity.
REFERENCE 4 (bases 1 to 14000)
AUTHORS Brioschi,S., Gualandi,F., Scotton,C., Armaroli,A., Bovolenta,M.,
Falzarano,M.S., Sabatelli,P., Selvatici,R., D'Amico,A., Pane,M.,
Ricci,G., Siciliano,G., Tedeschi,S., Pini,A., Vercelli,L., De
Grandis,D., Mercuri,E., Bertini,E., Merlini,L., Mongini,T. and
Ferlini,A.
TITLE Genetic characterization in symptomatic female DMD carriers: lack
of relationship between X-inactivation, transcriptional DMD allele
balancing and phenotype
JOURNAL BMC Med. Genet. 13, 73 (2012)
PUBMED 22894145
REMARK GeneRIF: No relationship between X-inactivation pattern and
transcriptional behaviour of DMD gene was observed in Duchenne
muscular dystrophies.
Publication Status: Online-Only
REFERENCE 5 (bases 1 to 14000)
AUTHORS Kapoor,S., Bindu,P.S., Taly,A.B., Sinha,S., Gayathri,N., Rani,S.V.,
Chandak,G.R. and Kumar,A.
TITLE Genetic analysis of an Indian family with members affected with
Waardenburg syndrome and Duchenne muscular dystrophy
JOURNAL Mol. Vis. 18, 2022-2032 (2012)
PUBMED 22876130
REMARK GeneRIF: A novel missense mutation in EDN3 and a deletion mutation
in DMD has been found in the same Indian family members affected
with Waardenburg syndrome and Duchenne muscular dystrophy.
REFERENCE 6 (bases 1 to 14000)
AUTHORS Nigro,V., Politano,L., Nigro,G., Romano,S.C., Molinari,A.M. and
Puca,G.A.
TITLE Detection of a nonsense mutation in the dystrophin gene by multiple
SSCP
JOURNAL Hum. Mol. Genet. 1 (7), 517-520 (1992)
PUBMED 1307253
REFERENCE 7 (bases 1 to 14000)
AUTHORS Gorecki,D.C., Monaco,A.P., Derry,J.M., Walker,A.P., Barnard,E.A.
and Barnard,P.J.
TITLE Expression of four alternative dystrophin transcripts in brain
regions regulated by different promoters
JOURNAL Hum. Mol. Genet. 1 (7), 505-510 (1992)
PUBMED 1307251
REFERENCE 8 (bases 1 to 14000)
AUTHORS Lederfein,D., Levy,Z., Augier,N., Mornet,D., Morris,G., Fuchs,O.,
Yaffe,D. and Nudel,U.
TITLE A 71-kilodalton protein is a major product of the Duchenne muscular
dystrophy gene in brain and other nonmuscle tissues
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 89 (12), 5346-5350 (1992)
PUBMED 1319059
REFERENCE 9 (bases 1 to 14000)
AUTHORS Rapaport,D., Lederfein,D., den Dunnen,J.T., Grootscholten,P.M., Van
Ommen,G.J., Fuchs,O., Nudel,U. and Yaffe,D.
TITLE Characterization and cell type distribution of a novel, major
transcript of the Duchenne muscular dystrophy gene
JOURNAL Differentiation 49 (3), 187-193 (1992)
PUBMED 1377655
REFERENCE 10 (bases 1 to 14000)
AUTHORS Koenig,M., Monaco,A.P. and Kunkel,L.M.
TITLE The complete sequence of dystrophin predicts a rod-shaped
cytoskeletal protein
JOURNAL Cell 53 (2), 219-228 (1988)
PUBMED 3282674
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from S64152.1, AL049643.12,
M18533.1, AL109609.5 and BC028720.1.
On May 24, 2009 this sequence version replaced gi:150036263.
Summary: The dystrophin gene is the largest gene found in nature,
measuring 2.4 Mb. The gene was identified through a positional
cloning approach, targeted at the isolation of the gene responsible
for Duchenne (DMD) and Becker (BMD) Muscular Dystrophies. DMD is a
recessive, fatal, X-linked disorder occurring at a frequency of
about 1 in 3,500 new-born males. BMD is a milder allelic form. In
general, DMD patients carry mutations which cause premature
translation termination (nonsense or frame shift mutations), while
in BMD patients dystrophin is reduced either in molecular weight
(derived from in-frame deletions) or in expression level. The
dystrophin gene is highly complex, containing at least eight
independent, tissue-specific promoters and two polyA-addition
sites. Furthermore, dystrophin RNA is differentially spliced,
producing a range of different transcripts, encoding a large set of
protein isoforms. Dystrophin (as encoded by the Dp427 transcripts)
is a large, rod-like cytoskeletal protein which is found at the
inner surface of muscle fibers. Dystrophin is part of the
dystrophin-glycoprotein complex (DGC), which bridges the inner
cytoskeleton (F-actin) and the extra-cellular matrix. [provided by
RefSeq, Jul 2008].
Transcript Variant: transcript Dp427p1 initiates from a unique
promoter/exon 1 located in what corresponds to the first intron of
transcript Dp427m. The transcript adds the common exon 2 of Dp427m
and has a similar length (14 kb). The Dp427p1 isoform replaces the
MLWWEEVEDCY-start of Dp427m with a unique N-terminal MSEVSSD aa
sequence.
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
RNAseq introns :: mixed/partial sample support ERS025081, ERS025082
[ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: full length.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-29 S64152.1 1-29
30-54 AL049643.12 56182-56206 c
55-329 S64152.1 46-320
330-4656 M18533.1 287-4613
4657-4657 AL109609.5 79506-79506 c
4658-5780 M18533.1 4615-5737
5781-5781 AL109609.5 35892-35892 c
5782-12755 M18533.1 5739-12712
12756-14000 BC028720.1 3398-4642
FEATURES Location/Qualifiers
source 1..14000
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="X"
/map="Xp21.2"
gene 1..14000
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="dystrophin"
/db_xref="GeneID:1756"
/db_xref="HGNC:2928"
/db_xref="HPRD:02303"
/db_xref="MIM:300377"
variation 45
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:72470539"
variation 177
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:72470538"
misc_feature 240..242
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="upstream in-frame stop codon"
CDS 264..11309
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Dp427p1 isoform is encoded by transcript variant
Dp427p1"
/codon_start=1
/product="dystrophin Dp427p1 isoform"
/protein_id="NP_004000.1"
/db_xref="GI:5032287"
/db_xref="CCDS:CCDS55395.1"
/db_xref="GeneID:1756"
/db_xref="HGNC:2928"
/db_xref="HPRD:02303"
/db_xref="MIM:300377"
/translation="
MSEVSSDEREDVQKKTFTKWVNAQFSKFGKQHIENLFSDLQDGRRLLDLLEGLTGQKLPKEKGSTRVHALNNVNKALRVLQNNNVDLVNIGSTDIVDGNHKLTLGLIWNIILHWQVKNVMKNIMAGLQQTNSEKILLSWVRQSTRNYPQVNVINFTTSWSDGLALNALIHSHRPDLFDWNSVVCQQSATQRLEHAFNIARYQLGIEKLLDPEDVDTTYPDKKSILMYITSLFQVLPQQVSIEAIQEVEMLPRPPKVTKEEHFQLHHQMHYSQQITVSLAQGYERTSSPKPRFKSYAYTQAAYVTTSDPTRSPFPSQHLEAPEDKSFGSSLMESEVNLDRYQTALEEVLSWLLSAEDTLQAQGEISNDVEVVKDQFHTHEGYMMDLTAHQGRVGNILQLGSKLIGTGKLSEDEETEVQEQMNLLNSRWECLRVASMEKQSNLHRVLMDLQNQKLKELNDWLTKTEERTRKMEEEPLGPDLEDLKRQVQQHKVLQEDLEQEQVRVNSLTHMVVVVDESSGDHATAALEEQLKVLGDRWANICRWTEDRWVLLQDILLKWQRLTEEQCLFSAWLSEKEDAVNKIHTTGFKDQNEMLSSLQKLAVLKADLEKKKQSMGKLYSLKQDLLSTLKNKSVTQKTEAWLDNFARCWDNLVQKLEKSTAQISQAVTTTQPSLTQTTVMETVTTVTTREQILVKHAQEELPPPPPQKKRQITVDSEIRKRLDVDITELHSWITRSEAVLQSPEFAIFRKEGNFSDLKEKVNAIEREKAEKFRKLQDASRSAQALVEQMVNEGVNADSIKQASEQLNSRWIEFCQLLSERLNWLEYQNNIIAFYNQLQQLEQMTTTAENWLKIQPTTPSEPTAIKSQLKICKDEVNRLSGLQPQIERLKIQSIALKEKGQGPMFLDADFVAFTNHFKQVFSDVQAREKELQTIFDTLPPMRYQETMSAIRTWVQQSETKLSIPQLSVTDYEIMEQRLGELQALQSSLQEQQSGLYYLSTTVKEMSKKAPSEISRKYQSEFEEIEGRWKKLSSQLVEHCQKLEEQMNKLRKIQNHIQTLKKWMAEVDVFLKEEWPALGDSEILKKQLKQCRLLVSDIQTIQPSLNSVNEGGQKIKNEAEPEFASRLETELKELNTQWDHMCQQVYARKEALKGGLEKTVSLQKDLSEMHEWMTQAEEEYLERDFEYKTPDELQKAVEEMKRAKEEAQQKEAKVKLLTESVNSVIAQAPPVAQEALKKELETLTTNYQWLCTRLNGKCKTLEEVWACWHELLSYLEKANKWLNEVEFKLKTTENIPGGAEEISEVLDSLENLMRHSEDNPNQIRILAQTLTDGGVMDELINEELETFNSRWRELHEEAVRRQKLLEQSIQSAQETEKSLHLIQESLTFIDKQLAAYIADKVDAAQMPQEAQKIQSDLTSHEISLEEMKKHNQGKEAAQRVLSQIDVAQKKLQDVSMKFRLFQKPANFEQRLQESKMILDEVKMHLPALETKSVEQEVVQSQLNHCVNLYKSLSEVKSEVEMVIKTGRQIVQKKQTENPKELDERVTALKLHYNELGAKVTERKQQLEKCLKLSRKMRKEMNVLTEWLAATDMELTKRSAVEGMPSNLDSEVAWGKATQKEIEKQKVHLKSITEVGEALKTVLGKKETLVEDKLSLLNSNWIAVTSRAEEWLNLLLEYQKHMETFDQNVDHITKWIIQADTLLDESEKKKPQQKEDVLKRLKAELNDIRPKVDSTRDQAANLMANRGDHCRKLVEPQISELNHRFAAISHRIKTGKASIPLKELEQFNSDIQKLLEPLEAEIQQGVNLKEEDFNKDMNEDNEGTVKELLQRGDNLQQRITDERKREEIKIKQQLLQTKHNALKDLRSQRRKKALEISHQWYQYKRQADDLLKCLDDIEKKLASLPEPRDERKIKEIDRELQKKKEELNAVRRQAEGLSEDGAAMAVEPTQIQLSKRWREIESKFAQFRRLNFAQIHTVREETMMVMTEDMPLEISYVPSTYLTEITHVSQALLEVEQLLNAPDLCAKDFEDLFKQEESLKNIKDSLQQSSGRIDIIHSKKTAALQSATPVERVKLQEALSQLDFQWEKVNKMYKDRQGRFDRSVEKWRRFHYDIKIFNQWLTEAEQFLRKTQIPENWEHAKYKWYLKELQDGIGQRQTVVRTLNATGEEIIQQSSKTDASILQEKLGSLNLRWQEVCKQLSDRKKRLEEQKNILSEFQRDLNEFVLWLEEADNIASIPLEPGKEQQLKEKLEQVKLLVEELPLRQGILKQLNETGGPVLVSAPISPEEQDKLENKLKQTNLQWIKVSRALPEKQGEIEAQIKDLGQLEKKLEDLEEQLNHLLLWLSPIRNQLEIYNQPNQEGPFDVQETEIAVQAKQPDVEEILSKGQHLYKEKPATQPVKRKLEDLSSEWKAVNRLLQELRAKQPDLAPGLTTIGASPTQTVTLVTQPVVTKETAISKLEMPSSLMLEVPALADFNRAWTELTDWLSLLDQVIKSQRVMVGDLEDINEMIIKQKATMQDLEQRRPQLEELITAAQNLKNKTSNQEARTIITDRIERIQNQWDEVQEHLQNRRQQLNEMLKDSTQWLEAKEEAEQVLGQARAKLESWKEGPYTVDAIQKKITETKQLAKDLRQWQTNVDVANDLALKLLRDYSADDTRKVHMITENINASWRSIHKRVSEREAALEETHRLLQQFPLDLEKFLAWLTEAETTANVLQDATRKERLLEDSKGVKELMKQWQDLQGEIEAHTDVYHNLDENSQKILRSLEGSDDAVLLQRRLDNMNFKWSELRKKSLNIRSHLEASSDQWKRLHLSLQELLVWLQLKDDELSRQAPIGGDFPAVQKQNDVHRAFKRELKTKEPVIMSTLETVRIFLTEQPLEGLEKLYQEPRELPPEERAQNVTRLLRKQAEEVNTEWEKLNLHSADWQRKIDETLERLQELQEATDELDLKLRQAEVIKGSWQPVGDLLIDSLQDHLEKVKALRGEIAPLKENVSHVNDLARQLTTLGIQLSPYNLSTLEDLNTRWKLLQVAVEDRVRQLHEAHRDFGPASQHFLSTSVQGPWERAISPNKVPYYINHETQTTCWDHPKMTELYQSLADLNNVRFSAYRTAMKLRRLQKALCLDLLSLSAACDALDQHNLKQNDQPMDILQIINCLTTIYDRLEQEHNNLVNVPLCVDMCLNWLLNVYDTGRTGRIRVLSFKTGIISLCKAHLEDKYRYLFKQVASSTGFCDQRRLGLLLHDSIQIPRQLGEVASFGGSNIEPSVRSCFQFANNKPEIEAALFLDWMRLEPQSMVWLPVLHRVAAAETAKHQAKCNICKECPIIGFRYRSLKHFNYDICQSCFFSGRVAKGHKMHYPMVEYCTPTTSGEDVRDFAKVLKNKFRTKRYFAKHPRMGYLPVQTVLEGDNMETPVTLINFWPVDSAPASSPQLSHDDTHSRIEHYASRLAEMENSNGSYLNDSISPNESIDDEHLLIQHYCQSLNQDSPLSQPRSPAQILISLESEERGELERILADLEEENRNLQAEYDRLKQQHEHKGLSPLPSPPEMMPTSPQSPRDAELIAEAKLLRQHKGRLEARMQILEDHNKQLESQLHRLRQLLEQPQAEAKVNGTTVSSPSTSLQRSDSSQPMLLRVVGSQTSDSMGEEDLLSPPQDTSTGLEEVMEQLNNSFPSSRGRNTPGKPMREDTM
"
misc_feature 264..284
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: dystrophin Dp427p unique N-terminus"
misc_feature 285..971
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: Actin binding domain"
misc_feature 297..608
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Calponin homology domain; actin-binding domain
which may be present as a single copy or in tandem repeats
(which increases binding affinity). The CH domain is found
in cytoskeletal and signal transduction proteins,
including actin-binding proteins like...; Region: CH;
cd00014"
/db_xref="CDD:28898"
misc_feature order(297..302,306..314,321..323,330..332,492..497,
504..506,513..515,519..521,564..569,576..581,585..590,
597..602)
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="putative actin binding surface [polypeptide
binding]; other site"
/db_xref="CDD:28898"
misc_feature 654..971
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Calponin homology domain; actin-binding domain
which may be present as a single copy or in tandem repeats
(which increases binding affinity). The CH domain is found
in cytoskeletal and signal transduction proteins,
including actin-binding proteins like...; Region: CH;
cd00014"
/db_xref="CDD:28898"
misc_feature order(654..659,663..671,678..680,687..689,849..854,
861..863,873..875,879..881,927..932,939..944,948..953,
960..965)
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="putative actin binding surface [polypeptide
binding]; other site"
/db_xref="CDD:28898"
misc_feature 1008..9371
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: central rod domain"
misc_feature 1008..1232
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: hinge region 1"
misc_feature 1260..1592
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 1"
misc_feature 1272..1925
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 1593..1919
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 2"
misc_feature 1593..1610
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 1710..2258
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 1920..2252
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 3"
misc_feature 1923..1940
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 2253..2402
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: hinge region 2"
misc_feature 2403..2735
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 4"
misc_feature 2430..3050
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 2736..3053
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 5"
misc_feature 2736..2753
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 3054..3386
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 6"
misc_feature 3387..3713
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 7"
misc_feature 3396..4040
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 3714..4040
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 8"
misc_feature 3714..3731
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 4041..4352
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 9"
misc_feature 4053..4673
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 4353..4640
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 10"
misc_feature 4353..4370
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 4632..4955
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 11"
misc_feature 4650..5279
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 4956..5279
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 12"
misc_feature 4956..4973
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 5280..5585
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 13"
misc_feature 5286..5579
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeat; Region: Spectrin; pfam00435"
/db_xref="CDD:201223"
misc_feature 5361..6188
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Uncharacterized archaeal coiled-coil protein
[Function unknown]; Region: COG1340"
/db_xref="CDD:31531"
misc_feature 5586..5873
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 14"
misc_feature 5589..6155
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 5874..6170
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 15"
misc_feature 5877..5894
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 6225..6554
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 16"
misc_feature 6249..6875
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 6555..6875
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 17"
misc_feature 6555..6572
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 6564..7211
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 6876..7205
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 18"
misc_feature order(6876..6884,6888..6896)
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 7206..7520
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 19"
misc_feature 7521..7661
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: hinge region 3"
misc_feature 7662..7982
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 20"
misc_feature 7665..8315
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 7983..8309
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 21"
misc_feature 7983..8000
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 8310..8657
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 22"
misc_feature 8319..9050
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 8658..9044
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 23"
misc_feature 8658..8675
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 9045..9371
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: repeat region 24"
misc_feature 9054..>9386
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 9291..9587
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: hinge region 4"
misc_feature 9372..9386
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 9426..9515
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Two conserved tryptophans domain; also known as the
WWP or rsp5 domain; around 40 amino acids; functions as an
interaction module in a diverse set of signalling
proteins; binds specific proline-rich sequences but at low
affinities compared to other...; Region: WW; cd00201"
/db_xref="CDD:29258"
misc_feature 9426..9515
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: WW-domain"
misc_feature order(9465..9467,9498..9500)
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="binding pocket"
/db_xref="CDD:29258"
misc_feature 9489..10475
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: dystroglycan binding site"
misc_feature 9510..9872
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="EF hand; Region: efhand_1; pfam09068"
/db_xref="CDD:149945"
misc_feature 9549..10151
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: Cysteine-rich domain"
misc_feature 9639..9722
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: EF-hand 1"
misc_feature 9783..9869
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: EF-hand 2"
misc_feature 9882..10157
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="EF-hand; Region: efhand_2; pfam09069"
/db_xref="CDD:149946"
misc_feature 10149..11306
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: Carboxy-terminal region"
misc_feature 10182..10328
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: ZZ-domain"
misc_feature 10182..10328
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Zinc finger, ZZ type. Zinc finger present in
dystrophin and dystrobrevin. The ZZ motif coordinates two
zinc ions and most likely participates in ligand binding
or molecular scaffolding. Dystrophin attaches actin
filaments to an integral membrane...; Region:
ZZ_dystrophin; cd02334"
/db_xref="CDD:30238"
misc_feature order(10188..10190,10197..10199,10233..10235,10242..10244,
10260..10262,10269..10271,10299..10301,10311..10313)
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Zinc-binding sites [ion binding]; other site"
/db_xref="CDD:30238"
misc_feature order(10188..10190,10197..10199,10260..10262,10269..10271)
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="zinc cluster 1 [ion binding]; other site"
/db_xref="CDD:30238"
misc_feature order(10191..10193,10224..10226,10230..10232,10248..10250,
10254..10256)
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="putative charged binding surface; other site"
/db_xref="CDD:30238"
misc_feature order(10227..10229,10272..10274,10317..10319,10326..10328)
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="putative hydrophobic binding surface; other site"
/db_xref="CDD:30238"
misc_feature order(10233..10235,10242..10244,10299..10301,10311..10313)
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="zinc cluster 2 [ion binding]; other site"
/db_xref="CDD:30238"
misc_feature 10524..10526
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 10581..10733
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="alpha1-syntrophin binding site"
misc_feature 10734..10856
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="beta1-syntrophin binding site"
misc_feature 10923..11030
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/note="Region: (Leu)6-heptad repeat"
variation 649
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:1800256"
STS 789..897
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99269"
variation 1053
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:1800264"
variation 1088
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:1800265"
variation 1346
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:1800266"
variation 1349
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="t"
/db_xref="dbSNP:72470507"
STS 1529..2103
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="MARC_84337-84338:1278013457:1"
/db_xref="UniSTS:532589"
variation 1588
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:72468699"
variation 1921
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:1800257"
variation 1925
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="g"
/replace="t"
/db_xref="dbSNP:1800258"
STS 1991..2577
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="MARC_84339-84340:1278014518:1"
/db_xref="UniSTS:532590"
variation 2118
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:1800259"
variation 2120
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:1800267"
variation 2139
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:72468692"
variation 2602
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="g"
/db_xref="dbSNP:1800260"
variation 2642
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="g"
/replace="t"
/db_xref="dbSNP:72468681"
variation 2708
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:72468680"
variation 2741
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:72468679"
variation 3222
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="g"
/db_xref="dbSNP:72468667"
variation 3272
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:1800268"
variation 3281
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:72468666"
variation 3371
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:1800261"
variation 3840
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="g"
/replace="t"
/db_xref="dbSNP:1800262"
STS 3858..3956
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99474"
variation 3985
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:1800269"
variation 4083
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="g"
/db_xref="dbSNP:1800270"
variation 4382
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1800263"
variation 4526
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:72468647"
variation 4657
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="t"
/db_xref="dbSNP:1057872"
variation 4780
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:72468638"
STS 4783..4895
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99582"
variation 5128
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="t"
/db_xref="dbSNP:72468634"
variation 5228
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:1801185"
variation 5291
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:72468632"
variation 5414
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="g"
/db_xref="dbSNP:72468630"
variation 5485
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:1801187"
STS 5662..6219
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="MARC_84357-84358:1278016549:1"
/db_xref="UniSTS:532591"
variation 5710
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:1800271"
variation 5781
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:1064325"
variation 5783
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:1801186"
STS 5887..5981
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99541"
variation 6026
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:1800272"
variation 6279
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="g"
/replace="t"
/db_xref="dbSNP:72468613"
STS 6543..6667
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99225"
variation 6714
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:1800273"
STS 6917..6999
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99066"
variation 7079
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:72466595"
variation 7331
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:1800274"
variation 7347
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:1800275"
variation 7434
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:72466590"
STS 7615..7726
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DXS7499"
/db_xref="UniSTS:30753"
variation 7979
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:1801188"
variation 8071
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="t"
/db_xref="dbSNP:72466581"
STS 8136..8271
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99382"
variation 8306
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:1801189"
STS 8478..8577
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99545"
variation 8573
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:72466575"
variation 8747
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:72466574"
variation 8822
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:72466570"
variation 8830
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:72466569"
variation 9061
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:1800280"
STS 9072..9174
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99400"
variation 9103
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:72466567"
variation 9344
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:72466563"
variation 9345
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:72466562"
STS 9823..9890
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:99128"
variation 10871
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:72466538"
variation 11040
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="c"
/replace="t"
/db_xref="dbSNP:1800281"
variation 11269
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:1795743"
STS 11391..11584
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="PMC316713P2"
/db_xref="UniSTS:273040"
STS 11659..11847
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="G15848"
/db_xref="UniSTS:3168"
STS 11700..11832
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DXS1234"
/db_xref="UniSTS:146800"
variation 11789..11790
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="acac"
/replace="taca"
/db_xref="dbSNP:3833413"
variation 12233
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="acaa"
/db_xref="dbSNP:72466531"
variation 12277
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="t"
/db_xref="dbSNP:72466530"
STS 12315..12383
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DXS503"
/db_xref="UniSTS:99031"
variation 12357
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="gat"
/db_xref="dbSNP:72466529"
variation 12554
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="cttt"
/db_xref="dbSNP:72466527"
STS 12621..12771
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DXS6988E"
/db_xref="UniSTS:32060"
variation 12756
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:3361"
STS 12777..12877
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="A002S20"
/db_xref="UniSTS:57879"
variation 12874
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="aaag"
/db_xref="dbSNP:72466526"
variation 12900
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="tgtt"
/db_xref="dbSNP:72466525"
variation 13040
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:3198427"
variation 13067
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="ttcat"
/db_xref="dbSNP:72466524"
variation 13348
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="c"
/db_xref="dbSNP:72466523"
variation 13462
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="atgtgacgctggacctt"
/db_xref="dbSNP:72466522"
variation 13494
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="t"
/db_xref="dbSNP:11550191"
variation 13546
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="aagt"
/db_xref="dbSNP:72466521"
STS 13627..13818
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="DMD"
/db_xref="UniSTS:506537"
variation 13736
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace="a"
/replace="g"
/db_xref="dbSNP:1057915"
STS 13884..13968
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/standard_name="PMC108984P1"
/db_xref="UniSTS:270148"
variation 13890
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
/replace=""
/replace="actt"
/db_xref="dbSNP:72466520"
polyA_signal 13978..13983
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
polyA_site 14000
/gene="DMD"
/gene_synonym="BMD; CMD3B; DXS142; DXS164; DXS206; DXS230;
DXS239; DXS268; DXS269; DXS270; DXS272"
ORIGIN
atgctgtctgtgaagctgaatctgtgagaacacctcactattcacggcaaccggagtggaagaaacaggtgcaaaaagattgtgtgtttgtctgcttttgtgaggctggtcagagattctgtgcctgctttatctgtgcttggctatgactctacctccaggtttaccataccccatagaatgtgtaagagaaaagtaccaacagggaaatcagcaaaaagctttcctatgaaggtgtgtagccagcctccgcagaatttgaaatgtctgaggtctcatctgatgaaagagaagatgttcaaaagaaaacattcacaaaatgggtaaatgcacaattttctaagtttgggaagcagcatattgagaacctcttcagtgacctacaggatgggaggcgcctcctagacctcctcgaaggcctgacagggcaaaaactgccaaaagaaaaaggatccacaagagttcatgccctgaacaatgtcaacaaggcactgcgggttttgcagaacaataatgttgatttagtgaatattggaagtactgacatcgtagatggaaatcataaactgactcttggtttgatttggaatataatcctccactggcaggtcaaaaatgtaatgaaaaatatcatggctggattgcaacaaaccaacagtgaaaagattctcctgagctgggtccgacaatcaactcgtaattatccacaggttaatgtaatcaacttcaccaccagctggtctgatggcctggctttgaatgctctcatccatagtcataggccagacctatttgactggaatagtgtggtttgccagcagtcagccacacaacgactggaacatgcattcaacatcgccagatatcaattaggcatagagaaactactcgatcctgaagatgttgataccacctatccagataagaagtccatcttaatgtacatcacatcactcttccaagttttgcctcaacaagtgagcattgaagccatccaggaagtggaaatgttgccaaggccacctaaagtgactaaagaagaacattttcagttacatcatcaaatgcactattctcaacagatcacggtcagtctagcacagggatatgagagaacttcttcccctaagcctcgattcaagagctatgcctacacacaggctgcttatgtcaccacctctgaccctacacggagcccatttccttcacagcatttggaagctcctgaagacaagtcatttggcagttcattgatggagagtgaagtaaacctggaccgttatcaaacagctttagaagaagtattatcgtggcttctttctgctgaggacacattgcaagcacaaggagagatttctaatgatgtggaagtggtgaaagaccagtttcatactcatgaggggtacatgatggatttgacagcccatcagggccgggttggtaatattctacaattgggaagtaagctgattggaacaggaaaattatcagaagatgaagaaactgaagtacaagagcagatgaatctcctaaattcaagatgggaatgcctcagggtagctagcatggaaaaacaaagcaatttacatagagttttaatggatctccagaatcagaaactgaaagagttgaatgactggctaacaaaaacagaagaaagaacaaggaaaatggaggaagagcctcttggacctgatcttgaagacctaaaacgccaagtacaacaacataaggtgcttcaagaagatctagaacaagaacaagtcagggtcaattctctcactcacatggtggtggtagttgatgaatctagtggagatcacgcaactgctgctttggaagaacaacttaaggtattgggagatcgatgggcaaacatctgtagatggacagaagaccgctgggttcttttacaagacatccttctcaaatggcaacgtcttactgaagaacagtgcctttttagtgcatggctttcagaaaaagaagatgcagtgaacaagattcacacaactggctttaaagatcaaaatgaaatgttatcaagtcttcaaaaactggccgttttaaaagcggatctagaaaagaaaaagcaatccatgggcaaactgtattcactcaaacaagatcttctttcaacactgaagaataagtcagtgacccagaagacggaagcatggctggataactttgcccggtgttgggataatttagtccaaaaacttgaaaagagtacagcacagatttcacaggctgtcaccaccactcagccatcactaacacagacaactgtaatggaaacagtaactacggtgaccacaagggaacagatcctggtaaagcatgctcaagaggaacttccaccaccacctccccaaaagaagaggcagattactgtggattctgaaattaggaaaaggttggatgttgatataactgaacttcacagctggattactcgctcagaagctgtgttgcagagtcctgaatttgcaatctttcggaaggaaggcaacttctcagacttaaaagaaaaagtcaatgccatagagcgagaaaaagctgagaagttcagaaaactgcaagatgccagcagatcagctcaggccctggtggaacagatggtgaatgagggtgttaatgcagatagcatcaaacaagcctcagaacaactgaacagccggtggatcgaattctgccagttgctaagtgagagacttaactggctggagtatcagaacaacatcatcgctttctataatcagctacaacaattggagcagatgacaactactgctgaaaactggttgaaaatccaacccaccaccccatcagagccaacagcaattaaaagtcagttaaaaatttgtaaggatgaagtcaaccggctatcaggtcttcaacctcaaattgaacgattaaaaattcaaagcatagccctgaaagagaaaggacaaggacccatgttcctggatgcagactttgtggcctttacaaatcattttaagcaagtcttttctgatgtgcaggccagagagaaagagctacagacaatttttgacactttgccaccaatgcgctatcaggagaccatgagtgccatcaggacatgggtccagcagtcagaaaccaaactctccatacctcaacttagtgtcaccgactatgaaatcatggagcagagactcggggaattgcaggctttacaaagttctctgcaagagcaacaaagtggcctatactatctcagcaccactgtgaaagagatgtcgaagaaagcgccctctgaaattagccggaaatatcaatcagaatttgaagaaattgagggacgctggaagaagctctcctcccagctggttgagcattgtcaaaagctagaggagcaaatgaataaactccgaaaaattcagaatcacatacaaaccctgaagaaatggatggctgaagttgatgtttttctgaaggaggaatggcctgcccttggggattcagaaattctaaaaaagcagctgaaacagtgcagacttttagtcagtgatattcagacaattcagcccagtctaaacagtgtcaatgaaggtgggcagaagataaagaatgaagcagagccagagtttgcttcgagacttgagacagaactcaaagaacttaacactcagtgggatcacatgtgccaacaggtctatgccagaaaggaggccttgaagggaggtttggagaaaactgtaagcctccagaaagatctatcagagatgcacgaatggatgacacaagctgaagaagagtatcttgagagagattttgaatataaaactccagatgaattacagaaagcagttgaagagatgaagagagctaaagaagaggcccaacaaaaagaagcgaaagtgaaactccttactgagtctgtaaatagtgtcatagctcaagctccacctgtagcacaagaggccttaaaaaaggaacttgaaactctaaccaccaactaccagtggctctgcactaggctgaatgggaaatgcaagactttggaagaagtttgggcatgttggcatgagttattgtcatacttggagaaagcaaacaagtggctaaatgaagtagaatttaaacttaaaaccactgaaaacattcctggcggagctgaggaaatctctgaggtgctagattcacttgaaaatttgatgcgacattcagaggataacccaaatcagattcgcatattggcacagaccctaacagatggcggagtcatggatgagctaatcaatgaggaacttgagacatttaattctcgttggagggaactacatgaagaggctgtaaggaggcaaaagttgcttgaacagagcatccagtctgcccaggagactgaaaaatccttacacttaatccaggagtccctcacattcattgacaagcagttggcagcttatattgcagacaaggtggacgcagctcaaatgcctcaggaagcccagaaaatccaatctgatttgacaagtcatgagatcagtttagaagaaatgaagaaacataatcaggggaaggaggctgcccaaagagtcctgtctcagattgatgttgcacagaaaaaattacaagatgtctccatgaagtttcgattattccagaaaccagccaattttgagcagcgtctacaagaaagtaagatgattttagatgaagtgaagatgcacttgcctgcattggaaacaaagagtgtggaacaggaagtagtacagtcacagctaaatcattgtgtgaacttgtataaaagtctgagtgaagtgaagtctgaagtggaaatggtgataaagactggacgtcagattgtacagaaaaagcagacggaaaatcccaaagaacttgatgaaagagtaacagctttgaaattgcattataatgagctgggagcaaaggtaacagaaagaaagcaacagttggagaaatgcttgaaattgtcccgtaagatgcgaaaggaaatgaatgtcttgacagaatggctggcagctacagatatggaattgacaaagagatcagcagttgaaggaatgcctagtaatttggattctgaagttgcctggggaaaggctactcaaaaagagattgagaaacagaaggtgcacctgaagagtatcacagaggtaggagaggccttgaaaacagttttgggcaagaaggagacgttggtggaagataaactcagtcttctgaatagtaactggatagctgtcacctcccgagcagaagagtggttaaatcttttgttggaataccagaaacacatggaaacttttgaccagaatgtggaccacatcacaaagtggatcattcaggctgacacacttttggatgaatcagagaaaaagaaaccccagcaaaaagaagacgtgcttaagcgtttaaaggcagaactgaatgacatacgcccaaaggtggactctacacgtgaccaagcagcaaacttgatggcaaaccgcggtgaccactgcaggaaattagtagagccccaaatctcagagctcaaccatcgatttgcagccatttcacacagaattaagactggaaaggcctccattcctttgaaggaattggagcagtttaactcagatatacaaaaattgcttgaaccactggaggctgaaattcagcagggggtgaatctgaaagaggaagacttcaataaagatatgaatgaagacaatgagggtactgtaaaagaattgttgcaaagaggagacaacttacaacaaagaatcacagatgagagaaagcgagaggaaataaagataaaacagcagctgttacagacaaaacataatgctctcaaggatttgaggtctcaaagaagaaaaaaggctctagaaatttctcatcagtggtatcagtacaagaggcaggctgatgatctcctgaaatgcttggatgacattgaaaaaaaattagccagcctacctgagcccagagatgaaaggaaaataaaggaaattgatcgggaattgcagaagaagaaagaggagctgaatgcagtgcgtaggcaagctgagggcttgtctgaggatggggccgcaatggcagtggagccaactcagatccagctcagcaagcgctggcgggaaattgagagcaaatttgctcagtttcgaagactcaactttgcacaaattcacactgtccgtgaagaaacgatgatggtgatgactgaagacatgcctttggaaatttcttatgtgccttctacttatttgactgaaatcactcatgtctcacaagccctattagaagtggaacaacttctcaatgctcctgacctctgtgctaaggactttgaagatctctttaagcaagaggagtctctgaagaatataaaagatagtctacaacaaagctcaggtcggattgacattattcatagcaagaagacagcagcattgcaaagtgcaacgcctgtggaaagggtgaagctacaggaagctctctcccagcttgatttccaatgggaaaaagttaacaaaatgtacaaggaccgacaagggcgatttgacagatctgttgagaaatggcggcgttttcattatgatataaagatatttaatcagtggctaacagaagctgaacagtttctcagaaagacacaaattcctgagaattgggaacatgctaaatacaaatggtatcttaaggaactccaggatggcattgggcagcggcaaactgttgtcagaacattgaatgcaactggggaagaaataattcagcaatcctcaaaaacagatgccagtattctacaggaaaaattgggaagcctgaatctgcggtggcaggaggtctgcaaacagctgtcagacagaaaaaagaggctagaagaacaaaagaatatcttgtcagaatttcaaagagatttaaatgaatttgttttatggttggaggaagcagataacattgctagtatcccacttgaacctggaaaagagcagcaactaaaagaaaagcttgagcaagtcaagttactggtggaagagttgcccctgcgccagggaattctcaaacaattaaatgaaactggaggacccgtgcttgtaagtgctcccataagcccagaagagcaagataaacttgaaaataagctcaagcagacaaatctccagtggataaaggtttccagagctttacctgagaaacaaggagaaattgaagctcaaataaaagaccttgggcagcttgaaaaaaagcttgaagaccttgaagagcagttaaatcatctgctgctgtggttatctcctattaggaatcagttggaaatttataaccaaccaaaccaagaaggaccatttgacgttcaggaaactgaaatagcagttcaagctaaacaaccggatgtggaagagattttgtctaaagggcagcatttgtacaaggaaaaaccagccactcagccagtgaagaggaagttagaagatctgagctctgagtggaaggcggtaaaccgtttacttcaagagctgagggcaaagcagcctgacctagctcctggactgaccactattggagcctctcctactcagactgttactctggtgacacaacctgtggttactaaggaaactgccatctccaaactagaaatgccatcttccttgatgttggaggtacctgctctggcagatttcaaccgggcttggacagaacttaccgactggctttctctgcttgatcaagttataaaatcacagagggtgatggtgggtgaccttgaggatatcaacgagatgatcatcaagcagaaggcaacaatgcaggatttggaacagaggcgtccccagttggaagaactcattaccgctgcccaaaatttgaaaaacaagaccagcaatcaagaggctagaacaatcattacggatcgaattgaaagaattcagaatcagtgggatgaagtacaagaacaccttcagaaccggaggcaacagttgaatgaaatgttaaaggattcaacacaatggctggaagctaaggaagaagctgagcaggtcttaggacaggccagagccaagcttgagtcatggaaggagggtccctatacagtagatgcaatccaaaagaaaatcacagaaaccaagcagttggccaaagacctccgccagtggcagacaaatgtagatgtggcaaatgacttggccctgaaacttctccgggattattctgcagatgataccagaaaagtccacatgataacagagaatatcaatgcctcttggagaagcattcataaaagggtgagtgagcgagaggctgctttggaagaaactcatagattactgcaacagttccccctggacctggaaaagtttcttgcctggcttacagaagctgaaacaactgccaatgtcctacaggatgctacccgtaaggaaaggctcctagaagactccaagggagtaaaagagctgatgaaacaatggcaagacctccaaggtgaaattgaagctcacacagatgtttatcacaacctggatgaaaacagccaaaaaatcctgagatccctggaaggttccgatgatgcagtcctgttacaaagacgtttggataacatgaacttcaagtggagtgaacttcggaaaaagtctctcaacattaggtcccatttggaagccagttctgaccagtggaagcgtctgcacctttctctgcaggaacttctggtgtggctacagctgaaagatgatgaattaagccggcaggcacctattggaggcgactttccagcagttcagaagcagaacgatgtacatagggccttcaagagggaattgaaaactaaagaacctgtaatcatgagtactcttgagactgtacgaatatttctgacagagcagcctttggaaggactagagaaactctaccaggagcccagagagctgcctcctgaggagagagcccagaatgtcactcggcttctacgaaagcaggctgaggaggtcaatactgagtgggaaaaattgaacctgcactccgctgactggcagagaaaaatagatgagacccttgaaagactccaggaacttcaagaggccacggatgagctggacctcaagctgcgccaagctgaggtgatcaagggatcctggcagcccgtgggcgatctcctcattgactctctccaagatcacctcgagaaagtcaaggcacttcgaggagaaattgcgcctctgaaagagaacgtgagccacgtcaatgaccttgctcgccagcttaccactttgggcattcagctctcaccgtataacctcagcactctggaagacctgaacaccagatggaagcttctgcaggtggccgtcgaggaccgagtcaggcagctgcatgaagcccacagggactttggtccagcatctcagcactttctttccacgtctgtccagggtccctgggagagagccatctcgccaaacaaagtgccctactatatcaaccacgagactcaaacaacttgctgggaccatcccaaaatgacagagctctaccagtctttagctgacctgaataatgtcagattctcagcttataggactgccatgaaactccgaagactgcagaaggccctttgcttggatctcttgagcctgtcagctgcatgtgatgccttggaccagcacaacctcaagcaaaatgaccagcccatggatatcctgcagattattaattgtttgaccactatttatgaccgcctggagcaagagcacaacaatttggtcaacgtccctctctgcgtggatatgtgtctgaactggctgctgaatgtttatgatacgggacgaacagggaggatccgtgtcctgtcttttaaaactggcatcatttccctgtgtaaagcacatttggaagacaagtacagataccttttcaagcaagtggcaagttcaacaggattttgtgaccagcgcaggctgggcctccttctgcatgattctatccaaattccaagacagttgggtgaagttgcatcctttgggggcagtaacattgagccaagtgtccggagctgcttccaatttgctaataataagccagagatcgaagcggccctcttcctagactggatgagactggaaccccagtccatggtgtggctgcccgtcctgcacagagtggctgctgcagaaactgccaagcatcaggccaaatgtaacatctgcaaagagtgtccaatcattggattcaggtacaggagtctaaagcactttaattatgacatctgccaaagctgctttttttctggtcgagttgcaaaaggccataaaatgcactatcccatggtggaatattgcactccgactacatcaggagaagatgttcgagactttgccaaggtactaaaaaacaaatttcgaaccaaaaggtattttgcgaagcatccccgaatgggctacctgccagtgcagactgtcttagagggggacaacatggaaactcccgttactctgatcaacttctggccagtagattctgcgcctgcctcgtcccctcagctttcacacgatgatactcattcacgcattgaacattatgctagcaggctagcagaaatggaaaacagcaatggatcttatctaaatgatagcatctctcctaatgagagcatagatgatgaacatttgttaatccagcattactgccaaagtttgaaccaggactcccccctgagccagcctcgtagtcctgcccagatcttgatttccttagagagtgaggaaagaggggagctagagagaatcctagcagatcttgaggaagaaaacaggaatctgcaagcagaatatgaccgtctaaagcagcagcacgaacataaaggcctgtccccactgccgtcccctcctgaaatgatgcccacctctccccagagtccccgggatgctgagctcattgctgaggccaagctactgcgtcaacacaaaggccgcctggaagccaggatgcaaatcctggaagaccacaataaacagctggagtcacagttacacaggctaaggcagctgctggagcaaccccaggcagaggccaaagtgaatggcacaacggtgtcctctccttctacctctctacagaggtccgacagcagtcagcctatgctgctccgagtggttggcagtcaaacttcggactccatgggtgaggaagatcttctcagtcctccccaggacacaagcacagggttagaggaggtgatggagcaactcaacaactccttccctagttcaagaggaagaaatacccctggaaagccaatgagagaggacacaatgtaggaagtcttttccacatggcagatgatttgggcagagcgatggagtccttagtatcagtcatgacagatgaagaaggagcagaataaatgttttacaactcctgattcccgcatggtttttataatattcatacaacaaagaggattagacagtaagagtttacaagaaataaatctatatttttgtgaagggtagtggtattatactgtagatttcagtagtttctaagtctgttattgttttgttaacaatggcaggttttacacgtctatgcaattgtacaaaaaagttataagaaaactacatgtaaaatcttgatagctaaataacttgccatttctttatatggaacgcattttgggttgtttaaaaatttataacagttataaagaaagattgtaaactaaagtgtgctttataaaaaaaagttgtttataaaaacccctaaaaacaaaacaaacacacacacacacacatacacacacacacacaaaactttgaggcagcgcattgttttgcatccttttggcgtgatatccatatgaaattcatggctttttctttttttgcatattaaagataagacttcctctaccaccacaccaaatgactactacacactgctcatttgagaactgtcagctgagtggggcaggcttgagttttcatttcatatatctatatgtctataagtatataaatactatagttatatagataaagagatacgaatttctatagactgactttttccattttttaaatgttcatgtcacatcctaatagaaagaaattacttctagtcagtcatccaggcttacctgcttggtctagaatggatttttcccggagccggaagccaggaggaaactacaccacactaaaacattgtctacagctccagatgtttctcattttaaacaactttccactgacaacgaaagtaaagtaaagtattggatttttttaaagggaacatgtgaatgaatacacaggacttattatatcagagtgagtaatcggttggttggttgattgattgattgattgatacattcagcttcctgctgctagcaatgccacgatttagatttaatgatgcttcagtggaaatcaatcagaaggtattctgaccttgtgaacatcagaaggtattttttaactcccaagcagtagcaggacgatgatagggctggagggctatggattcccagcccatccctgtgaaggagtaggccactctttaagtgaaggattggatgattgttcataatacataaagttctctgtaattacaactaaattattatgccctcttctcacagtcaaaaggaactgggtggtttggtttttgttgcttttttagatttattgtcccatgtgggatgagtttttaaatgccacaagacataatttaaaataaataaactttgggaaaaggtgtaaaacagtagccccatcacatttgtgatactgacaggtatcaacccagaagcccatgaactgtgtttccatcctttgcatttctctgcgagtagttccacacaggtttgtaagtaagtaagaaagaaggcaaattgattcaaatgttacaaaaaaacccttcttggtggattagacaggttaaatatataaacaaacaaacaaaaattgctcaaaaaagaggagaaaagctcaagaggaaaagctaaggactggtaggaaaaagctttactctttcatgccattttatttctttttgatttttaaatcattcattcaatagataccaccgtgtgacctataattttgcaaatctgttacctctgacatcaagtgtaattagcttttggagagtgggctgacatcaagtgtaattagcttttggagagtgggttttgtccattattaataattaattaattaacatcaaacacggcttctcatgctatttctacctcactttggttttggggtgttcctgataattgtgcacacctgagttcacagcttcaccacttgtccattgcgttattttctttttcctttataattctttctttttccttcataattttcaaaagaaaacccaaagctctaaggtaacaaattaccaaattacatgaagatttggtttttgtcttgcatttttttcctttatgtgacgctggaccttttctttacccaaggatttttaaaactcagatttaaaacaaggggttactttacatcctactaagaagtttaagtaagtaagtttcattctaaaatcagaggtaaatagagtgcataaataattttgttttaatctttttgtttttcttttagacacattagctctggagtgagtctgtcataatatttgaacaaaaattgagagctttattgctgcattttaagcataattaatttggacattatttcgtgttgtgttctttataaccaccaagtattaaactgtaaatcataatgtaactgaagcataaacatcacatggcatgttttgtcattgttttcaggtactgagttcttacttgagtatcataatatattgtgttttaacaccaacactgtaacatttacgaattatttttttaaacttcagttttactgcattttcacaacatatcagacttcaccaaatatatgccttactattgtattatagtactgctttactgtgtatctcaataaagcacgcagttatgttac
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:1756 -> Molecular function: GO:0002162 [dystroglycan binding] evidence: IPI
GeneID:1756 -> Molecular function: GO:0003779 [actin binding] evidence: IDA
GeneID:1756 -> Molecular function: GO:0003779 [actin binding] evidence: TAS
GeneID:1756 -> Molecular function: GO:0005200 [structural constituent of cytoskeleton] evidence: TAS
GeneID:1756 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA
GeneID:1756 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:1756 -> Molecular function: GO:0008270 [zinc ion binding] evidence: IEA
GeneID:1756 -> Molecular function: GO:0008307 [structural constituent of muscle] evidence: IDA
GeneID:1756 -> Molecular function: GO:0008307 [structural constituent of muscle] evidence: TAS
GeneID:1756 -> Molecular function: GO:0017022 [myosin binding] evidence: IDA
GeneID:1756 -> Molecular function: GO:0017166 [vinculin binding] evidence: IPI
GeneID:1756 -> Molecular function: GO:0050998 [nitric-oxide synthase binding] evidence: ISS
GeneID:1756 -> Biological process: GO:0001954 [positive regulation of cell-matrix adhesion] evidence: IEA
GeneID:1756 -> Biological process: GO:0002027 [regulation of heart rate] evidence: IMP
GeneID:1756 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: IEA
GeneID:1756 -> Biological process: GO:0007517 [muscle organ development] evidence: NAS
GeneID:1756 -> Biological process: GO:0008065 [establishment of blood-nerve barrier] evidence: IEA
GeneID:1756 -> Biological process: GO:0010880 [regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum] evidence: ISS
GeneID:1756 -> Biological process: GO:0010881 [regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion] evidence: ISS
GeneID:1756 -> Biological process: GO:0010976 [positive regulation of neuron projection development] evidence: IMP
GeneID:1756 -> Biological process: GO:0014809 [regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion] evidence: ISS
GeneID:1756 -> Biological process: GO:0014819 [regulation of skeletal muscle contraction] evidence: ISS
GeneID:1756 -> Biological process: GO:0014904 [myotube cell development] evidence: IEA
GeneID:1756 -> Biological process: GO:0021629 [olfactory nerve structural organization] evidence: IEA
GeneID:1756 -> Biological process: GO:0030049 [muscle filament sliding] evidence: TAS
GeneID:1756 -> Biological process: GO:0030198 [extracellular matrix organization] evidence: TAS
GeneID:1756 -> Biological process: GO:0033137 [negative regulation of peptidyl-serine phosphorylation] evidence: ISS
GeneID:1756 -> Biological process: GO:0034613 [cellular protein localization] evidence: IMP
GeneID:1756 -> Biological process: GO:0043043 [peptide biosynthetic process] evidence: IDA
GeneID:1756 -> Biological process: GO:0043623 [cellular protein complex assembly] evidence: ISS
GeneID:1756 -> Biological process: GO:0044458 [motile cilium assembly] evidence: TAS
GeneID:1756 -> Biological process: GO:0045213 [neurotransmitter receptor metabolic process] evidence: IEA
GeneID:1756 -> Biological process: GO:0045666 [positive regulation of neuron differentiation] evidence: IMP
GeneID:1756 -> Biological process: GO:0046716 [muscle cell homeostasis] evidence: IEA
GeneID:1756 -> Biological process: GO:0048747 [muscle fiber development] evidence: IEA
GeneID:1756 -> Biological process: GO:0051647 [nucleus localization] evidence: IEA
GeneID:1756 -> Biological process: GO:0060048 [cardiac muscle contraction] evidence: IMP
GeneID:1756 -> Biological process: GO:0060314 [regulation of ryanodine-sensitive calcium-release channel activity] evidence: ISS
GeneID:1756 -> Biological process: GO:0060857 [establishment of glial blood-brain barrier] evidence: IEA
GeneID:1756 -> Biological process: GO:0086001 [regulation of cardiac muscle cell action potential] evidence: ISS
GeneID:1756 -> Biological process: GO:0090287 [regulation of cellular response to growth factor stimulus] evidence: IMP
GeneID:1756 -> Biological process: GO:1901385 [regulation of voltage-gated calcium channel activity] evidence: ISS
GeneID:1756 -> Biological process: GO:2000169 [regulation of peptidyl-cysteine S-nitrosylation] evidence: ISS
GeneID:1756 -> Biological process: GO:2000651 [positive regulation of sodium ion transmembrane transporter activity] evidence: ISS
GeneID:1756 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:1756 -> Cellular component: GO:0005634 [nucleus] evidence: TAS
GeneID:1756 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
GeneID:1756 -> Cellular component: GO:0005856 [cytoskeleton] evidence: IEA
GeneID:1756 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
GeneID:1756 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS
GeneID:1756 -> Cellular component: GO:0009986 [cell surface] evidence: IDA
GeneID:1756 -> Cellular component: GO:0015629 [actin cytoskeleton] evidence: TAS
GeneID:1756 -> Cellular component: GO:0016010 [dystrophin-associated glycoprotein complex] evidence: IDA
GeneID:1756 -> Cellular component: GO:0016010 [dystrophin-associated glycoprotein complex] evidence: NAS
GeneID:1756 -> Cellular component: GO:0016010 [dystrophin-associated glycoprotein complex] evidence: TAS
GeneID:1756 -> Cellular component: GO:0030018 [Z disc] evidence: IEA
GeneID:1756 -> Cellular component: GO:0030055 [cell-substrate junction] evidence: IEA
GeneID:1756 -> Cellular component: GO:0030175 [filopodium] evidence: IDA
GeneID:1756 -> Cellular component: GO:0042383 [sarcolemma] evidence: IDA
GeneID:1756 -> Cellular component: GO:0043034 [costamere] evidence: IDA
GeneID:1756 -> Cellular component: GO:0043234 [protein complex] evidence: IDA
GeneID:1756 -> Cellular component: GO:0044306 [neuron projection terminus] evidence: IEA
GeneID:1756 -> Cellular component: GO:0045121 [membrane raft] evidence: IEA
GeneID:1756 -> Cellular component: GO:0045121 [membrane raft] evidence: TAS
GeneID:1756 -> Cellular component: GO:0045211 [postsynaptic membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.